Nicotinamide Mononucleotide Prevents Retinal Dysfunction in a Mouse Model of Retinal Ischemia/Reperfusion Injury
Abstract
1. Introduction
2. Results
2.1. NMN Treatment Prevents Retinal Dysfunction in a Mouse Model of Retinal I/R Injury Induced by Acute Elevation of Intraocular Pressure
2.2. NMN Treatment Reduces Retinal Inflammation in a Mouse Model of Retinal I/R Injury Induced by Acute Elevation of Intraocular Pressure
2.3. NMN Treatment Exerts Neuroprotection in Retinal 661W Cells under CoCl2-Induced Oxidative Stress Conditions
2.4. NMN Treatment Upregulates the Antioxidant Genes in Retinal 661W Cells under CoCl2-Induced Oxidative Stress Conditions
3. Discussion
4. Materials and Methods
4.1. Animal and Retinal Ischemia/Reperfusion (I/R) Injury
4.2. Electroretinography (ERG)
4.3. Immunohistochemistry (IHC)
4.4. Cell Culture
4.5. Terminal Deoxynucleotidyl Transferase dUTP Nick end Labeling (TUNEL) and MTT Assays
4.6. Quantitative PCR (qPCR)
4.7. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Hangai, M.; Yoshimura, N.; Hiroi, K.; Mandai, M.; Honda, Y. Inducible nitric oxide synthase in retinal ischemia-reperfusion injury. Exp. Eye Res. 1996, 63, 501–509. [Google Scholar] [CrossRef] [Scilit]
- Neufeld, A.H.; Kawai, S.; Das, S.; Vora, S.; Gachie, E.; Connor, J.R.; Manning, P.T. Loss of retinal ganglion cells following retinal ischemia: The role of inducible nitric oxide synthase. Exp. Eye Res. 2002, 75, 521–528. [Google Scholar] [CrossRef] [Scilit]
- Wei, Y.; Gong, J.; Yoshida, T.; Eberhart, C.G.; Xu, Z.; Kombairaju, P.; Sporn, M.B.; Handa, J.T.; Duh, E.J. Nrf2 has a protective role against neuronal and capillary degeneration in retinal ischemia-reperfusion injury. Free. Radic. Biol. Med. 2011, 51, 216–224. [Google Scholar] [CrossRef] [Scilit]
- Minhas, G.; Morishita, R.; Anand, A. Preclinical models to investigate retinal ischemia: Advances and drawbacks. Front. Neurol. 2012, 3, 75. [Google Scholar] [CrossRef] [Scilit]
- Shah, M.; Cabrera-Ghayouri, S.; Christie, L.A.; Held, K.S.; Viswanath, V. Translational Preclinical Pharmacologic Disease Models for Ophthalmic Drug Development. Pharm. Res. 2019, 36, 58. [Google Scholar] [CrossRef] [Scilit]
- Shade, C. The Science Behind NMN-A Stable, Reliable NAD+Activator and Anti-Aging Molecule. Integr. Med. 2020, 19, 12–14. [Google Scholar]
- Braidy, N.; Berg, J.; Clement, J.; Khorshidi, F.; Poljak, A.; Jayasena, T.; Grant, R.; Sachdev, P. Role of Nicotinamide Adenine Dinucleotide and Related Precursors as Therapeutic Targets for Age-Related Degenerative Diseases: Rationale, Biochemistry, Pharmacokinetics, and Outcomes. Antioxid. Redox Signal. 2019, 30, 251–294. [Google Scholar] [CrossRef] [Scilit]
- Nadeeshani, H.; Li, J.; Ying, T.; Zhang, B.; Lu, J. Nicotinamide mononucleotide (NMN) as an anti-aging health product—Promises and safety concerns. J. Adv. Res. 2022, 37, 267–278. [Google Scholar] [CrossRef] [Scilit]
- Lin, J.B.; Kubota, S.; Ban, N.; Yoshida, M.; Santeford, A.; Sene, A.; Nakamura, R.; Zapata, N.; Kubota, M.; Tsubota, K.; et al. NAMPT-Mediated NAD(+) Biosynthesis Is Essential for Vision in Mice. Cell Rep. 2016, 17, 69–85. [Google Scholar] [CrossRef] [Scilit]
- Chen, X.; Amorim, J.A.; Moustafa, G.A.; Lee, J.J.; Yu, Z.; Ishihara, K.; Iesato, Y.; Barbisan, P.; Ueta, T.; Togka, K.A.; et al. Neuroprotective effects and mechanisms of action of nicotinamide mononucleotide (NMN) in a photoreceptor degenerative model of retinal detachment. Aging 2020, 12, 24504–24521. [Google Scholar] [CrossRef] [Scilit]
- Yoshino, J.; Mills, K.F.; Yoon, M.J.; Imai, S. Nicotinamide mononucleotide, a key NAD(+) intermediate, treats the pathophysiology of diet- and age-induced diabetes in mice. Cell Metab. 2011, 14, 528–536. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ramanathan, C.; Lackie, T.; Williams, D.H.; Simone, P.S.; Zhang, Y.; Bloomer, R.J. Oral Administration of Nicotinamide Mononucleotide Increases Nicotinamide Adenine Dinucleotide Level in an Animal Brain. Nutrients 2022, 14, 300. [Google Scholar] [CrossRef] [Scilit]
- Lee, D.; Nakai, A.; Miwa, Y.; Tomita, Y.; Kunimi, H.; Chen, J.; Ikeda, S.I.; Tsubota, K.; Negishi, K.; Kurihara, T. Retinal degeneration induced in a mouse model of ischemia-reperfusion injury and its management by pemafibrate treatment. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 2022, 36, e22497. [Google Scholar] [CrossRef] [Scilit]
- Wheway, G.; Nazlamova, L.; Turner, D.; Cross, S. 661W Photoreceptor Cell Line as a Cell Model for Studying Retinal Ciliopathies. Front. Genet. 2019, 10, 308. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sayyad, Z.; Sirohi, K.; Radha, V.; Swarup, G. 661W is a retinal ganglion precursor-like cell line in which glaucoma-associated optineurin mutants induce cell death selectively. Sci. Rep. 2017, 7, 16855. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thompson, A.F.; Crowe, M.E.; Lieven, C.J.; Levin, L.A. Induction of Neuronal Morphology in the 661W Cone Photoreceptor Cell Line with Staurosporine. PLoS ONE 2015, 10, e0145270. [Google Scholar] [CrossRef] [Scilit]
- Kunimi, H.; Lee, D.; Ibuki, M.; Katada, Y.; Negishi, K.; Tsubota, K.; Kurihara, T. Inhibition of the HIF-1α/BNIP3 pathway has a retinal neuroprotective effect. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 2021, 35, e21829. [Google Scholar] [CrossRef] [Scilit]
- Wei, C.C.; Kong, Y.Y.; Li, G.Q.; Guan, Y.F.; Wang, P.; Miao, C.Y. Nicotinamide mononucleotide attenuates brain injury after intracerebral hemorrhage by activating Nrf2/HO-1 signaling pathway. Sci. Rep. 2017, 7, 717. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pu, Q.; Guo, X.X.; Hu, J.J.; Li, A.L.; Li, G.G.; Li, X.Y. Nicotinamide mononucleotide increases cell viability and restores tight junctions in high-glucose-treated human corneal epithelial cells via the SIRT1/Nrf2/HO-1 pathway. Biomed. Pharmacother. Biomed. Pharmacother. 2022, 147, 112659. [Google Scholar] [CrossRef] [Scilit]
- Westenskow, P.D. Nicotinamide: A novel treatment for age-related macular degeneration? Stem Cell Investig. 2017, 4, 86. [Google Scholar] [CrossRef] [Scilit]
- Pîrvu, A.S.; Andrei, A.M.; Stănciulescu, E.C.; Baniță, I.M.; Pisoschi, C.G.; Jurja, S.; Ciuluvica, R. NAD(+) metabolism and retinal degeneration (Review). Exp. Ther. Med. 2021, 22, 670. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Covarrubias, A.J.; Perrone, R.; Grozio, A.; Verdin, E. NAD(+) metabolism and its roles in cellular processes during ageing. Nat. Reviews. Mol. Cell Biol. 2021, 22, 119–141. [Google Scholar] [CrossRef] [Scilit]
- Hong, W.; Mo, F.; Zhang, Z.; Huang, M.; Wei, X. Nicotinamide Mononucleotide: A Promising Molecule for Therapy of Diverse Diseases by Targeting NAD+ Metabolism. Front. Cell Dev. Biol. 2020, 8, 246. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lautrup, S.; Sinclair, D.A.; Mattson, M.P.; Fang, E.F. NAD(+) in Brain Aging and Neurodegenerative Disorders. Cell Metab. 2019, 30, 630–655. [Google Scholar] [CrossRef] [Scilit]
- Yoshino, J.; Baur, J.A.; Imai, S.I. NAD(+) Intermediates: The Biology and Therapeutic Potential of NMN and NR. Cell Metab. 2018, 27, 513–528. [Google Scholar] [CrossRef] [Scilit]
- Sasaki, Y.; Kakita, H.; Kubota, S.; Sene, A.; Lee, T.J.; Ban, N.; Dong, Z.; Lin, J.B.; Boye, S.L.; DiAntonio, A.; et al. SARM1 depletion rescues NMNAT1-dependent photoreceptor cell death and retinal degeneration. Elife 2020, 9, e62027. [Google Scholar] [CrossRef] [Scilit]
- Wenz, C.; Faust, D.; Linz, B.; Turmann, C.; Nikolova, T.; Bertin, J.; Gough, P.; Wipf, P.; Schröder, A.S.; Krautwald, S.; et al. t-BuOOH induces ferroptosis in human and murine cell lines. Arch. Toxicol. 2018, 92, 759–775. [Google Scholar] [CrossRef] [Scilit]
- Takayama, F.; Egashira, T.; Yamanaka, Y. Protective effect of Ninjin-yoei-to on damage to isolated hepatocytes following transient exposure to tert-butyl hydroperoxide. Jpn. J. Pharmacol. 2001, 85, 227–233. [Google Scholar] [CrossRef] [Scilit]
- Baysal, E.; Sullivan, S.G.; Stern, A. Prooxidant and antioxidant effects of ascorbate on tBuOOH-induced erythrocyte membrane damage. Int. J. Biochem. 1989, 21, 1109–1113. [Google Scholar] [CrossRef] [Scilit]
- Audrito, V.; Messana, V.G.; Deaglio, S. NAMPT and NAPRT: Two Metabolic Enzymes with Key Roles in Inflammation. Front. Oncol. 2020, 10, 358. [Google Scholar] [CrossRef] [Scilit]
- Gardell, S.J.; Hopf, M.; Khan, A.; Dispagna, M.; Hampton Sessions, E.; Falter, R.; Kapoor, N.; Brooks, J.; Culver, J.; Petucci, C.; et al. Boosting NAD(+) with a small molecule that activates NAMPT. Nat. Commun. 2019, 10, 3241. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abcouwer, S.F.; Shanmugam, S.; Muthusamy, A.; Lin, C.M.; Kong, D.; Hager, H.; Liu, X.; Antonetti, D.A. Inflammatory resolution and vascular barrier restoration after retinal ischemia reperfusion injury. J. Neuroinflammation 2021, 18, 186. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, R.; Liang, S.; Fang, L.; Wu, M.; Cheng, H.; Mi, X.; Ding, Y. Low-dose minocycline mediated neuroprotection on retinal ischemia-reperfusion injury of mice. Mol. Vis. 2018, 24, 367–378. [Google Scholar] [PubMed]
- Celorrio, M.; Shumilov, K.; Payne, C.; Vadivelu, S.; Friess, S.H. Acute minocycline administration reduces brain injury and improves long-term functional outcomes after delayed hypoxemia following traumatic brain injury. Acta Neuropathol. Commun. 2022, 10, 10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schimmel, S.J.; Acosta, S.; Lozano, D. Neuroinflammation in traumatic brain injury: A chronic response to an acute injury. Brain Circ. 2017, 3, 135–142. [Google Scholar] [CrossRef] [Scilit]
- Begemann, M.; Leon, M.; van der Horn, H.J.; van der Naalt, J.; Sommer, I. Drugs with anti-inflammatory effects to improve outcome of traumatic brain injury: A meta-analysis. Sci. Rep. 2020, 10, 16179. [Google Scholar] [CrossRef] [Scilit]
- Yamaura, K.; Mifune, Y.; Inui, A.; Nishimoto, H.; Kurosawa, T.; Mukohara, S.; Hoshino, Y.; Niikura, T.; Kuroda, R. Antioxidant effect of nicotinamide mononucleotide in tendinopathy. BMC Musculoskelet. Disord. 2022, 23, 249. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.; Dilxat, T.; Shi, Q.; Qiu, T.; Lin, J. The combination of nicotinamide mononucleotide and lycopene prevents cognitive impairment and attenuates oxidative damage in D-galactose induced aging models via Keap1-Nrf2 signaling. Gene 2022, 822, 146348. [Google Scholar] [CrossRef] [Scilit]
- Luo, C.; Ding, W.; Yang, C.; Zhang, W.; Liu, X.; Deng, H. Nicotinamide Mononucleotide Administration Restores Redox Homeostasis via the Sirt3-Nrf2 Axis and Protects Aged Mice from Oxidative Stress-Induced Liver Injury. J. Proteome Res. 2022, 21, 1759–1770. [Google Scholar] [CrossRef] [Scilit]
- Miwa, Y.; Tsubota, K.; Kurihara, T. Effect of midazolam, medetomidine, and butorphanol tartrate combination anesthetic on electroretinograms of mice. Mol. Vis. 2019, 25, 645–653. [Google Scholar]
- Ibuki, M.; Lee, D.; Shinojima, A.; Miwa, Y.; Tsubota, K.; Kurihara, T. Rice Bran and Vitamin B6 Suppress Pathological Neovascularization in a Murine Model of Age-Related Macular Degeneration as Novel HIF Inhibitors. Int. J. Mol. Sci. 2020, 21, 8940. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, D.; Miwa, Y.; Wu, J.; Shoda, C.; Jeong, H.; Kawagishi, H.; Tsubota, K.; Kurihara, T. A Fairy Chemical Suppresses Retinal Angiogenesis as a HIF Inhibitor. Biomolecules 2020, 10, 1405. [Google Scholar] [CrossRef] [Scilit]
- Lee, D.; Jeong, H.; Miwa, Y.; Shinojima, A.; Katada, Y.; Tsubota, K.; Kurihara, T. Retinal dysfunction induced in a mouse model of unilateral common carotid artery occlusion. PeerJ 2021, 9, e11665. [Google Scholar] [CrossRef] [Scilit]
- Lee, D.; Tomita, Y.; Jeong, H.; Miwa, Y.; Tsubota, K.; Negishi, K.; Kurihara, T. Pemafibrate Prevents Retinal Dysfunction in a Mouse Model of Unilateral Common Carotid Artery Occlusion. Int. J. Mol. Sci. 2021, 22, 9408. [Google Scholar] [CrossRef] [Scilit]




| Name | Direction | Sequence (5′→3′) | Accession Number |
|---|---|---|---|
| Hprt | Forward | TCAGTCAACGGGGGACATAAA | NM_013556.2 |
| Reverse | GGGGCTGTACTGCTTAACCAG | ||
| Hmox-1 | Forward | CACTCTGGAGATGACACCTGAG | NM_010442.2 |
| Reverse | GTGTTCCTCTGTCAGCATCACC | ||
| Nrf2 | Forward | TAGATGACCATGAGTCGCTTGC | NM_010902.4 |
| Reverse | GCCAAACTTGCTCCATGTCC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, D.; Tomita, Y.; Miwa, Y.; Shinojima, A.; Ban, N.; Yamaguchi, S.; Nishioka, K.; Negishi, K.; Yoshino, J.; Kurihara, T. Nicotinamide Mononucleotide Prevents Retinal Dysfunction in a Mouse Model of Retinal Ischemia/Reperfusion Injury. Int. J. Mol. Sci. 2022, 23, 11228. https://doi.org/10.3390/ijms231911228
Lee D, Tomita Y, Miwa Y, Shinojima A, Ban N, Yamaguchi S, Nishioka K, Negishi K, Yoshino J, Kurihara T. Nicotinamide Mononucleotide Prevents Retinal Dysfunction in a Mouse Model of Retinal Ischemia/Reperfusion Injury. International Journal of Molecular Sciences. 2022; 23(19):11228. https://doi.org/10.3390/ijms231911228
Chicago/Turabian StyleLee, Deokho, Yohei Tomita, Yukihiro Miwa, Ari Shinojima, Norimitsu Ban, Shintaro Yamaguchi, Ken Nishioka, Kazuno Negishi, Jun Yoshino, and Toshihide Kurihara. 2022. "Nicotinamide Mononucleotide Prevents Retinal Dysfunction in a Mouse Model of Retinal Ischemia/Reperfusion Injury" International Journal of Molecular Sciences 23, no. 19: 11228. https://doi.org/10.3390/ijms231911228
APA StyleLee, D., Tomita, Y., Miwa, Y., Shinojima, A., Ban, N., Yamaguchi, S., Nishioka, K., Negishi, K., Yoshino, J., & Kurihara, T. (2022). Nicotinamide Mononucleotide Prevents Retinal Dysfunction in a Mouse Model of Retinal Ischemia/Reperfusion Injury. International Journal of Molecular Sciences, 23(19), 11228. https://doi.org/10.3390/ijms231911228

