Activating PPARβ/δ Protects against Endoplasmic Reticulum Stress-Induced Astrocytic Apoptosis via UCP2-Dependent Mitophagy in Depressive Model
Abstract
1. Introduction
2. Results
2.1. Activating PPARβ/δ Ameliorates Depression-Like Behavior in Mice
2.2. Activating PPARβ/δ Ameliorates Astrocytic Injury in In Vivo and In Vitro Depressive Models
2.3. Activating PPARβ/δ Ameliorates Oxidative Stress-Induced Damages in Astrocytes
2.4. Activating PPARβ/δ Enhances Mitophagy in Astrocytes via Upregulating the Expression of UCP2
2.5. Activating PPARβ/δ Ameliorates Mitochondrial Damage via UCP2-Mediated Mitophagy in Astrocytes
2.6. Activating PPARβ/δ Reduces ER Stress-Induced Astrocytic Apoptosis Induced by Corticosterone
3. Discussion
4. Materials and Methods
4.1. Experimental Animals and Procedures
4.2. Sucrose Preference Test
4.3. Forced Swimming Test
4.4. Tail Suspension Test
4.5. Open Field Test
4.6. Primary Astrocytes Culture
4.7. Cell Viability Assay
4.8. Tissue Processing and Immunohistochemistry
4.9. Immunofluorescent Staining
4.10. Western Blotting
4.11. Reverse Transcription and Real-Time Quantitative PCR
4.12. Transmission Electron Microscope Analysis
4.13. Transfection of Primary Astrocytes with siRNA
4.14. Flow Cytometry
4.15. Intracellular ROS Assessment
4.16. Glutathione Assay
4.17. Determination of Mitochondrial Membrane Potential and ATP Content
4.18. Chromatin Immunoprecipitation (ChIP) Assay
4.19. Luciferase Reporter Assay
4.20. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Malhi, G.S.; Mann, J.J. Depression. Lancet 2018, 392, 2299–2312. [Google Scholar] [CrossRef]
- Dubovsky, S.L.; Ghosh, B.M.; Serotte, J.C.; Cranwell, V. Psychotic Depression: Diagnosis, Differential Diagnosis, and Treatment. Psychother. Psychosom. 2021, 90, 160–177. [Google Scholar] [CrossRef] [PubMed]
- O’Leary, L.A.; Mechawar, N. Implication of cerebral astrocytes in major depression: A review of fine neuroanatomical evidence in humans. Glia 2021, 69, 2077–2099. [Google Scholar] [CrossRef] [PubMed]
- Park, M.W.; Cha, H.W.; Kim, J.; Kim, J.H.; Yang, H.; Yoon, S.; Boonpraman, N.; Yi, S.S.; Yoo, I.D.; Moon, J.S. NOX4 promotes ferroptosis of astrocytes by oxidative stress-induced lipid peroxidation via the impairment of mitochondrial metabolism in Alzheimer’s diseases. Redox Biol. 2021, 41, 101947. [Google Scholar] [CrossRef] [PubMed]
- Rizor, A.; Pajarillo, E.; Johnson, J.; Aschner, M.; Lee, E. Astrocytic Oxidative/Nitrosative Stress Contributes to Parkinson’s Disease Pathogenesis: The Dual Role of Reactive Astrocytes. Antioxidants 2019, 8, 265. [Google Scholar] [CrossRef]
- Kaufmann, F.N.; Menard, C. Inflamed Astrocytes: A Path to Depression Led by Menin. Neuron 2018, 100, 511–513. [Google Scholar] [CrossRef]
- Li, Y.; Luo, Y.; Tang, J.; Liang, X.; Wang, J.; Xiao, Q.; Zhu, P.; Xiao, K.; Jiang, L.; Dou, X.; et al. The positive effects of running exercise on hippocampal astrocytes in a rat model of depression. Transl. Psychiatry 2021, 11, 83. [Google Scholar] [CrossRef]
- Zhang, Q.; Sun, Y.; He, Z.; Xu, Y.; Li, X.; Ding, J.; Lu, M.; Hu, G. Kynurenine regulates NLRP2 inflammasome in astrocytes and its implications in depression. Brain Behav. Immun. 2020, 88, 471–481. [Google Scholar] [CrossRef]
- Ochoa, C.D.; Wu, R.F.; Terada, L.S. ROS signaling and ER stress in cardiovascular disease. Mol. Asp. Med. 2018, 63, 18–29. [Google Scholar] [CrossRef]
- Knupp, J.; Arvan, P.; Chang, A. Increased mitochondrial respiration promotes survival from endoplasmic reticulum stress. Cell Death Differ. 2019, 26, 487–501. [Google Scholar] [CrossRef]
- Hetz, C.; Zhang, K.; Kaufman, R.J. Mechanisms, regulation and functions of the unfolded protein response. Nat. Rev. Mol. Cell Biol. 2020, 21, 421–438. [Google Scholar] [CrossRef]
- Ren, J.; Bi, Y.; Sowers, J.R.; Hetz, C.; Zhang, Y. Endoplasmic reticulum stress and unfolded protein response in cardiovascular diseases. Nat. Rev. Cardiol. 2021, 18, 499–521. [Google Scholar] [CrossRef]
- Mao, J.; Hu, Y.; Ruan, L.; Ji, Y.; Lou, Z. Role of endoplasmic reticulum stress in depression (Review). Mol. Med. Rep. 2019, 20, 4774–4780. [Google Scholar] [CrossRef]
- Gold, P.W.; Licinio, J.; Pavlatou, M.G. Pathological parainflammation and endoplasmic reticulum stress in depression: Potential translational targets through the CNS insulin, klotho and PPAR-gamma systems. Mol. Psychiatry 2013, 18, 154–165. [Google Scholar] [CrossRef]
- Nevell, L.; Zhang, K.; Aiello, A.E.; Koenen, K.; Galea, S.; Soliven, R.; Zhang, C.; Wildman, D.E.; Uddin, M. Elevated systemic expression of ER stress related genes is associated with stress-related mental disorders in the Detroit Neighborhood Health Study. Psychoneuroendocrinology 2014, 43, 62–70. [Google Scholar] [CrossRef]
- Riaz, T.A.; Junjappa, R.P.; Handigund, M.; Ferdous, J.; Kim, H.R.; Chae, H.J. Role of Endoplasmic Reticulum Stress Sensor IRE1alpha in Cellular Physiology, Calcium, ROS Signaling, and Metaflammation. Cells 2020, 9, 1160. [Google Scholar] [CrossRef]
- Singh-Mallah, G.; Nair, S.; Sandberg, M.; Mallard, C.; Hagberg, H. The Role of Mitochondrial and Endoplasmic Reticulum Reactive Oxygen Species Production in Models of Perinatal Brain Injury. Antioxid. Redox Signal. 2019, 31, 643–663. [Google Scholar] [CrossRef]
- Verfaillie, T.; Rubio, N.; Garg, A.D.; Bultynck, G.; Rizzuto, R.; Decuypere, J.P.; Piette, J.; Linehan, C.; Gupta, S.; Samali, A.; et al. PERK is required at the ER-mitochondrial contact sites to convey apoptosis after ROS-based ER stress. Cell Death Differ. 2012, 19, 1880–1891. [Google Scholar] [CrossRef]
- Wang, Z.; Yin, F.; Xu, J.; Zhang, T.; Wang, G.; Mao, M.; Wang, Z.; Sun, W.; Han, J.; Yang, M.; et al. CYT997(Lexibulin) induces apoptosis and autophagy through the activation of mutually reinforced ER stress and ROS in osteosarcoma. J. Exp. Clin. Cancer Res. 2019, 38, 44. [Google Scholar] [CrossRef]
- Cheng, H.S.; Tan, W.R.; Low, Z.S.; Marvalim, C.; Lee, J.Y.H.; Tan, N.S. Exploration and Development of PPAR Modulators in Health and Disease: An Update of Clinical Evidence. Int. J. Mol. Sci. 2019, 20, 5055. [Google Scholar] [CrossRef]
- Mirza, A.Z.; Althagafi, I.I.; Shamshad, H. Role of PPAR receptor in different diseases and their ligands: Physiological importance and clinical implications. Eur. J. Med. Chem. 2019, 166, 502–513. [Google Scholar] [CrossRef]
- Zhang, L.; Tang, M.; Xie, X.; Zhao, Q.; Hu, N.; He, H.; Liu, G.; Huang, S.; Peng, C.; Xiao, Y.; et al. Ginsenoside Rb1 induces a pro-neurogenic microglial phenotype via PPARgamma activation in male mice exposed to chronic mild stress. J. Neuroinflamm. 2021, 18, 171. [Google Scholar] [CrossRef]
- Xu, L.; Ma, X.; Verma, N.; Perie, L.; Pendse, J.; Shamloo, S.; Marie Josephson, A.; Wang, D.; Qiu, J.; Guo, M.; et al. PPARgamma agonists delay age-associated metabolic disease and extend longevity. Aging Cell 2020, 19, e13267. [Google Scholar] [CrossRef]
- Jiang, X.; Yi, S.; Liu, Q.; Su, D.; Li, L.; Xiao, C.; Zhang, J. Asperosaponin VI ameliorates the CMS-induced depressive-like behaviors by inducing a neuroprotective microglial phenotype in hippocampus via PPAR-gamma pathway. J. Neuroinflamm. 2022, 19, 115. [Google Scholar] [CrossRef]
- Wang, B.; Chen, D.; Jiang, R.; Ntim, M.; Lu, J.; Xia, M.; Yang, X.; Wang, Y.; Kundu, S.; Guan, R.; et al. TIP60 buffers acute stress response and depressive behaviour by controlling PPARgamma-mediated transcription. Brain Behav. Immun. 2022, 101, 410–422. [Google Scholar] [CrossRef]
- Zhao, Z.; Zhang, L.; Guo, X.D.; Cao, L.L.; Xue, T.F.; Zhao, X.J.; Yang, D.D.; Yang, J.; Ji, J.; Huang, J.Y.; et al. Rosiglitazone Exerts an Anti-depressive Effect in Unpredictable Chronic Mild-Stress-Induced Depressive Mice by Maintaining Essential Neuron Autophagy and Inhibiting Excessive Astrocytic Apoptosis. Front. Mol. Neurosci. 2017, 10, 293. [Google Scholar] [CrossRef]
- Gold, P.W. The PPARg System in Major Depression: Pathophysiologic and Therapeutic Implications. Int. J. Mol. Sci. 2021, 22, 9248. [Google Scholar] [CrossRef]
- Guo, M.; Li, C.; Lei, Y.; Xu, S.; Zhao, D.; Lu, X.Y. Role of the adipose PPARgamma-adiponectin axis in susceptibility to stress and depression/anxiety-related behaviors. Mol. Psychiatry 2017, 22, 1056–1068. [Google Scholar] [CrossRef]
- Lam, Y.Y.; Tsai, S.F.; Chen, P.C.; Kuo, Y.M.; Chen, Y.W. Pioglitazone rescues high-fat diet-induced depression-like phenotypes and hippocampal astrocytic deficits in mice. Biomed. Pharmacother. 2021, 140, 111734. [Google Scholar] [CrossRef]
- Lim, J.; Kim, H.I.; Bang, Y.; Choi, H.J. Peroxisome proliferator-activated receptor gamma: A novel therapeutic target for cognitive impairment and mood disorders that functions via the regulation of adult neurogenesis. Arch. Pharm Res. 2021, 44, 553–563. [Google Scholar] [CrossRef]
- Li, Y.; Cheng, K.C.; Liu, K.F.; Peng, W.H.; Cheng, J.T.; Niu, H.S. Telmisartan Activates PPARdelta to Improve Symptoms of Unpredictable Chronic Mild Stress-Induced Depression in Mice. Sci. Rep. 2017, 7, 14021. [Google Scholar] [CrossRef] [PubMed]
- Liu, K.F.; Li, Y.; Cheng, K.C.; Hsu, C.C.; Cheng, J.T.; Peng, W.H. Changes in PPARdelta expression in a rat model of stress-induced depression. Clin. Exp. Pharmacol. Physiol. 2017, 44, 664–670. [Google Scholar] [CrossRef] [PubMed]
- He, J.G.; Zhou, H.Y.; Xue, S.G.; Lu, J.J.; Xu, J.F.; Zhou, B.; Hu, Z.L.; Wu, P.F.; Long, L.H.; Ni, L.; et al. Transcription Factor TWIST1 Integrates Dendritic Remodeling and Chronic Stress to Promote Depressive-like Behaviors. Biol. Psychiatry 2021, 89, 615–626. [Google Scholar] [CrossRef] [PubMed]
- Toda, C.; Diano, S. Mitochondrial UCP2 in the central regulation of metabolism. Best Pract. Res. Clin. Endocrinol. Metab. 2014, 28, 757–764. [Google Scholar] [CrossRef]
- Colle, R.; de Larminat, D.; Rotenberg, S.; Hozer, F.; Hardy, P.; Verstuyft, C.; Feve, B.; Corruble, E. PPAR-gamma Agonists for the Treatment of Major Depression: A Review. Pharmacopsychiatry 2017, 50, 49–55. [Google Scholar] [CrossRef]
- Wang, Y.X.; Kang, X.N.; Cao, Y.; Zheng, D.X.; Lu, Y.M.; Pang, C.F.; Wang, Z.; Cheng, B.; Peng, Y. Porphyromonas gingivalis induces depression via downregulating p75NTR-mediated BDNF maturation in astrocytes. Brain Behav. Immun. 2019, 81, 523–534. [Google Scholar] [CrossRef]
- Traslavina, G.A.A.; Torres, F.P.; de Barcelos Filho, P.C.G.; Lucio-Oliveira, F.; Franci, C.R. Hypothalamic-pituitary-adrenal axis responsivity to an acute novel stress in female rats subjected to the chronic mild stress paradigm. Brain Res. 2019, 1723, 146402. [Google Scholar] [CrossRef]
- Greaney, J.L.; Saunders, E.F.H.; Santhanam, L.; Alexander, L.M. Oxidative Stress Contributes to Microvascular Endothelial Dysfunction in Men and Women With Major Depressive Disorder. Circ. Res. 2019, 124, 564–574. [Google Scholar] [CrossRef]
- Birmann, P.T.; Casaril, A.M.; Pesarico, A.P.; Caballero, P.S.; Smaniotto, T.A.; Rodrigues, R.R.; Moreira, A.N.; Conceicao, F.R.; Sousa, F.S.S.; Collares, T.; et al. Komagataella pastoris KM71H modulates neuroimmune and oxidative stress parameters in animal models of depression: A proposal for a new probiotic with antidepressant-like effect. Pharmacol. Res. 2021, 171, 105740. [Google Scholar] [CrossRef]
- Bhatt, S.; Nagappa, A.N.; Patil, C.R. Role of oxidative stress in depression. Drug Discov. Today 2020, 25, 1270–1276. [Google Scholar] [CrossRef]
- Zhao, S.; Zhong, S.; Wang, F.; Wang, H.; Xu, D.; Li, G. Microcystin-LR exposure decreased the fetal weight of mice by disturbance of placental development and ROS-mediated endoplasmic reticulum stress in the placenta. Environ. Pollut. 2020, 256, 113362. [Google Scholar] [CrossRef]
- Liao, D.; Xiang, D.; Dang, R.; Xu, P.; Wang, J.; Han, W.; Fu, Y.; Yao, D.; Cao, L.; Jiang, P. Neuroprotective Effects of dl-3-n-Butylphthalide against Doxorubicin-Induced Neuroinflammation, Oxidative Stress, Endoplasmic Reticulum Stress, and Behavioral Changes. Oxid. Med. Cell Longev. 2018, 2018, 9125601. [Google Scholar] [CrossRef]
- Liu, D.; Ke, Z.; Luo, J. Thiamine Deficiency and Neurodegeneration: The Interplay Among Oxidative Stress, Endoplasmic Reticulum Stress, and Autophagy. Mol. Neurobiol. 2017, 54, 5440–5448. [Google Scholar] [CrossRef]
- Resende, R.; Fernandes, T.; Pereira, A.C.; De Pascale, J.; Marques, A.P.; Oliveira, P.; Morais, S.; Santos, V.; Madeira, N.; Pereira, C.F.; et al. Mitochondria, endoplasmic reticulum and innate immune dysfunction in mood disorders: Do Mitochondria-Associated Membranes (MAMs) play a role? Biochim. Biophys. Acta Mol. Basis Dis. 2020, 1866, 165752. [Google Scholar] [CrossRef]
- Baechler, B.L.; Bloemberg, D.; Quadrilatero, J. Mitophagy regulates mitochondrial network signaling, oxidative stress, and apoptosis during myoblast differentiation. Autophagy 2019, 15, 1606–1619. [Google Scholar] [CrossRef]
- Li, J.; Jiang, R.; Cong, X.; Zhao, Y. UCP2 gene polymorphisms in obesity and diabetes, and the role of UCP2 in cancer. FEBS Lett. 2019, 593, 2525–2534. [Google Scholar] [CrossRef]
- Broche, B.; Ben Fradj, S.; Aguilar, E.; Sancerni, T.; Benard, M.; Makaci, F.; Berthault, C.; Scharfmann, R.; Alves-Guerra, M.C.; Duvillie, B. Mitochondrial Protein UCP2 Controls Pancreas Development. Diabetes 2018, 67, 78–84. [Google Scholar] [CrossRef]
- Toral, M.; Romero, M.; Jimenez, R.; Robles-Vera, I.; Tamargo, J.; Martinez, M.C.; Perez-Vizcaino, F.; Duarte, J. Role of UCP2 in the protective effects of PPARbeta/delta activation on lipopolysaccharide-induced endothelial dysfunction. Biochem. Pharmacol. 2016, 110–111, 25–36. [Google Scholar] [CrossRef]
- Zou, P.; Wang, X.; Yang, W.; Liu, C.; Chen, Q.; Yang, H.; Zhou, N.; Zeng, Y.; Chen, H.; Zhang, G.; et al. Mechanisms of Stress-Induced Spermatogenesis Impairment in Male Rats Following Unpredictable Chronic Mild Stress (uCMS). Int. J. Mol. Sci. 2019, 20, 4470. [Google Scholar] [CrossRef]
- Filho, C.B.; Jesse, C.R.; Donato, F.; Giacomeli, R.; Del Fabbro, L.; da Silva Antunes, M.; de Gomes, M.G.; Goes, A.T.; Boeira, S.P.; Prigol, M.; et al. Chronic unpredictable mild stress decreases BDNF and NGF levels and Na(+),K(+)-ATPase activity in the hippocampus and prefrontal cortex of mice: Antidepressant effect of chrysin. Neuroscience 2015, 289, 367–380. [Google Scholar] [CrossRef]
- Reis-Silva, T.M.; Sandini, T.M.; Calefi, A.S.; Orlando, B.C.G.; Moreira, N.; Lima, A.P.N.; Florio, J.C.; Queiroz-Hazarbassanov, N.G.T.; Bernardi, M.M. Stress resilience evidenced by grooming behaviour and dopamine levels in male mice selected for high and low immobility using the tail suspension test. Eur. J. Neurosci. 2019, 50, 2942–2954. [Google Scholar] [CrossRef]
- Hou, Y.; Zhou, L.; Yang, Q.D.; Du, X.P.; Li, M.; Yuan, M.; Zhou, Z.W. Changes in hippocampal synapses and learning-memory abilities in a streptozotocin-treated rat model and intervention by using fasudil hydrochloride. Neuroscience 2012, 200, 120–129. [Google Scholar] [CrossRef]







| Target Gene | Orientation | Primer Sequence (5’-3’) |
|---|---|---|
| UCP2 | Forward | GCCACTTCACTTCTGCCTTC |
| Reverse | GAAGGCATGAACCCCTTGTA | |
| β-actin | Forward | AATCGTGCGTGACATCAAG |
| Reverse | ATGCCACAGGATTCCATACC |
| Target Gene | Orientation | Primer Sequence (5’-3’) |
|---|---|---|
| Si-UCP2 | Forward | GCCACTTCACTTCTGCCTTC |
| Reverse | GAAGGCATGAACCCCTTGTA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ji, J.; Li, S.; Jiang, Z.; Yu, J.; Sun, Y.; Cai, Z.; Dong, Y.; Sun, X. Activating PPARβ/δ Protects against Endoplasmic Reticulum Stress-Induced Astrocytic Apoptosis via UCP2-Dependent Mitophagy in Depressive Model. Int. J. Mol. Sci. 2022, 23, 10822. https://doi.org/10.3390/ijms231810822
Ji J, Li S, Jiang Z, Yu J, Sun Y, Cai Z, Dong Y, Sun X. Activating PPARβ/δ Protects against Endoplasmic Reticulum Stress-Induced Astrocytic Apoptosis via UCP2-Dependent Mitophagy in Depressive Model. International Journal of Molecular Sciences. 2022; 23(18):10822. https://doi.org/10.3390/ijms231810822
Chicago/Turabian StyleJi, Juan, Shangze Li, Zikai Jiang, Jianbing Yu, Yuqin Sun, Zhenyu Cai, Yinfeng Dong, and Xiulan Sun. 2022. "Activating PPARβ/δ Protects against Endoplasmic Reticulum Stress-Induced Astrocytic Apoptosis via UCP2-Dependent Mitophagy in Depressive Model" International Journal of Molecular Sciences 23, no. 18: 10822. https://doi.org/10.3390/ijms231810822
APA StyleJi, J., Li, S., Jiang, Z., Yu, J., Sun, Y., Cai, Z., Dong, Y., & Sun, X. (2022). Activating PPARβ/δ Protects against Endoplasmic Reticulum Stress-Induced Astrocytic Apoptosis via UCP2-Dependent Mitophagy in Depressive Model. International Journal of Molecular Sciences, 23(18), 10822. https://doi.org/10.3390/ijms231810822

