Integrating Oxygen and 3D Cell Culture System: A Simple Tool to Elucidate the Cell Fate Decision of hiPSCs
Abstract
:1. Introduction
2. Result
2.1. Self-Assembled Aggregate Formation on Microwells
2.2. Cellular Metabolism of hiPSCs Aggregates
2.3. Exit from Pluripotency
2.4. Oxygen Affecting Three Lineage Gene Expression
3. Discussion
4. Materials and Methods
4.1. Fabrication of Honeycomb Microwells and Sterilization
4.2. Monolayer hiPSC Culture
4.3. Aggregate Formation on Honeycomb Microwells
4.4. Morphological Analysis
4.5. Glucose and Lactate Measurement
4.6. Quantitative Real-Time PCR
4.7. Immunocytochemistry
4.8. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Liu, G.; David, B.T.; Trawczynski, M.; Fessler, R.G. Advances in Pluripotent Stem Cells: History, Mechanisms, Technologies, and Applications. Stem Cell Rev. Rep. 2020, 16, 3–32. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kolios, G.; Moodley, Y. Introduction to Stem Cells and Regenerative Medicine. Respiration 2012, 85, 3–10. [Google Scholar] [CrossRef] [PubMed]
- Singh, V.K.; Kalsan, M.; Kumar, N.; Saini, A.; Chandra, R. Induced pluripotent stem cells: Applications in regenerative medicine, disease modeling, and drug discovery. Front. Cell Dev. Biol. 2015, 3, 2. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Keung, A.J.; De Juan-Pardo, E.M.; Schaffer, D.V.; Kumar, S. Rho GTPases mediate the mechanosensitive lineage commitment of neural stem cells. Stem Cells 2011, 29, 1886–1897. [Google Scholar] [CrossRef]
- Roccio, M.; Schmitter, D.; Knobloch, M.; Okawa, Y.; Sage, D.; Lutolf, M.P. Predicting stem cell fate changes by differential cell cycle progression patterns. Development 2013, 140, 459–470. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lane, S.W.; Williams, D.A.; Watt, F.M. Modulating the stem cell niche for tissue regeneration. Nat. Biotechnol. 2014, 32, 795–803. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mohyeldin, A.; Garzón-Muvdi, T.; Quiñones-Hinojosa, A. Oxygen in stem cell biology: A critical component of the stem cell niche. Cell Stem Cell 2010, 7, 150–161. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Simon, M.C.; Keith, B. The role of oxygen availability in embryonic development and stem cell function. Nat. Rev. Mol. Cell Biol. 2008, 9, 285–296. [Google Scholar] [CrossRef] [PubMed]
- Mas-Bargues, C.; Sanz-Ros, J.; Román-Domínguez, A.; Inglés, M.; Gimeno-Mallench, L.; El Alami, M.; Viña-Almunia, J.; Gambini, J.; Viña, J.; Borrás, C. Relevance of oxygen concentration in stem cell culture for regenerative medicine. Int. J. Mol. Sci. 2019, 20, 1195. [Google Scholar] [CrossRef] [Green Version]
- Cigognini, D.; Lomas, A.; Kumar, P.; Satyam, A.; English, A.; Azeem, A.; Pandit, A.; Zeugolis, D. Engineering in vitro microenvironments for cell based therapies and drug discovery. Drug Discov. Today 2013, 18, 1099–1108. [Google Scholar] [CrossRef]
- Hakim, F.; Kaitsuka, T.; Raeed, J.M.; Wei, F.Y.; Shiraki, N.; Akagi, T.; Yokota, T.; Kume, S.; Tomizawa, K. High oxygen condition facilitates the differentiation of mouse and human pluripotent stem cells into pancreatic progenitors and insulin-producing cells. J. Biol. Chem. 2014, 289, 9623–9638. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Horton, R.E.; Auguste, D.T. Synergistic effects of hypoxia and extracellular matrix cues in cardiomyogenesis. Biomaterials 2012, 33, 6313–6319. [Google Scholar] [CrossRef]
- Souidi, M.; Sleiman, Y.; Acimovic, I.; Pribyl, J.; Charrabi, A.; Baecker, V.; Scheuermann, V.; Pesl, M.; Jelinkova, S.; Skladal, P.; et al. Oxygen is an ambivalent factor for the differentiation of human pluripotent stem cells in cardiac 2D monolayer and 3D cardiac spheroids. Int. J. Mol. Sci. 2021, 22, 662. [Google Scholar] [CrossRef] [PubMed]
- Medley, T.L.; Furtado, M.; Lam, N.T.; Idrizi, R.; Williams, D.; Verma, P.J.; Costa, M.; Kaye, D.M. Effect of oxygen on cardiac differentiation in mouse iPS cells: Role of hypoxia inducible factor-1 and Wnt/beta-catenin signaling. PLoS ONE 2013, 8, e80280. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, J.T.; Lamprecht, M.P.; Duncan, S.A. Using human induced pluripotent stem cell-derived hepatocyte-like cells for drug discovery. J. Vis. Exp. 2018, 2018, e57194. [Google Scholar] [CrossRef]
- Turner, D.A.; Girgin, M.; Alonso-Crisostomo, L.; Trivedi, V.; Baillie-Johnson, P.; Glodowski, C.R.; Hayward, P.C.; Collignon, J.; Gustavsen, C.; Serup, P.; et al. Anteroposterior polarity and elongation in the absence of extraembryonic tissues and of spatially localised signalling in gastruloids: Mammalian embryonic organoids. Development 2017, 144, 3894–3906. [Google Scholar] [CrossRef] [Green Version]
- Ishihara, K.; Tanaka, E.M. Spontaneous symmetry breaking and pattern formation of organoids. Curr. Opin. Syst. Biol. 2018, 11, 123–128. [Google Scholar] [CrossRef] [Green Version]
- Podkalicka, P.; Stępniewski, J.; Mucha, O.; Kachamakova-Trojanowska, N.; Dulak, J.; Łoboda, A. Hypoxia as a driving force of pluripotent stem cell reprogramming and differentiation to endothelial cells. Biomolecules 2020, 10, 1614. [Google Scholar] [CrossRef]
- Niebruegge, S.; Bauwens, C.L.; Peerani, R.; Thavandiran, N.; Masse, S.; Sevaptisidis, E.; Nanthakumar, K.; Woodhouse, K.; Husain, M.; Kumacheva, E.; et al. Generation of human embryonic stem cell-derived mesoderm and cardiac cells using size-specified aggregates in an oxygen-controlled bioreactor. Biotechnol. Bioeng. 2009, 102, 493–507. [Google Scholar] [CrossRef]
- Pimton, P.; Lecht, S.; Stabler, C.T.; Johannes, G.; Schulman, E.S.; Lelkes, P.I. Hypoxia enhances differentiation of mouse embryonic stem cells into definitive endoderm and distal lung cells. Stem Cells Dev. 2015, 24, 663–676. [Google Scholar] [CrossRef] [Green Version]
- Mondragon-Teran, P.; Baboo, J.Z.; Mason, C.; Lye, G.J.; Veraitch, F.S. The full spectrum of physiological oxygen tensions and step-changes in oxygen tension affects the neural differentiation of mouse embryonic stem cells. Biotechnol. Prog. 2011, 27, 1700–1708. [Google Scholar] [CrossRef] [PubMed]
- Stacpoole, S.R.L.; Bilican, B.; Webber, D.J.; Luzhynskaya, A.; He, X.L.; Compston, A.; Karadottir, R.; Franklin, R.J.M.; Chandran, S. Derivation of neural precursor cells from human ES cells at 3% O2 is efficient, enhances survival and presents no barrier to regional specification and functional differentiation. Cell Death Differ. 2011, 18, 1016–1023. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Burridge, P.W.; Thompson, S.; Millrod, M.A.; Weinberg, S.; Yuan, X.; Peters, A.; Mahairaki, V.; Koliatsos, V.E.; Tung, L.; Zambidis, E.T. A universal system for highly efficient cardiac differentiation of human induced pluripotent stem cells that eliminates interline variability. PLoS ONE 2011, 6, e18293. [Google Scholar] [CrossRef] [PubMed]
- Prado-Lopez, S.; Conesa, A.; Armiñán, A.; Martínez-Losa, M.; Escobedo-Lucea, C.; Gandia, C.; Tarazona, S.; Melguizo, D.; Blesa, D.; Montaner, D.; et al. Hypoxia promotes efficient differentiation of human embryonic stem cells to functional endothelium. Stem Cells 2010, 28, 407–418. [Google Scholar] [CrossRef]
- Koay, E.J.; Athanasiou, K.A. Hypoxic chondrogenic differentiation of human embryonic stem cells enhances cartilage protein synthesis and biomechanical functionality. Osteoarthr. Cartil. 2008, 16, 1450–1456. [Google Scholar] [CrossRef] [Green Version]
- Fynes, K.; Tostoes, R.; Ruban, L.; Weil, B.; Mason, C.; Veraitch, F.S. The differential effects of 2% oxygen preconditioning on the subsequent differentiation of mouse and human pluripotent stem cells. Stem Cells Dev. 2014, 23, 1910–1922. [Google Scholar] [CrossRef]
- Garreta, E.; Melo, E.; Navajas, D.; Farré, R. Low oxygen tension enhances the generation of lung progenitor cells from mouse embryonic and induced pluripotent stem cells. Physiol. Rep. 2014, 2, e12075. [Google Scholar] [CrossRef]
- Guo, N.N.; Liu, L.P.; Zhang, Y.X.; Cai, Y.T.; Guo, Y.; Zheng, Y.W.; Li, Y.M. Early prediction of the differentiation potential during the formation of human iPSC-derived embryoid bodies. Biochem. Biophys. Res. Commun. 2019, 516, 673–679. [Google Scholar] [CrossRef]
- Mummery, C.L.; Zhang, J.; Ng, E.S.; Elliott, D.A.; Elefanty, A.G.; Kamp, T.J. Differentiation of human embryonic stem cells and induced pluripotent stem cells to cardiomyocytes: A methods overview. Circ. Res. 2012, 111, 344–358. [Google Scholar] [CrossRef]
- Bogacheva, M.S.; Harjumäki, R.; Flander, E.; Taalas, A.; Bystriakova, M.A.; Yliperttula, M.; Xiang, X.; Leung, A.W.; Lou, Y.R. Differentiation of Human Pluripotent Stem Cells Into Definitive Endoderm Cells in Various Flexible Three-Dimensional Cell Culture Systems: Possibilities and Limitations. Front. Cell Dev. Biol. 2021, 9, 726499. [Google Scholar] [CrossRef]
- Quattrocelli, M.; Swinnen, M.; Giacomazzi, G.; Camps, J.; Barthélemy, I.; Ceccarelli, G.; Caluwé, E.; Grosemans, H.; Thorrez, L.; Pelizzo, G.; et al. Mesodermal iPSC-derived progenitor cells functionally regenerate cardiac and skeletal muscle. J. Clin. Investig. 2015, 125, 4463–4482. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shinohara, M.; Kimura, H.; Montagne, K.; Komori, K.; Fujii, T.; Sakai, Y. Combination of microwell structures and direct oxygenation enables efficient and size-regulated aggregate formation of an insulin-secreting pancreatic β-cell line. Biotechnol. Prog. 2014, 30, 178–187. [Google Scholar] [CrossRef] [PubMed]
- Rizki-Safitri, A.; Shinohara, M.; Miura, Y.; Danoy, M.; Tanaka, M.; Miyajima, A.; Sakai, Y. Efficient functional cyst formation of biliary epithelial cells using microwells for potential bile duct organisation in vitro. Sci. Rep. 2018, 8, 11086. [Google Scholar] [CrossRef] [PubMed]
- Tokito, F.; Shinohara, M.; Maruyama, M.; Inamura, K.; Nishikawa, M.; Sakai, Y. High density culture of pancreatic islet-like 3D tissue organized in oxygen-permeable porous scaffolds with external oxygen supply. J. Biosci. Bioeng. 2021, 131, 543–548. [Google Scholar] [CrossRef]
- Nit, K.; Tyszka-Czochara, M.; Bobis-Wozowicz, S. Oxygen as a master regulator of human pluripotent stem cell function and metabolism. J. Pers. Med. 2021, 11, 905. [Google Scholar] [CrossRef]
- Tsogtbaatar, E.; Landin, C.; Minter-Dykhouse, K.; Folmes, C.D.L. Energy Metabolism Regulates Stem Cell Pluripotency. Front. Cell Dev. Biol. 2020, 8, 87. [Google Scholar] [CrossRef] [Green Version]
- Guo, C.W.; Kawakatsu, M.; Idemitsu, M.; Urata, Y.; Goto, S.; Ono, Y.; Hamano, K.; Li, T.S. Culture under low physiological oxygen conditions improves the stemness and quality of induced pluripotent stem cells. J. Cell. Physiol. 2013, 228, 2159–2166. [Google Scholar] [CrossRef]
- Fisher, J.B.; Pulakanti, K.; Rao, S.; Duncan, S.A. GATA6 is essential for endoderm formation from human pluripotent stem cells. Biol. Open 2017, 6, 1084–1095. [Google Scholar] [CrossRef] [Green Version]
- Heslop, J.A.; Pournasr, B.; Liu, J.T.; Duncan, S.A. GATA6 defines endoderm fate by controlling chromatin accessibility during differentiation of human-induced pluripotent stem cells. Cell Rep. 2021, 35, 109145. [Google Scholar] [CrossRef]
- Brafman, D.A.; Moya, N.; Allen-Soltero, S.; Fellner, T.; Robinson, M.; McMillen, Z.L.; Gaasterland, T.; Willert, K. Analysis of SOX2-expressing cell populations derived from human pluripotent stem cells. Stem Cell Rep. 2013, 1, 464–478. [Google Scholar] [CrossRef] [Green Version]
- Varum, S.; Rodrigues, A.S.; Moura, M.B.; Momcilovic, O.; Easley IV, C.A.; Ramalho-Santos, J.; van Houten, B.; Schatten, G. Energy metabolism in human pluripotent stem cells and their differentiated counterparts. PLoS ONE 2011, 6, e20914. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- López-Anguita, N.; Gassaloglu, S.I.; Stötzel, M.; Typou, M.; Virta, I.; Hetzel, S.; Buschow, R.; Koksal, B.; Atilla, D.; Maitschke-Rajasekharan, R.; et al. Hypoxia induces a transcriptional early primitive streak signature in pluripotent cells enhancing spontaneous elongation and lineage representation in gastruloids. bioRxiv 2021. [Google Scholar] [CrossRef]
- Dunwoodie, S.L. The Role of Hypoxia in Development of the Mammalian Embryo. Dev. Cell 2009, 17, 755–773. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Goral, V.N.; Au, S.H.; Faris, R.A.; Yuen, P.K. Methods for advanced hepatocyte cell culture in microwells utilizing air bubbles. Lab Chip 2015, 15, 1032–1037. [Google Scholar] [CrossRef] [PubMed]
- Evenou, F.; Hamon, M.; Fujii, T.; Takeuchi, S.; Sakai, Y. Gas-permeable membranes and co-culture with fibroblasts enable high-density hepatocyte culture as multilayered liver tissues. Biotechnol. Prog. 2011, 27, 1146–1153. [Google Scholar] [CrossRef]
- Hamon, M.; Hanada, S.; Fujii, T.; Sakaif, Y. Direct oxygen supply with polydimethylsiloxane (PDMS) membranes induces a spontaneous organization of thick heterogeneous liver tissues from rat fetal liver cells in vitro. Cell Transplant. 2012, 21, 401–410. [Google Scholar] [CrossRef] [Green Version]
- Takayama, N.; Nishimura, S.; Nakamura, S.; Shimizu, T.; Ohnishi, R.; Endo, H.; Yamaguchi, T.; Otsu, M.; Nishimura, K.; Nakanishi, M.; et al. Transient activation of c-MYC expression is critical for efficient platelet generation from human induced pluripotent stem cells. J. Exp. Med. 2010, 207, 2817–2830. [Google Scholar] [CrossRef] [Green Version]
Gene | Forward Primer | Reverse Primer |
---|---|---|
OCT4 | AGTGGGTGGAGGAAGCTGACAAC | TCGGTTGTGCATAGTCGCTGCTTGA |
SOX2 | GGCAGCTACAGCATGATGCAGGAGC | CTGGTCATGGAGTTGTACGCAGG |
Nanog | AGGACAGGTTTCAGAAGCAGAAGT | TCAGACCATTGCTAGTCTTCAACC |
E-cadherin | AGCCCTTACTGCCCCCAGAG | GGGAAGATACCGGGGGACAC |
N-cadherin | CAACGGGGACTGCACAGATG | TGTTTGGCCTGGCGTTCTTT |
OTX2 | GGAGAGGACGACATTTACTAGG | TTCTGACCTCCATTCTGCTG |
Nestin | GCGTTGGAACAGAGGTTGGA | TGGGAGCAAAGATCCAAGAC |
PAX6 | GAGTGCCCGTCCATCTTTG | GTCTGCGCCCATCTGTTGCTTTTC |
Brachyury | ATCGTGGACAGCCAGTACG | GCCAACTGCATCATCTCCAC |
RUNX1 | CCCTAGGGGATGTTCCAGAT | TGAAGCTTTTCCCTCTTCCA |
TBX6 | AAGTACCAACCCCGCATACA | TAGGCTGTCACGGAGATGAA |
GATA4 | AGCACACTGCATCTCTCCTGTG | CTCCGCTTGTTCTCAGATCCTC |
GATA6 | CCCACAACACAACCTACAGC | GCGAGACTGACGCCTATGTA |
FOXA2 | GCATTCCCAATCTTGACACGGTGA | GCCCTTGCAGCCAGAATACACATT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Khadim, R.R.; Vadivelu, R.K.; Utami, T.; Torizal, F.G.; Nishikawa, M.; Sakai, Y. Integrating Oxygen and 3D Cell Culture System: A Simple Tool to Elucidate the Cell Fate Decision of hiPSCs. Int. J. Mol. Sci. 2022, 23, 7272. https://doi.org/10.3390/ijms23137272
Khadim RR, Vadivelu RK, Utami T, Torizal FG, Nishikawa M, Sakai Y. Integrating Oxygen and 3D Cell Culture System: A Simple Tool to Elucidate the Cell Fate Decision of hiPSCs. International Journal of Molecular Sciences. 2022; 23(13):7272. https://doi.org/10.3390/ijms23137272
Chicago/Turabian StyleKhadim, Rubina Rahaman, Raja Kumar Vadivelu, Tia Utami, Fuad Gandhi Torizal, Masaki Nishikawa, and Yasuyuki Sakai. 2022. "Integrating Oxygen and 3D Cell Culture System: A Simple Tool to Elucidate the Cell Fate Decision of hiPSCs" International Journal of Molecular Sciences 23, no. 13: 7272. https://doi.org/10.3390/ijms23137272