Sequence, Expression, and Anti-GCRV Function of the Ferritin from the Grass Carp, Ctenopharyngodon idellus
Abstract
:1. Introduction
2. Results
2.1. Full-Length cDNA of Ciferritin
2.2. Sequence Alignment and Functional Structure of Ciferritin
2.3. Phylogenetic Tree Construction
2.4. Ciferritin Expression Change after GCRV Infection
2.5. Ciferritin Promoter Sequence
2.6. Correlation between Ciferritin Expression and Promoter Methylation Level
2.7. Anti-GCRV Effect of Ciferritin Overexpression
3. Discussion
4. Materials and Methods
4.1. Experimental Fish and Sample Collection
4.2. RNA Extraction and cDNA Template Synthesis
4.3. Full-Length cDNA Cloning of Ciferritin
4.4. Promoter Cloning of Ciferritin
4.5. Bioinformatics Analysis
4.6. Ciferritin Expressions in Grass Carp after Infection and of Different Resistance
4.7. Promoter Methylation Level Detection
4.8. Anti-GCRV Function of Ciferritin Overexpression in CIK Cells
4.9. Fluorescence Microscopy
4.10. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Moreira, A.C.; Mesquita, G.; Gomes, M.S. Ferritin: An inflammatory player keeping iron at the core of pathogen-host interactions. Microorganisms 2020, 8, 589. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huang, H.S.; Jiang, Q.Q.; Wu, Y.; Qiu, X.T.; Lu, C.Y.; Su, C.; Zhou, J.; Li, Y.; Ming, T.H.; Su, X.R. Structure determination of ferritin from Dendrorhynchus zhejiangensis. Biochem. Biophys. Res. Commun. 2020, 531, 195–202. [Google Scholar] [CrossRef] [PubMed]
- Peña, T.C.; Cárcamo, C.B.; Díaz, M.I.; Winkler, F.M.; Morales-Lange, B.; Mercado, L.; Brokordt, K.B. Cloning and molecular characterization of two ferritins from red abalone Haliotis Rufescens and their expressions in response to bacterial challenge at juvenile and adult life stages. Fish Shellfish Immunol. 2018, 82, 279–285. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.K.; Cheng, D.W.; Tan, K.; Liu, H.X.; Ye, T.; Li, S.K.; Ma, H.Y.; Zheng, H.P. Identification of two ferritin genes and their expression profiles in response to bacterial challenge in noble scallop Chlamys Nobilis with different carotenoids content. Fish Shellfish Immunol. 2019, 88, 9–16. [Google Scholar] [CrossRef]
- Zhang, J.L.; Chen, X.H.; Hong, J.J.; Tang, A.F.; Liu, Y.; Xie, N.; Nie, G.H.; Yan, X.Y.; Liang, M.M. Biochemistry of mammalian ferritins in the regulation of cellular iron homeostasis and oxidative responses. Sci. China Life Sci. 2021, 64, 352–362. [Google Scholar] [CrossRef]
- Tang, T.; Yang, Z.; Li, J.; Yuan, F.; Xie, S.; Liu, F. Identification of multiple ferritin genes in Macrobrachium nipponense and their involvement in redox homeostasis and innate immunity. Fish Shellfish Immunol. 2019, 89, 701–709. [Google Scholar] [CrossRef]
- Hintze, K.J.; Theil, E.C. Cellular regulation and molecular interactions of the ferritins. Cell. Mol. Life Sci. 2006, 63, 591–600. [Google Scholar] [CrossRef]
- Cowley, J.M.; Janney, D.E.; Gerkin, R.C.; Buseck, P.R. The structure of ferritin cores determined by electron nanodiffraction. J. Struct. Biol. 2000, 131, 210–216. [Google Scholar] [CrossRef]
- Koralewski, M.; Balejcíková, L.; Mitróová, Z.; Pochylski, M.; Baranowski, M.; Kopčanský, P. Morphology and magnetic structure of the ferritin core during iron loading and release by magnetooptical and NMR methods. ACS Appl. Mater. Interfaces 2018, 10, 7777–7787. [Google Scholar] [CrossRef]
- Ding, Z.; Zhao, X.; Cui, L.; Sun, Q.H.; Zhang, F.; Wang, J.X.; Wang, W.M.; Liu, H. Novel insights into the immune regulatory effects of ferritins from blunt snout bream, Megalobrama amblycephala. Fish Shellfish Immunol. 2019, 87, 679–687. [Google Scholar] [CrossRef]
- Crielaard, B.J.; Lammers, T.; Rivella, S. Targeting iron metabolism in drug discovery and delivery. Nat. Rev. Drug Discov. 2017, 16, 400–423. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wessling-Resnick, M. Crossing the iron gate: Why and how transferrin receptors mediate viral entry. Annu. Rev. Nutr. 2018, 38, 431–458. [Google Scholar] [CrossRef] [PubMed]
- Chen, G.F.; Zhang, C.Y.; Wang, Y.Y.; Gou, C.L.; Sang, F.M.; Wang, C.M. Identification and characterization of a ferritin gene involved in the immune defense response of scallop Chlamys Farreri. Fish Shellfish Immunol. 2016, 55, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Haschka, D.; Hoffmann, A.; Weiss, G. Iron in immune cell function and host defense. Semin. Cell Dev. Biol. 2021, 115, 27–36. [Google Scholar] [CrossRef] [PubMed]
- Miller, K.; Traxler, G.; Kaukinen, K.; Li, S.; Richard, J.; Ginther, N. Salmonid host response to infectious hematopoietic necrosis (IHN) virus: Cellular receptors, viral control, and novel pathways of defence. Aquaculture 2007, 272, S217–S237. [Google Scholar] [CrossRef]
- Yang, H.; Liu, Z.; Jiang, Q.; Xu, J.J.; An, Z.H.; Zhang, Y.Y.; Xiong, D.M.; Wang, L.X. A novel ferritin gene from Procambarus clarkii involved in the immune defense against Aeromonas hydrophila infection and inhibits WSSV replication. Fish Shellfish Immunol. 2019, 86, 882–891. [Google Scholar] [CrossRef]
- Chen, X.X.; Li, Y.Y.; Chang, X.J.; Xie, X.L.; Liang, Y.T.; Wang, K.J.; Zheng, W.Y.; Liu, H.P. A CqFerritin protein inhibits white spot syndrome virus infection via regulating iron ions in red claw crayfish Cherax quadricarinatus. Dev. Comp. Immunol. 2018, 82, 104–112. [Google Scholar] [CrossRef]
- Yaacob, E.N.; De Geest, B.G.; Goethals, J.; Bajek, A.; Dierckens, K.; Bossier, P.; Vanrompay, D. Recombinant ferritin-H induces immunosuppression in European sea bass larvae (Dicentrarchus labrax) rather than immunostimulation and protection against a Vibrio anguillarum infection. Vet. Immunol. Immunopathol. 2018, 204, 19–27. [Google Scholar] [CrossRef] [Green Version]
- Sun, X.; Hong, Y.; Gong, Y.; Zheng, S.; Xie, D. Bioengineered ferritin nanocarriers for cancer therapy. Int. J. Mol. Sci. 2021, 22, 7023. [Google Scholar] [CrossRef]
- Zheng, L.; Liu, Z.; Wu, B.; Dong, Y.; Zhou, L.; Tian, J.; Sun, X.; Yang, A. Ferritin has an important immune function in the ark shell Scapharca broughtonii. Dev. Comp. Immunol. 2016, 59, 15–24. [Google Scholar] [CrossRef]
- Lin, S.J.; Lee, D.Y.; Wang, H.C.; Kang, S.T.; Hwang, P.P.; Kou, G.S.; Huang, M.F.; Chang, G.D.; Lo, C.F. White spot syndrome virus protein kinase 1 defeats the host cell’s iron-withholding defense mechanism by interacting with host ferritin. J. Virol. 2014, 89, 1083–1093. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Luo, S.W.; Mao, Z.W.; Luo, Z.Y.; Xiong, N.X.; Lou, K.K.; Liu, S.J.; Yan, T.; Ding, Y.M.; Zhao, R.R.; Wu, C.; et al. Chimeric ferritin H in hybrid crucian carp exhibits a similar down-regulation in lipopolysaccharide-induced NF-κB inflammatory signal in comparison with Carassius cuvieri and Carassius auratus red var. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2021, 241, 108966. [Google Scholar] [CrossRef] [PubMed]
- Xiao, T.Y.; Zhou, Z.Y.; Wang, R.H.; Li, Y.G.; Jin, S.Z.; Li, W.; Wang, H.Q. The expression and transmission of immune factors between generations in maternal Ctenopharyngodon idella after immunization with GCRV attenuated vaccine. J. Fish. Sci. China 2017, 41, 1308–1318. [Google Scholar]
- Xiong, N.X.; Luo, S.W.; Mao, Z.W.; Fan, L.F.; Luo, K.K.; Wang, S.; Hu, F.Z.; Wen, M.; Liu, Q.F.; Liu, S.J. Ferritin H can counteract inflammatory response in hybrid fish and its parental species after Aeromonas hydrophila infection. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2021, 250, 109174. [Google Scholar] [CrossRef]
- Zhang, S.C.; Wang, Z.P.; Wang, H.M. Maternal immunity in fish. Dev. Comp. Immunol. 2013, 39, 72–78. [Google Scholar] [CrossRef] [PubMed]
- Oh, M.; Umasuthan, N.; Elvitigala, D.A.S.; Wan, Q.; Jo, E.; Ko, J.; Noh, G.E.; Shin, S.; Rho, S.; Lee, J. First comparative characterization of three distinct ferritin subunits from a teleost: Evidence for immune-responsive mRNA expression and iron depriving activity of seahorse (Hippocampus abdominalis) ferritins. Fish Shellfish Immunol. 2016, 49, 450–460. [Google Scholar] [CrossRef]
- Arosio, P.; Ingrassia, R.; Cavadini, P. Ferritins: A family of molecules for iron storage, antioxidation and more. Biochim. Biophys. Acta Gen. Subj. 2009, 1790, 589–599. [Google Scholar] [CrossRef]
- Kao, W.P.; Yang, C.Y.; Su, T.W.; Wang, Y.T.; Lo, Y.C.; Lin, S.C. The versatile roles of CARDs in regulating apoptosis, inflammation, and NF-κB signaling. Apoptosis 2014, 20, 174–195. [Google Scholar] [CrossRef]
- Andrews, S.C. The Ferritin-like superfamily: Evolution of the biological iron storeman from a rubrerythrin-like ancestor. Biophys. Acta Gen. Subj. 2010, 1800, 691–705. [Google Scholar] [CrossRef]
- Sztukowska, M.; Bugno, M.; Potempa, J.; Travis, J.; Kurtz, D.M., Jr. Role of rubrerythrin in the oxidative stress response of Porphyromonas gingivalis. Mol. Microbiol. 2002, 44, 479–488. [Google Scholar] [CrossRef]
- Chu, P.F.; Zhu, Y.C.; Zhuang, M.L.; He, L.B.; Zhang, X.J. Autophagy signaling pathway is a therapeutic target to inhibit GCRV replication. Aquaculture 2021, 548, 737657. [Google Scholar] [CrossRef]
- Ye, T.; Wu, X.T.; Wu, W.L.; Dai, C.J.; Yuan, J.J. Ferritin protect shrimp Litopenaeus vannamei from WSSV infection by inhibiting virus replication. Fish Shellfish Immunol. 2015, 42, 138–143. [Google Scholar] [CrossRef] [PubMed]
- Maiti, B.; Khushiramani, R.; Tyagi, A.; Karunasagar, I.; Karunasagar, I. Recombinant ferritin protein protects Penaeus monodon infected by pathogenic Vibrio harveyi. Dis. Aquat. Organ. 2010, 88, 99–105. [Google Scholar] [CrossRef] [PubMed]
- Zhang, F.; Sun, D.; Fang, Q. Molecular characterization of outer capsid proteins VP5 and VP7 of grass carp reovirus. Viruses 2022, 14, 1032. [Google Scholar] [CrossRef]
- He, Y.; Yang, Q.; Xu, H.; Wu, H.; Wu, F.; Lu, L. Prokaryotic expression and purification of grass carp reovirus capsid protein VP7 and its vaccine potential. Afr. J. Microbiol. Res. 2011, 5, 1643–1648. [Google Scholar]
- Shao, L.; Sun, X.; Fang, Q. Antibodies against outer-capsid proteins of grass carp reovirus expressed in E. coli are capable of neutralizing viral infectivity. Virol. J. 2011, 8, 347. [Google Scholar] [CrossRef] [Green Version]
- Moghadam, H.; Mørkøre, T.; Robinson, N. Epigenetics-potential for programming fish for aquaculture? J. Mar. Sci. Eng. 2015, 3, 175–192. [Google Scholar] [CrossRef] [Green Version]
- Hu, Q.; Ao, Q.; Tan, Y.; Gan, X.; Luo, Y.; Zhu, J. Genome-wide DNA methylation and RNA analysis reveal potential mechanism of resistance to Streptococcus agalactiae in GIFT strain of nile tilapia (Oreochromis niloticus). J. Immunol. 2020, 204, 3182–3190. [Google Scholar] [CrossRef] [Green Version]
- Xiu, Y.; Shao, C.; Zhu, Y.; Li, Y.; Gan, T.; Xu, W.; Piferrer, F.; Chen, S. Differences in DNA methylation between disease-resistant and disease-susceptible Chinese tongue sole (Cynoglossus semilaevis) families. Front. Genet. 2019, 10, 847. [Google Scholar] [CrossRef] [Green Version]
- Shang, X.; Wan, Q.; Su, J.; Su, J. DNA methylation of CiRIG-I gene notably relates to the resistance against GCRV and negatively-regulates mRNA expression in grass carp, Ctenopharyngodon idella. Immunobiology 2016, 221, 23–30. [Google Scholar] [CrossRef]
- Zou, H.F.; Lan, Z.H.; Zhou, M.; Lu, W.Q. Promoter methylation and Hoxd4 regulate UII mRNA tissue-specific expression in olive flounder (Paralichthys olivaceus). Gen. Comp. Endocrinol. 2018, 262, 36–43. [Google Scholar] [CrossRef] [PubMed]
- Han, L.S.; Sun, Y.; Cao, Y.; Gao, P.P.; Quan, Z.J.; Chang, Y.Q.; Ding, J. Analysis of the gene transcription patterns and DNA methylation characteristics of triploid sea cucumbers (Apostichopus japonicus). Sci. Rep. 2021, 11, 7564. [Google Scholar] [CrossRef] [PubMed]
- Li, S.P.; He, F.; Wen, H.S.; Li, J.F.; Si, Y.F.; Liu, M.Y.; Huang, Y.J.; Meng, L.C. Low salinity affects cellularity, DNA methylation, and mRNA expression of igf1 in the liver of half smooth tongue sole (Cynoglossus semilaevis). Fish Physiol. Biochem. 2017, 43, 1587–1602. [Google Scholar] [CrossRef] [PubMed]
- Ye, N.; Wu, H.Z.; Zhang, Y.X. Maternal transfer and protection role in zebrafish (Danio rerio) offspring following vaccination of the brood stock with a live attenuated Vibrio anguillarum vaccine. Aquac. Res. 2016, 47, 3667–3678. [Google Scholar] [CrossRef]
- Guo, D.; Wu, B.; Yan, J.H.; Li, X.S.; Sun, H.M.; Zhou, D.S. A possible gene silencing mechanism: Hypermethylation of the Keap1 promoter abrogates binding of the transcription factor Sp1 in lung cancer cells. Biochem. Biophys. Res. Commun. 2012, 428, 80–85. [Google Scholar] [CrossRef]
- Liu, X.; Zhou, P.; Fan, F.; Li, D.; Wu, J.H.; Lu, Y.; Luo, Y. CpG site methylation in CRYAA promoter affect transcription factor Sp1 binding in human lens epithelial cells. BMC Ophthalmol. 2016, 16, 141. [Google Scholar] [CrossRef] [Green Version]
- Ren, W.H.; Wang, C.M.; Wang, Q.L.; Zhao, D.Z.; Zhao, K.; Sun, D.H.; Liu, X.G.; Han, C.F.; Hou, J.; Li, X.; et al. Bromodomain protein Brd3 promotes Ifnb1 transcription via enhancing IRF3/p300 complex formation and recruitment to Ifnb1 promoter in macrophages. Sci. Rep. 2017, 7, 39986. [Google Scholar] [CrossRef] [Green Version]
- Wang, J.P.; Tang, C.; Wang, Q.; Su, J.; Ni, T.; Yang, W.J.; Wang, Y.S.; Chen, W.; Liu, X.Q.; Wang, S.; et al. NRF1 coordinates with DNA methylation to regulate spermatogenesis. FASEB J. 2017, 31, 4959–4970. [Google Scholar] [CrossRef] [Green Version]
- Tao, L.; Wang, X.Y.; Zhou, Q. Long noncoding RNA SNHG16 promotes the tumorigenicity of cervical cancer cells by recruiting transcriptional factor SPI1 to upregulate PARP9. Cell Biol. Int. 2019, 44, 773–784. [Google Scholar] [CrossRef]
- Leichsenring, M.; Maes, J.; Mössner, R.; Driever, W.; Onichtchouk, D. Pou5f1 transcription factor controls zygotic gene activation in vertebrates. Science 2013, 341, 1005–1009. [Google Scholar] [CrossRef]
- Hu, H.; Miao, Y.R.; Jia, L.H.; Yu, Q.Y.; Zhang, Q.; Guo, A.Y. AnimalTFDB 3.0: A comprehensive resource for annotation and prediction of animal transcription factors. Nucleic Acids Res. 2018, 47, D33–D38. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.G.; Huang, X.D.; Guan, Y.Y.; Shi, Y.; Zhang, H.; He, M.X. DNA methylation is associated with expression level changes of galectin gene in mantle wound healing process of pearl oyster, Pinctada fucata. Fish Shellfish Immunol. 2015, 45, 912–918. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.G.; Jin, S.; Zhao, X.; Luo, H.; Li., R.; Li., D.; Xiao., T.Y. Sequence and expression analysis of the cytoplasmic pattern recognition receptor melanoma differentiation-associated gene 5 from the barbel chub Squaliobarbus curriculus. Fish Shellfish Immunol. 2019, 94, 485–496. [Google Scholar] [CrossRef] [PubMed]
Primer Name | Primer Sequence 5′-3′ | Usage |
---|---|---|
Ft-F1 | AGATTCGCCAGAACTACGAAC | RACE |
Ft-R1 | GCTGCATGACAACATTAGCTT | RACE |
Ft-F2 | GAAGAACGTCAACCAGGCTCT | RACE |
Ft-R2 | ACATTCAAGAACGCATTGGCT | RACE |
Ferritin F | CGTATTCCGACGTAGACTCTT | qPCR |
Ferritin R | AAAGTTAACATTTAGAGGCTACA | qPCR |
Ferritin P1 | ATGAATTTCTCGGCATGCTCGCGCTCCT | Promoter cloning |
Ferritin P2 | AGTGTAGCCAGCATAAAGCTCCAGATTCACCA | Promoter cloning |
Ferritin YF | TCTTCCCGGTTTTGCCAAGT | qPCR |
Ferritin YR | TCATCGCGCTCAGGTTTCTT | qPCR |
β-actin YF | GCTATGTGGCTCTTGACTTCG | qPCR |
β-actin YR | GGGCACCTGAACCTCTCATT | qPCR |
18sYF | ATTTCCGACACGGAGAGG | qPCR |
18sYR | CATGGGTTTAGGATACGCTC | qPCR |
IFN1 YF | AATGCTCTGCTTGCGAATG | qPCR |
IFN1 YR | CCTGGAAATGACACCTTGG | qPCR |
Mx YF | CGACCACAGAAGCATTGCAGA | qPCR |
Mx YR | CCCTTCAGTGCCTTTATCCACCA | qPCR |
VP2F | GAGCTTACCGGCGTCCTGAT | qPCR |
VP2R | GGTCGGAGGCCATCGTGTAA | qPCR |
VP7F | CCATGACACTCACGCACACG | qPCR |
VP7R | GGCAAGCGAAGGTCAGGTTG | qPCR |
Ferritin MF | aggaagagagAGAATGATAGATAGTTTTTTGTTGGA | Methylation detection |
Ferritin MR | cagtaatacgactcactatagggagaaggctCATAAAACTCCAAATTCACCATCTT | Methylation detection |
Ferritin OF | tcgagctcaagcttcgaattcATGGATTCTCAGATTCGCCAGA | Overexpression |
Ferritin OR | cgtcatggtggcggcggatccGCTGTCTCCATCCAGGGTGTG | Overexpression |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xiao, T.; Li, D.; Tang, H.; Liao, Y.; Zou, J.; Li, Y. Sequence, Expression, and Anti-GCRV Function of the Ferritin from the Grass Carp, Ctenopharyngodon idellus. Int. J. Mol. Sci. 2022, 23, 6835. https://doi.org/10.3390/ijms23126835
Xiao T, Li D, Tang H, Liao Y, Zou J, Li Y. Sequence, Expression, and Anti-GCRV Function of the Ferritin from the Grass Carp, Ctenopharyngodon idellus. International Journal of Molecular Sciences. 2022; 23(12):6835. https://doi.org/10.3390/ijms23126835
Chicago/Turabian StyleXiao, Tiaoyi, Dongfang Li, Hao Tang, Yijing Liao, Jun Zou, and Yaoguo Li. 2022. "Sequence, Expression, and Anti-GCRV Function of the Ferritin from the Grass Carp, Ctenopharyngodon idellus" International Journal of Molecular Sciences 23, no. 12: 6835. https://doi.org/10.3390/ijms23126835
APA StyleXiao, T., Li, D., Tang, H., Liao, Y., Zou, J., & Li, Y. (2022). Sequence, Expression, and Anti-GCRV Function of the Ferritin from the Grass Carp, Ctenopharyngodon idellus. International Journal of Molecular Sciences, 23(12), 6835. https://doi.org/10.3390/ijms23126835