MicroRNA Expression in Clear Cell Renal Cell Carcinoma Cell Lines and Tumor Biopsies: Potential Therapeutic Targets
Abstract
1. Introduction
2. Results
2.1. miR Expression Profile of ccRCC Cell Lines Relative to Normal Kidney Cells
2.2. miR Profile in ccRCC Biopsies and Matching Normal Kidney Tissue
2.3. Modulation of miRs Using Biologically Targeted Agents
3. Discussion
4. Materials and Methods
4.1. Cell Lines
4.2. RNA Isolation
4.3. cDNA Synthesis
4.4. Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Puissegur, M.-P.; Mazure, N.M.; Bertero, T.; Pradelli, L.; Grosso, S.; Robbe-Sermesant, K.; Maurin, T.; Lebrigand, K.; Cardi-naud, B.; Hofman, V.; et al. miR-210 is overexpressed in late stages of lung cancer and mediates mitochondrial alterations associated with modulation of HIF-1 activity. Cell Death Differ. 2011, 18, 465–478. [Google Scholar] [CrossRef] [PubMed]
 - Sim, J.; Johnson, R.S. Through a clear cell, Darkly: HIF2α/PLIN2-maintained fat droplets protect ccRCCs from ER stress. Cancer Discov. 2015, 5, 584–585. [Google Scholar] [CrossRef] [PubMed]
 - Mylonis, I.; Simos, G.; Paraskeva, E. Hypoxia-Inducible Factors and the Regulation of Lipid Metabolism. Cells 2019, 8, 214. [Google Scholar] [CrossRef] [PubMed]
 - An, X.; Sarmiento, C.; Tan, T.; Zhu, H. Regulation of multidrug resistance by microRNAs in anti-cancer therapy. Acta Pharm. Sin. B 2017, 7, 38–51. [Google Scholar] [CrossRef]
 - Si, W.; Shen, J.; Zheng, H.; Fan, W. The role and mechanisms of action of microRNAs in cancer drug resistance. Clin. Epigenet. 2019, 11, 25. [Google Scholar] [CrossRef]
 - Bayraktar, R.; Van Roosbroeck, K. miR-155 in cancer drug resistance and as target for miRNA-based therapeutics. Cancer Metastasis Rev. 2018, 37, 33–44. [Google Scholar] [CrossRef]
 - Ma, J.; Dong, C.; Ji, C. MicroRNA and drug resistance. Cancer Gene Ther. 2010, 17, 523–531. [Google Scholar] [CrossRef]
 - Toth, R.K.; Warfel, N.A. Strange Bedfellows: Nuclear Factor, Erythroid 2-Like 2 (Nrf2) and Hypoxia-Inducible Factor 1 (HIF-1) in Tumor Hypoxia. Antioxidants 2017, 6, 27. [Google Scholar] [CrossRef]
 - Oh, S.A.; Liu, M.; Nixon, B.G.; Kang, D.; Toure, A.; Bivona, M.; Li, M.O. Foxp3-independent mechanism by which TGF-β controls peripheral T cell tolerance. Proc. Natl. Acad. Sci. USA 2017, 114, e7536–e7544. [Google Scholar] [CrossRef]
 - Sun, X.; Cui, Y.; Feng, H.; Liu, H.; Liu, X. TGF-β signaling controls Foxp3 methylation and T reg cell differentiation by modulating Uhrf1 activity. J. Exp. Med. 2019, 216, 2819–2837. [Google Scholar] [CrossRef]
 - Arfmann-Knübel, S.; Struck, B.; Genrich, G.; Helm, O.; Sipos, B.; Sebens, S.; Schäfer, H. The Crosstalk between Nrf2 and TGF-β1 in the Epithelial-Mesenchymal Transition of Pancreatic Duct Epithelial Cells. PLoS ONE 2015, 10, e0132978. [Google Scholar] [CrossRef] [PubMed]
 - Sitaram, R.T.; Mallikarjuna, P.; Landström, M.; Ljungberg, B. Transforming growth factor-β promotes aggressiveness and invasion of clear cell renal cell carcinoma. Oncotarget 2016, 7, 35917–35931. [Google Scholar] [CrossRef] [PubMed]
 - Guerrero, P.A.M.; McCarty, J.H. TGF-β activation and signaling in angiogenesis. In Physiologic and Pathologic Angiogenesis—Signaling Mechanisms and Targeted Therapy; InTechOpen: London, UK, 2017; pp. 3–23. [Google Scholar]
 - Toraih, E.A.; Ibrahiem, A.T.; Fawzy, M.S.; Hussein, M.H.; Al-Qahtani, S.A.M.; Shaalan, A.A.M. MicroRNA-34a: A Key Regulator in the Hallmarks of Renal Cell Carcinoma. Oxid. Med. Cell. Longev. 2017, 2017, 3269379. [Google Scholar] [CrossRef] [PubMed]
 - Genovese, G.; Ergun, A.; Shukla, S.A.; Campos, B.; Hanna, J.; Ghosh, P.; Quayle, S.N.; Rai, K.; Colla, S.; Ying, H.; et al. microRNA regulatory network inference identifies miR-34a as a novel regulator of TGF-β signaling in glioblastoma. Cancer Discov. 2012, 2, 736–749. [Google Scholar] [CrossRef]
 - Yu, G.; Yao, W.; Xiao, W.; Li, H.; Xu, H.; Lang, B. MicroRNA-34a functions as an anti-metastatic microRNA and suppresses angiogenesis in bladder cancer by directly targeting CD44. J. Exp. Clin. Cancer Res. 2014, 33, 779. [Google Scholar] [CrossRef]
 - Lazarova, M.; Steinle, A. Impairment of NKG2D-Mediated Tumor Immunity by TGF-β. Front. Immunol. 2019, 10, 2689. [Google Scholar] [CrossRef]
 - Hagemann-Jensen, M.; Uhlenbrock, F.; Kehlet, S.; Andresen, L.; Gabel-Jensen, C.; Ellgaard, L.; Gammelgaard, B.; Skov, S. The Selenium Metabolite Methylselenol Regulates the Expression of Ligands That Trigger Immune Activation through the Lymphocyte Receptor NKG2D. J. Biol. Chem. 2014, 289, 31576–31590. [Google Scholar] [CrossRef]
 - Yi, M.; Xu, L.; Jiao, Y.; Luo, S.; Li, A.; Wu, K. The role of cancer-derived microRNAs in cancer immune escape. J. Hematol. Oncol. 2020, 13, 25. [Google Scholar] [CrossRef]
 - Catalanotto, C.; Cogoni, C.; Zardo, G. MicroRNA in Control of Gene Expression: An Overview of Nuclear Functions. Int. J. Mol. Sci. 2016, 17, 1712. [Google Scholar] [CrossRef]
 - Giubellino, A.; Ricketts, C.J.; Moreno, V.; Linehan, W.M.; Merino, M.J. MicroRNA Profiling of Morphologically Heterogeneous Clear Cell Renal Cell Carcinoma. J. Cancer 2021, 12, 5375–5384. [Google Scholar] [CrossRef]
 - Grange, C.; Collino, F.; Tapparo, M.; Camussi, G. Oncogenic micro-RNAs and renal cell carcinoma. Front. Oncol. 2014, 4, 49. [Google Scholar] [CrossRef] [PubMed]
 - Bavelloni, A.; Ramazzotti, G.; Poli, A.; Piazzi, M.; Focaccia, E.; Blalock, W.; Faenza, I. MiRNA-210: A Current Overview. Anticancer Res. 2017, 37, 6511–6521. [Google Scholar]
 - Li, M.; Wang, Y.; Song, Y.; Bu, R.; Ying, W.; Fei, X.; Guo, Q.; Wu, B. MicroRNAs in renal cell carcinoma: A systematic review of clinical implications (Review). Oncol. Rep. 2015, 33, 1571–1578. [Google Scholar] [CrossRef] [PubMed]
 - Fedorko, M.; Pacik, D.; Wasserbauer, R.; Juracek, J.; Varga, G.; Ghazal, M.; Nussir, M.I. MicroRNAs in the Pathogenesis of Renal Cell Carcinoma and Their Diagnostic and Prognostic Utility as Cancer Biomarkers. Int. J. Biol. Markers 2016, 31, 26–37. [Google Scholar] [CrossRef] [PubMed]
 - Redova, M.; Poprach, A.; Besse, A.; Iliev, R.; Nekvindova, J.; Lakomy, R.; Radova, L.; Svoboda, M.; Dolezel, J.; Vyzula, R.; et al. MiR-210 expression in tumor tissue and in vitro effects of its silencing in renal cell carcinoma. Tumor Biol. 2013, 34, 481–491. [Google Scholar] [CrossRef] [PubMed]
 - Biswas, S.; Troy, H.; Leek, R.; Chung, Y.-L.; Li, J.-L.; Raval, R.R.; Turley, H.; Gatter, K.; Pezzella, F.; Griffiths, J.R.; et al. Effects of HIF-1α and HIF2α on Growth and Metabolism of Clear-Cell Renal Cell Carcinoma 786-0 Xenografts. J. Oncol. 2010, 2010, 757908. [Google Scholar] [CrossRef]
 - Tóth, K.; Chintala, S.; Rustum, Y.M. Constitutive expression of HIF-α plays a major role in generation of clear-cell phenotype in human primary and metastatic renal carcinoma. Appl. Immunohistochem. Mol. Morphol. 2014, 22, 642–647. [Google Scholar] [CrossRef] [PubMed]
 - Schödel, J.; Grampp, S.; Maher, E.R.; Moch, H.; Ratcliffe, P.J.; Russo, P.; Mole, D.R. Hypoxia, hypoxia-inducible transcription factors, and renal cancer. Eur. Urol. 2016, 69, 646–657. [Google Scholar] [CrossRef]
 - Hoefflin, R.; Harlander, S.; Schäfer, S.; Metzger, P.; Kuo, F.; Schönenberger, D.; Adlesic, M.; Peighambari, A.; Seidel, P.; Chen, C.-Y.; et al. HIF-1α and HIF-2α differently regulate tumour development and inflammation of clear cell renal cell carcinoma in mice. Nat. Commun. 2020, 11, 4111. [Google Scholar] [CrossRef]
 - Arreola, A.; Cowey, C.L.; Coloff, J.L.; Rathmell, J.C.; Rathmell, W.K. HIF1α and HIF2α exert distinct nutrient preferences in renal cells. PLoS ONE 2014, 9, e98705. [Google Scholar] [CrossRef][Green Version]
 - Branco-Price, C.; Zhang, N.; Schnelle, M.; Evans, C.; Katschinski, D.M.; Liao, D.; Ellies, L.; Johnson, R.S. Endothelial cell HIF-1α and HIF-2α differentially regulate metastatic success. Cancer Cell 2012, 21, 52–65. [Google Scholar] [CrossRef]
 - Wierzbicki, P.M.; Klacz, J.; Kotulak-Chrzaszcz, A.; Wronska, A.; Stanislawowski, M.; Rybarczyk, A.; Ludziejewska, A.; Kmiec, Z.; Matuszewski, M. Prognostic significance of VHL, HIF1A, HIF2A, VEGFA and p53 expression in patients with clear-cell renal cell carcinoma treated with sunitinib as first-line treatment. Int. J. Oncol. 2019, 55, 371–390. [Google Scholar] [CrossRef]
 - Sourbier, C.; Srivastava, G.; Ghosh, M.C.; Ghosh, S.; Yang, Y.; Gupta, G.; DeGraff, W.; Krishna, M.C.; Mitchell, J.B.; Rouault, T.A.; et al. Targeting HIF2α Translation with Tempol in VHL-Deficient Clear Cell Renal Cell Carcinoma. Oncotarget 2012, 3, 1472–1482. [Google Scholar] [CrossRef][Green Version]
 - Choueiri, T.K.; Bauer, T.M.; Papadopoulos, K.P.; Plimack, E.R.; Merchan, J.R.; McDermott, D.F.; Michaelson, M.D.; Appleman, L.J.; Thamake, S.; Perini, R.F.; et al. Inhibition of hypoxia-inducible factor-2α in renal cell carcinoma with belzutifan: A phase 1 trial and biomarker analysis. Nat. Med. 2021, 27, 802–805. [Google Scholar] [CrossRef]
 - Stenvang, J.; Petri, A.; Lindow, M.; Obad, S.; Kauppinen, S. Inhibition of microRNA function by antimiR oligonucleotides. Silence 2012, 3, 1. [Google Scholar] [CrossRef]
 - Fallah, J.; Rini, B.I. HIF Inhibitors: Status of Current Clinical Development. Curr. Oncol. Rep. 2019, 21, 6. [Google Scholar] [CrossRef]
 - Scheuermann, T.H.; Li, Q.; Ma, H.W.; Key, J.; Zhang, L.; Chen, R.; Garcia, J.A.; Naidoo, J.; Longgood, J.; Frantz, D.E.; et al. Allosteric inhibition of hypoxia inducible factor-2 with small molecules. Nat. Chem. Biol. 2013, 9, 271–276. [Google Scholar] [CrossRef]
 - Scheuermann, T.H.; Thomchick, D.R.; Machius, M.; Guo, Y.; Bruick, R.K.; Gardner, R.K. Artificial ligand binding within the HIF2α PAS-B domain of the HIF2 transcription factor. Proc. Natl. Acad. Sci. USA 2009, 106, 450–455. [Google Scholar] [CrossRef]
 - Jeong, W.; Rapisarda, A.; Park, S.R.; Kinders, R.J.; Chen, A.; Melilo, G.; Turkbey, B.; Steinberg, S.M.; Choyke, P.; Doroshow, J.H.; et al. Pilot trial of EZN-2968, an antisense oligonucleotide inhibitor of hypoxia-inducible factor-1 alpha (HIF-1α), in patients with refractory solid tumors. Cancer Chemother. Pharmacol. 2014, 73, 343–348. [Google Scholar] [CrossRef]
 - Yu, T.; Tang, B.; Sun, X. Development of Inhibitors Targeting Hypoxia-Inducible Factor 1 and 2 for Cancer Therapy. Yonsei Med. J. 2017, 58, 489–496. [Google Scholar] [CrossRef]
 - Downes, N.L.; Laham-Karam, N.; Kaikkonen, M.U.; Ylä-Herttuala, S. Differential but complementary HIF1α and HIF2α transcriptional regulation. Mol. Ther. 2018, 26, 1735–1745. [Google Scholar] [CrossRef]
 - Chintala, S.; Najrana, T.; Toth, K.; Cao, S.; Durrani, F.A.; Pili, R.; Rustum, Y.M. Prolyl hydroxylase 2 dependent and Von-Hippel-Lindau independent degradation of Hypoxia-inducible factor 1 and 2 alpha by selenium in clear cell renal cell carcinoma leads to tumor growth inhibition. BMC Cancer 2012, 12, 293. [Google Scholar] [CrossRef]
 - Rustum, Y.M.; Chintala, S.; Durrani, F.A.; Bhattacharya, A. Non-Coding Micro RNAs and Hypoxia-Inducible Factors Are Selenium Targets for Development of a Mechanism-Based Combination Strategy in Clear-Cell Renal Cell Carcinoma—Bench-to-Bedside Therapy. Int. J. Mol. Sci. 2018, 19, 3378. [Google Scholar] [CrossRef]
 - Cao, S.; Durrani, F.A.; Rustum, Y.M. Selective Modulation of the Therapeutic Efficacy of Anticancer Drugs by Selenium Containing Compounds against Human Tumor Xenografts. Clin. Cancer Res. 2004, 10, 2561–2569. [Google Scholar] [CrossRef]
 - Kim, Y.-B.; Baek, S.H.; Bogner, P.N.; Ip, C.; Rustum, Y.M.; Fakih, M.G.; Park, Y.M. Targeting the Nrf2-Prx1 pathway with selenium to enhance the efficacy and selectivity of cancer therapy. J. Cancer Mol. 2007, 3, 37–43. [Google Scholar]
 - Garje, R.; Brown, J.A.; Nepple, K.G.; Dahmoush, L.; Bellizzi, A.; Bonner, J.; Mott, S.L.; Zamba, G.; Laux, D.E.; Milhem, M.M.; et al. Preliminary results of phase I clinical trial of high doses of seleno-L-methionine (SLM) in sequential com-bination with axitinib in previously treated and relapsed clear cell renal cell carcinoma (ccRCC) patients. J. Clin. Oncol. 2019, 37 (Suppl. S7), 660. [Google Scholar] [CrossRef]
 - Zakharia, Y.S.J.; Reis, R.; Garje, R.; Born, J.; Rajput, M.; Humble, R.; Bellizi, A.; Rustum, Y.M. Potential role of sele-no-L-methionine (SLM) in the stabilization of tumor vasculature and enhanced efficacy of axitinib in previously treated patients with advanced clear cell renal cell carcinoma (ccRCC). In Proceedings of the Kidney Cancer Research Summit, Philadelphia, PA, USA, 7–8 October 2021. [Google Scholar]
 - Qiao, P.; Li, G.; Bi, W.; Yang, L.; Yao, L.; Wu, D. microRNA-34a inhibits epithelial mesenchymal transition in human cholangiocarcinoma by targeting Smad4 through transforming growth factor-beta/Smad pathway. BMC Cancer 2015, 15, 469. [Google Scholar] [CrossRef]
 - Liu, X.; Luo, X.; Wu, Y.; Dia, D.; Chen, W.; Fang, Z.; Deng, J.; Hao, Y.; Yang, X.; Zhang, T.; et al. MicroRNA-34a attenuates paclitaxel resistance in prostate cancer cells via direct suppression of JAG1/Notch1 axis. Cell. Physiol. Biochem. 2018, 50, 261–276. [Google Scholar] [CrossRef]
 - Zhang, L.; Liao, Y.; Tang, L. MicroRNA-34 family: A potential tumor suppressor and therapeutic candidate in cancer. J. Exp. Clin. Cancer Res. 2019, 38, 53. [Google Scholar] [CrossRef]
 - Slabáková, E.; Culig, Z.; Remšík, J.; Souček, K. Alternative mechanisms of miR-34a regulation in cancer. Cell Death Dis. 2017, 8, e3100. [Google Scholar] [CrossRef]
 - Hart, M.; Walch-Rückheim, R.; Friedman, K.S.; Rheinheimer, S.; Tanzer, T.; Glombitza, B.; Sester, M.; Lenhof, H.P.; Hoth, M.; Schwarz, E.C.; et al. miR-34a: A new player in the regulation of T cell function by modulation of NF-κB signaling. Cell Death Dis. 2019, 10, 46. [Google Scholar] [CrossRef]
 - Zhang, J.; Ye, Y.; Chang, D.W.; Lin, S.-H.; Huang, M.; Tannir, N.M.; Matin, S.; Karam, J.A.; Wood, C.G.; Chen, Z.-N.; et al. Global and Targeted miRNA Expression Profiling in Clear Cell Renal Cell Carcinoma Tissues Potentially Links miR-155-5p and miR-210-3p to both Tumorigenesis and Recurrence. Am. J. Pathol. 2018, 188, 2487–2496. [Google Scholar] [CrossRef]
 - Gilyazova, I.R.; Klimentova, E.A.; Bulygin, K.V.; Izmailov, A.A.; Bermisheva, M.A.; Galimova, E.F.; Safiullin, R.I.; Galimov, S.N.; Pavlov, V.N.; Khusnutdinova, E.K. MicroRNA-200 family expression analysis in metastatic clear cell renal cell carcinoma patients. Cancer Gene Ther. 2020, 27, 768–772. [Google Scholar] [CrossRef]
 - Suzuki, H.I. MicroRNA control of TGF-β signaling. Int. J. Mol. Sci. 2018, 19, 1901. [Google Scholar] [CrossRef]
 - Clerici, S.; Boletta, A. Role of the KEAP1-NRF2 Axis in Renal Cell Carcinoma. Cancers 2020, 12, 3458. [Google Scholar] [CrossRef]
 - Kim, B.-G.; Malek, E.; Choi, S.H.; Ignatz-Hoover, J.J.; Driscoll, J.J. Novel therapies emerging in oncology to target the TGF-β pathway. J. Hematol. Oncol. 2021, 14, 55. [Google Scholar] [CrossRef]
 - Terry, S.; Dalban, C.; Rioux-Leclercq, N.; Adam, J.; Meylan, M.; Buart, S.; Bougoüin, A.; Lespagnol, A.; Dugay, F.; Moreno, I.C.; et al. Association of AXL and PD-L1 Expression with Clinical Outcomes in Patients with Advanced Renal Cell Carcinoma Treated with PD-1 Blockade. Clin. Cancer Res. 2021, 27, 6749–6760. [Google Scholar] [CrossRef]
 - Goyette, M.-A.; Elkholi, I.E.; Apcher, C.; Kuasne, H.; Rothlin, C.V.; Muller, W.J.; Richard, D.E.; Park, M.; Gratton, J.-P.; Côté, J.-F. Targeting Axl favors an antitumorigenic microenvironment that enhances immunotherapy responses by decreasing Hif-1α levels. Proc. Natl. Acad. Sci. 2021, 118, e2023868118. [Google Scholar] [CrossRef]
 - Rankin, E.B.; Fuh, K.C.; Castellini, L.; Viswanathan, K.; Finger, E.C.; Diep, A.N.; LaGory, E.L.; Kariolis, M.S.; Chan, A.; Lindgren, D.; et al. Direct regulation of GAS6/AXL signaling by HIF promotes renal metastasis through SRC and MET. Proc. Natl. Acad. Sci. USA 2014, 111, 13373–13378. [Google Scholar] [CrossRef]
 - Auyez, A.; Sayan, A.E.; Kriajevska, M.; Tulchinsky, E. AXL Receptor in Cancer Metastasis and Drug Resistance: When Normal Functions Go Askew. Cancers 2021, 13, 4864. [Google Scholar] [CrossRef]
 - Ardizzone, A.; Calabrese, G.; Campolo, M.; Filippone, A.; Giuffrida, D.; Esposito, F.; Colarossi, C.; Cuzzocrea, S.; Esposito, E.; Paterniti, I. Role of miRNA-19a in Cancer Diagnosis and Poor Prognosis. Int. J. Mol. Sci. 2021, 22, 4697. [Google Scholar] [CrossRef]
 - Deshmukh, A.P.; Vasaikar, V.; Tomcza, K.K.; Tripathi, S.; den Hollander, P.; Arslan, E.; Chakraborty, P.; Soundararajan, R.; Jolly, M.K.; Rai, K.; et al. Identification of EMT signaling cross-talk and gene regulatory networks by single-cell RNA sequencing. Proc. Natl. Acad. Sci. USA 2021, 118, e2102050118. [Google Scholar] [CrossRef]
 - Hao, Y.; Baker, D.; Dijke, P.T. TGF-β-mediated epithelial-mesenchymal transition and cancer metastasis. Int. J. Mol. Sci. 2019, 20, 2767. [Google Scholar] [CrossRef]
 - Baello, S.; Iqbal, M.; Bloise, E.; Javam, M.; Gibb, W.; Matthews, S. TGF-β1 Regulation of Multidrug Resistance P-glycoprotein in the Developing Male Blood-Brain Barrier. Endocrinology 2014, 155, 475–484. [Google Scholar] [CrossRef]
 - McCubrey, J.A.; Fitzgerald, T.L.; Yang, L.V.; Lertpiriyapong, K.; Steelman, L.S.; Abrams, S.L.; Libra, M. Roles of GSK-3 and microRNAs on epithelial mesenchymal transition and cancer stem cells. Oncotarget 2017, 8, 14221–14250. [Google Scholar] [CrossRef]
 - Lu, Z.; Li, X.; Xu, Y.; Chen, M.; Chen, W.; Chen, T.; Tang, Q.; He, Z. microRNA-17 functions as an oncogene by downregulating Smad3 expression in hepatocellular carcinoma. Cell Death Dis. 2019, 10, 723. [Google Scholar] [CrossRef]
 - Ries, R.; Yu, W.; Holton, N.; Cao, H.; Amendt, B. Inhibition of the miR-17-92 Cluster Separates Stages of Palatogenesis. J. Dent. Res. 2017, 96, 1257–1264. [Google Scholar] [CrossRef]
 - Amendt, C.; Schirmacher, P.; Weber, H.; Blessing, M. Expression of a dominant negative type II TGF-beta receptor in mouse skin results in an increase in carcinoma incidence and an acceleration of carcinoma development. Oncogene 1998, 17, 25–34. [Google Scholar] [CrossRef]
 - Elston, R.; Inman, G.J. Crosstalk between p53 and TGF-β Signalling. J. Signal Transduct. 2012, 2012, 294097. [Google Scholar] [CrossRef]
 - Yang, Y.; Vocke, C.D.; Ricketts, C.J.; Wei, D.; Padilla-Nash, H.M.; Lang, M.; Sourbier, C.; Killian, J.K.; Boyle, S.L.; Worrell, R.; et al. Genomic and metabolic characterization of a chromophobe renal cell carcinoma cell line model (UOK276). Genes Chromosom. Cancer 2017, 56, 719–729. [Google Scholar] [CrossRef]
 - Bakouny, Z.; Braun, D.A.; Shukla, S.A.; Pan, W.; Gao, X.; Hou, Y.; Flaifel, A.; Tang, S.; Bosma-Moody, A.; He, M.X.; et al. Integrative molecular characterization of sarcomatoid and rhabdoid renal cell carcinoma. Nat. Commun. 2021, 12, 808. [Google Scholar] [CrossRef] [PubMed]
 




| miRNA | Forward Primer Sequences | Reverse Primer Sequences | 
|---|---|---|
| Hsa miR-17 (5′) | CAAAGTGCTTACAGTGCAGGTAG | |
| Hsa miR-19a (3′) | TGTGCAAATCTATGCAAAACTGA | |
| Hsa miR-34a (5′) | TGGCAGTGTCTTAGCTGGTTGT | |
| Hsa miR-155 (5′) | TTAATGCTAATCGTGATAGGGGTT | |
| Hsa miR-210 (3′) | CTGTGCGTGTGACAGCGGCTGA | |
| U6 | CTCGCTTCGGCAGCACAT | TTTGCGTGTCATCCTTGCG | 
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.  | 
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Swearson, S.; Rataan, A.O.; Eliason, S.; Amendt, B.A.; Zakharia, Y.; Salem, A.K.; Ho, T.; Rustum, Y.M. MicroRNA Expression in Clear Cell Renal Cell Carcinoma Cell Lines and Tumor Biopsies: Potential Therapeutic Targets. Int. J. Mol. Sci. 2022, 23, 5604. https://doi.org/10.3390/ijms23105604
Swearson S, Rataan AO, Eliason S, Amendt BA, Zakharia Y, Salem AK, Ho T, Rustum YM. MicroRNA Expression in Clear Cell Renal Cell Carcinoma Cell Lines and Tumor Biopsies: Potential Therapeutic Targets. International Journal of Molecular Sciences. 2022; 23(10):5604. https://doi.org/10.3390/ijms23105604
Chicago/Turabian StyleSwearson, Samuel, Aseel O. Rataan, Steven Eliason, Brad A. Amendt, Yousef Zakharia, Aliasger K. Salem, Thai Ho, and Youcef M. Rustum. 2022. "MicroRNA Expression in Clear Cell Renal Cell Carcinoma Cell Lines and Tumor Biopsies: Potential Therapeutic Targets" International Journal of Molecular Sciences 23, no. 10: 5604. https://doi.org/10.3390/ijms23105604
APA StyleSwearson, S., Rataan, A. O., Eliason, S., Amendt, B. A., Zakharia, Y., Salem, A. K., Ho, T., & Rustum, Y. M. (2022). MicroRNA Expression in Clear Cell Renal Cell Carcinoma Cell Lines and Tumor Biopsies: Potential Therapeutic Targets. International Journal of Molecular Sciences, 23(10), 5604. https://doi.org/10.3390/ijms23105604
        
                                                
