Next Article in Journal
SGLT2is and Renal Protection: From Biological Mechanisms to Real-World Clinical Benefits
Next Article in Special Issue
The Effect of Ethanol Treatment on the Quality of a New Table Grape Cultivar It 681–30 Stored at Low Temperature and after a 7-Day Shelf-Life Period at 20 °C: A Molecular Approach
Previous Article in Journal
Insights into the Pathophysiology of Psychiatric Symptoms in Central Nervous System Disorders: Implications for Early and Differential Diagnosis
Previous Article in Special Issue
Varied Expression of Senescence-Associated and Ethylene-Related Genes during Postharvest Storage of Brassica Vegetables
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 22
Issue 9
10.3390/ijms22094437
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Transcriptome Analysis of Pre-Storage 1-MCP and High CO2-Treated ‘Madoka’ Peach Fruit Explains the Reduction in Chilling Injury and Improvement of Storage Period by Delaying Ripening

by
Han Ryul Choi
1,2,
Min Jae Jeong
1,2,
Min Woo Baek
1,2,
Jong Hang Choi
1,
Hee Cheol Lee
1,2,
Cheon Soon Jeong
1,2,* and
Shimeles Tilahun
1,3,4,*
1
Department of Horticulture, Kangwon National University, Chuncheon 24341, Korea
2
Interdisciplinary Program in Smart Agriculture, Kangwon National University, Chuncheon 24341, Korea
3
Agriculture and Life Science Research Institute, Kangwon National University, Chuncheon 24341, Korea
4
Department of Horticulture and Plant Sciences, Jimma University, Jimma 378, Ethiopia
*
Authors to whom correspondence should be addressed.
Int. J. Mol. Sci. 2021, 22(9), 4437; https://doi.org/10.3390/ijms22094437
Submission received: 10 February 2021 / Revised: 22 April 2021 / Accepted: 22 April 2021 / Published: 23 April 2021
(This article belongs to the Special Issue Gene Transcriptional Regulation in Crops during Postharvest)
Browse Figures
Versions Notes

Abstract

:
Cold storage of peach fruit at low temperatures may induce chilling injury (CI). Pre-storage 1-MCP and high CO2 treatments were reported among the methods to ameliorate CI and reduce softening of peach fruit. However, molecular data indicating the changes associated with pre-storage 1-MCP and high CO2 treatments during cold storage of peach fruit are insufficient. In this study, a comparative analysis of the difference in gene expression and physico-chemical properties of fruit at commercial harvest vs. stored fruit for 12 days at 0 °C (cold-stored (CS), pre-storage 1-MCP+CS, and pre-storage high CO2+CS) were used to evaluate the variation among treatments. Several genes were differentially expressed in 1-MCP+CS- and CO2+CS-treated fruits as compared to CS. Moreover, the physico-chemical and sensory data indicated that 1-MCP+CS and CO2+CS suppressed CI and delayed ripening than the CS, which could lead to a longer storage period. We also identified the list of genes that were expressed commonly and exclusively in the fruit treated by 1-MCP+CS and CO2+CS and compared them to the fruit quality parameters. An attempt was also made to identify and categorize genes related to softening, physiological changes, and other ripening-related changes. Furthermore, the transcript levels of 12 selected representative genes from the differentially expressed genes (DEGs) in the transcriptome analysis were confirmed via quantitative real-time PCR (qRT-PCR). These results add information on the molecular mechanisms of the pre-storage treatments during cold storage of peach fruit. Understanding the genetic response of susceptible cultivars such as ‘Madoka’ to CI-reducing pre-storage treatments would help breeders release CI-resistant cultivars and could help postharvest technologists to develop more CI-reducing technologies.

1. Introduction

The family Rosaceae covers a wide range of fruit types (drupes, pomes, achenes, hips, follicles, and capsules) with various growing habits ranging from herbaceous to cane, bush and tree forms [1]. The drupe fruits’ species (peaches, apricots, almonds, plums, and cherries) are important crops worldwide. For instance, 24.45 million tons of peaches and nectarines were produced per year in 2018, out of which the Republic of Korea took a share of 205,741 Mt [2]. Peaches (Prunus persica L.) provide a range of vitamins, minerals, fiber, carotenoids, phenolics, and anthocyanin for a healthy diet [1,3,4,5]. In particular, the level of phenolics and antioxidant activity of red-fleshed peaches is comparable to that measured in blueberries, and its antioxidant activity is best correlated with phenolic content among peach cultivars [3,6].
Peach is a climacteric fruit, and the initiation and continuation of its ripening process are accelerated by ethylene [7,8,9]. While ripening is desirable to fulfill the customers’ needs, a prolonged storage period is equally important for the marketing and distribution of fleshy fruits [10]. Peach fruit is vulnerable to damage after harvest due to its soft tissues [11] and deteriorates quickly at ambient temperature [12]. One of the most common methods to slow the ripening processes and to extend the postharvest life of peach fruit is low-temperature (0–5 °C) storage [13,14]. However, prolonged storage of peach fruit at low temperatures can cause chilling injury (CI), a physiological disorder leading to a reduction in value. CI in peach causes wooly fruit that lacks juice and is undesirable to consumers [12,15]. Internal and external browning, reddish discoloration and breakdown of the flesh, decay, and the loss of normal ripening are some symptoms of CI [10,16]. Hence, methods to ameliorate CI can essentially contribute to the fruit industry. Jin et al. [17] reported that treating peach fruit with 0.5 μL L−1 1-methylcyclopropene (1-MCP) can prevent CI. Similarly, a significant reduction in CI and softening of peach fruit was reported following pre-storage high-CO2 treatment [10]. Although the above studies have reported the effect of 1-MCP and high CO2 treatment on the CI and physicochemical characteristics of peach fruit, molecular data indicating the changes during storage of peach fruit is insufficient. Hence, in this study, we treated ‘Madoka’ peach fruit with 1-MCP and high CO2, and stored the fruit at 0 °C for 12 days. The treated fruit were compared with the control to study the candidate genes related to CI and ripening of peach fruit.

2. Results

2.1. Assembly and Annotation

Mapping and sequencing results are summarized in Table 1 and Table 2. Novaseq 6000 platform and Illumina Truseq Stranded mRNA library prep kit were used for sequencing. Eight ‘Madoka’ peach fruit transcriptome datasets were generated in this study. The datasets were fruit at commercial harvest (control), CS, 1-MCP+CS, and CO2+CS, all in duplicate. A total of 44.05, 62.46, 60.05, and 62.41 million average reads were generated from the control, CS, CS+1-MCP, and CS+CO2, respectively. From the total reads, 41.52, 59.57, 58.01, and 59.84 million were mapped with high mapping rate (>94%) to the reference Prunus persica (GCA_000346465.2) from the control, CS, CS+1-MCP, and CS+CO2, respectively. We identified a total of 26,411 unigenes in the transcriptome contigs, and the identified unigenes were classified into three functional categories. From the identified unigenes, we assigned 258 genes to molecular function, 530 to biological processes, and 129 to cellular component. Further subcategories were also observed within each main category of the GO classification scheme, and the dominant subcategories from each main category are presented in Figure 1. Higher percentage of genes in molecular function were mainly involved in binding and catalytic activity. Moreover, cellular processes and metabolic processes encompasses 64% of the genes in biological processes. Similarly, the genes in cellular component were mainly categorized as cellular anatomical entity, intercellular component, and protein-containing complex (Figure 1).

2.2. DEGs in the Comparison of CS, 1-MCP+CS, and CO2+CS vs. Control Peach Fruit

Differentially expressed genes (DEGs) were compared on the basis of twofold change and p value < 0.05 during the comparison of control to CS, 1-MCP+CS, and CO2+CS. Venn diagrams summarize the number of overlapping differentially expressed genes in the comparison of CS, 1-MCP+CS, and CO2+CS vs. control (Figure 2). A total of 1465, 1904, and 1648 unigenes were differentially expressed during the comparison of CS, 1-MCP+CS, and CO2+CS, vs. control ‘Madoka’ peach fruit, respectively. From the differentially expressed unigenes, 801 (55%), 1251 (66%), and 913 (55%) were upregulated, and 664 (45%), 653 (34%), and 735 (45%) were downregulated in the CS, 1-MCP+CS, and CO2+CS fruit, respectively. More unigenes were expressed due to the combined effects of CS and pre-storage treatment of ‘Madoka’ peach fruit with 1-MCP and CO2 as compared to the CS (Figure 2). Commonly and exclusively expressed and identified DEGs in the comparison of CS vs. CO2+CS and 1-MCP+CS ‘Madoka’ peach fruit were summarized by heat map (Figure 3). A long list of identified, commonly and exclusively expressed DEGs that might attract researchers for more detailed work are reported in this study (Tables S1–S3). Attempts were also made to briefly discuss and relate some of the identified genes into different ripening-related parameters.

2.3. CI, Firmness, Total Pectin, PG Activity, and Related Genes

Pre-storage treatment of ‘Madoka’ peach fruit with 1-MCP and high CO2 was effective in delaying CI and the ripening process, as observed on the firmness, total pectin, and PG activity (Figure 4A). Quality parameters and the transcriptome analysis in this study were compared on the 12-d storage on the basis of the observation of CI in the control fruit (Figure 4C). CI was not observed in the fruit treated with pre-storage 1-MCP and high CO2 combined with cold storage while the untreated cold-stored fruit showed a CI index of 2.78% and higher sponginess after 12-d storage (Figure 4C).
The firmness, one of the most important quality indices for fruits, in CS fruit decreased from 63.31 N at harvest to 35.60 N on day 12, in contrast to 48.72 and 48.47 N in 1-MCP and high-CO2-treated fruit on the same day, respectively. Total pectin content also showed the same trend with firmness. However, PG activity was higher in the CS fruit as compared to pretreated fruit (Figure 4A).
Figure 3 shows the commonly and exclusively expressed and identified DEGs during the comparison of CS vs. 1-MCP+CS and CO2+CS. Tables S1–S3 also show gene expression levels and the details of their gene ID, mRNA_accession, protein accession, and gene descriptions. In this study, the combined effect of pre-storage high CO2 and 1-MCP treatment with CS reduced the rate of solubilization of pectin and PG activity (Figure 4A) as compared to CS. Moreover, beta-amylase 3, chloroplastic (BAM3) was commonly upregulated in both 1-MCP+CS and CO2+CS as compared to CS. Moreover, vegetative cell wall protein gp1 and the probable aquaporin PIP2-5 were upregulated due to the 1-MCP+CS (Figure 3, Tables S1 and S2). Nevertheless, the genes that encode cell wall hydrolytic enzymes such as endoglucanase 6, pectin acetylesterase 12, probable galacturonosyltransferase 15, and endo-1,3; 1,4-beta-D-glucanase were also commonly downregulated in both 1-MCP+CS and CO2+CS. Similarly, the genes encoding expansin-A6 and expansin-A4 were also downregulated in both 1-MCP+CS and CO2+CS (Figure 3, Table S1). The probable pectate lyase 8 was also downregulated due to CO2+CS (Figure 3, Table S3).

2.4. Weight Loss, Respiration and Ethylene Production Rates, and Related Genes

Weight loss of CS fruit was significantly higher than 1-MCP+CS and CO2+CS on the 12-d storage (Figure 3B). However, respiration and ethylene production rates were not significantly different between CS, 1-MCP+CS, and CO2+CS. The results imply that storage at low temperature could be efficient in reducing respiration and ethylene production rates, but the weight loss was significantly hindered by pre-storage 1-MCP and CO2 treatment. This could have been the possible reason for firmness and pectin content being maintained (Figure 3A). Moreover, we observed the significant down regulation of 1-aminocyclopropane-1-carboxylate oxidase homolog 1, transcript variant X1 in both 1-MCP+CS and CO2+CS as compared to CS (Figure 3, Table S1).

2.5. Stress-Related Genes Due to 1-MCP+CS, and CO2+CS Treatments

Following cold storage of high-CO2- and 1-MCP-treated fruits, genes related to stress response exhibited significant upregulation as compared to CS. Stress-related transcription factors such as ethylene-responsive transcription factor ERF113; ethylene-responsive transcription factor ERF071; and AP2-like ethylene-responsive transcription factor TOE3, transcript variant X2 were upregulated in response to 1-MCP+CS and CO2+CS as compared to CS (Figure 3, Table S1). Thaumatin-like protein 1, transcription factor MYB1R1, zinc finger protein ZAT10, and bZIP transcription factor 60 were also upregulated in response to 1-MCP+CS and CO2+CS as compared to CS. Moreover, abiotic stress acclimation genes such as cold shock protein CS66 and NAC transcription factor 29 were upregulated due to 1-MCP+CS treatment (Figure 3, Table S2). However, 12-oxophytodienoate reductase 3 (OPR3) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were commonly downregulated due to 1-MCP+CS and CO2+CS treatments as compared to CS (Figure 3, Table S1).

2.6. Color and Other Changes and the Related Genes

Anthocyanidin 3-O-glucosyltransferase 2 (3GT), glutathione S-transferase F12, 3-hydroxy-3-methylglutaryl-coenzyme A reductase 1(HMGR), and methanol O-anthraniloyltransferase (AMAT) were commonly downregulated due to 1-MCP+CS and CO2+CS treatments (Figure 3, Table S1). Similarly, the genes that encode dihydroflavonol 4-reductase (DFR) and chalcone–flavonone isomerase (CHI) were downregulated commonly in 1-MCP+CS and CO2+CS, and CO2+CS, respectively (Figure 3, Tables S1 and S3).

2.7. Verification of DEGs by qRT-PCR

The transcript levels of 12 selected representative genes (ERF113, ERF071, BAM3, TLP1, ZAT10, BZIP60, At1g64390, AMAT, EXPA6, EXPA4, PAE12, and DFR) were confirmed by qRT-PCR (Table 3 and Figure 5). Figure 5 shows transcript accumulation of the selected DEGs of ‘Madoka’ peach fruit by qRT-PCR for the comparison of control to CS, 1-MCP+CS, and CO2+CS. The expression trends of RNA-seq and qRT-PCR were quite similar for the observed 12 genes (Figure 5, Table S1). These results indicated that the expression patterns of these representative genes tested in the RNA-seq assay coincided with the results of qRT-PCR analysis, suggesting that the RNA-seq data are reliable. ERF113, ERF071, BAM3, TLP1, ZAT10, and BZIP60 showed a significant higher expression in both 1-MCP+CS and CO2+CS as compared to CS. However, At1g64390, AMAT, EXPA6, EXPA4, PAE12, and DFR showed significantly lower expression in both 1-MCP+CS and CO2+CS as compared to CS.

3. Discussion

Peach (Prunus persica L.) fruit are highly perishable and deteriorate quickly at ambient temperature. Cold storage is a common strategy to slow the ripening process and extend shelf life [13,14]. However, low-temperature storage could cause improper ripening and CI to the susceptible cultivars such as ‘Madoka’. Pre-storage treatments such as 1-MCP and high CO2 are known to reduce CI [10,17]. Hence, we treated ‘Madoka’ peach fruit with 1-MCP and high CO2 and stored them at 0 °C. The treated fruit were compared with the control to study the physico-chemical changes during cold storage and the associated genetic responses.
In this study, CI was not observed in 1-MCP+CS and CO2+CS, while the CS fruit showed a CI index of 2.78% after 12-d storage. According to Lee [10], moderate and severely injured fruit with CI index > 20% are not commercially acceptable due to the injury of the mesocarp surface on the opposite sides of the stone. Maruyama et al. [18] reported that the expression of genes encoding starch degrading enzymes such as beta-amylase 3, chloroplastic (BAM3) increased specifically under cold conditions. In this study, BAM3 was commonly upregulated in both 1-MCP+CS and CO2+CS as compared to CS, indicating that pre-storage 1-MCP and high CO2 could induce more CI resistance.
The ripening of peach fruit involves degradation or modification of cell wall [19]. During fruit ripening, there could be solubilization and depolymersation of pectin, which in turn contributes to middle lamella erosion and primary cell wall disintegration that results in softening and a decrease of firmness [20]. Cell wall hydrolytic enzymes such as pectate lyase (PL), pectin acetylesterase (PAEs), polygalacturonase (PG), and β-galactosidase (β-gal) are involved in the ripening process by solubilizing pectin polysaccharides of fruits [21]. In this study, the combined effect of pre-storage high-CO2 and 1-MCP treatment with CS reduced the rate of solubilization of pectin and PG activity. This could be attributed to the commonly downregulated genes that encode cell wall hydrolytic enzymes such as endoglucanase 6, pectin acetylesterase 12, probable galacturonosyltransferase 15, and endo-1,3; 1,4-beta-D-glucanase in both 1-MCP+CS and CO2+CS.
Expansins are thought to be involved in cell wall disassembly during fruit ripening and softening [22]. The genes encoding expansin-A6 and expansin-A4 were also downregulated in both 1-MCP+CS and CO2+CS, and could play a role in maintaining firmness of fruit as the cell walls do not disrupt for loosening and extension. The probable pectate lyase 8 was also downregulated due to CO2+CS. Moreover, vegetative cell wall protein gp1, which is the major component of the outer cell wall [23], and the probable aquaporin PIP2-5, which facilitates the transport of water and solutes across cell membrane [24], were upregulated due to the 1-MCP+CS. Hence, supplementing CS with 1-MCP and high CO2 pre-storage treatment could reduce CI and maintain firmness of peach fruit, in turn prolonging the storage period.
The results of the present study also imply that storage at low temperature could be efficient in reducing respiration and ethylene production rates, but the weight loss was significantly hindered by pre-storage 1-MCP and CO2 treatment. The climacteric rise of respiration in fruits during ripening is caused by the ethylene and the final step of ethylene biosynthesis catalyzed by 1-aminocyclopropane-1-carboxylate oxidase (ACCO) [21,25]. In this study, the downregulation of 1-aminocyclopropane-1-carboxylate oxidase homolog 1, transcript variant X1 in both 1-MCP and CO2 treatments could have been the possible reason for maintaining firmness and pectin content.
The ethylene signaling and response pathway includes ethylene response factors (ERFs), and ERFs act as a key regulatory hub in plant responses to abiotic stresses [26]. Moreover, thaumatin-like protein 1 that could be involved in protecting tissues from pathogen infection [9], transcription factor MYB1R1 [27], zinc finger protein ZAT10 [28], and bZIP transcription factor 60 [29] that expressed in response to environmental stresses were also upregulated in response to 1-MCP+CS and CO2+CS as compared to CS. Moreover, abiotic stress acclimation genes such as cold shock protein CS66 [30] and NAC transcription factor 29 [31] were upregulated due to 1-MCP+CS treatment. Hence, the upregulation of the above genes and transcription factors in the present study could be the response of the fruit to the stress caused by the exogenous 1-MCP and CO2 treatment.
12-oxophytodienoate reductase 3 (OPR3) is involved in the synthesis of jasmonic acid (JA) [32], which is known as a stress-related hormone [33]. In this study, OPR3 was commonly downregulated due to 1-MCP+CS and CO2+CS treatments as compared to CS. In abiotic stress, JA is usually involved in physiological and molecular responses. Physiological responses include activation of antioxidant system and accumulation of amino acids and soluble sugars; the molecular responses involve the expression of JA-associated genes [33]. Moreover, the gene that encodes glyceraldehyde-3-phosphate dehydrogenase (GAPDH), an essential component of the glycolytic pathway that converts glyceraldehyde-3-phosphate to 1,3-bisphosphoglycerate, was downregulated in this study due to 1-MCP+CS and CO2+CS treatments as compared to CS. In addition to its key role in glycolysis, GAPDH is involved in abiotic stress resistance in plants [34]. Taken together, delaying the synthesis of JA through downregulation of OPR3 and downregulation of GAPDH could contribute to delaying of physiological and molecular responses, in turn prolonging the storage period of peach fruit treated with 1-MCP+CS and CO2+CS as compared to CS.
The gene that encodes the glycosylation reaction for the accumulation of anthocyanin pigments, anthocyanidin 3-O-glucosyltransferase 2 (3GT) [35], and the gene that is involved in the transport and accumulation of anthocyanins and proanthocyanidins in the vacuole, glutathione S-transferase F12 (GSTF12) [36], were commonly downregulated due to 1-MCP+CS and CO2+CS. Moreover, the gene that encodes 3-hydroxy-3-methylglutaryl-coenzyme A reductase 1(HMGR), which catalyzes mevalonate pathway for isoprenoid (terpenoid) biosynthesis [37], was also downregulated due to 1-MCP+CS and CO2+CS. Hence, the downregulation of 3GT, GSTF12, and HMGR due to 1-MCP+CS and CO2+CS could play in maintaining color of peach fruit as the treatments affect synthesis of the two groups of plant pigments, anthocyanins and carotenoids (tetraterpenoids) [38].
Wang and Luca [39] reported that methanol O-anthraniloyltransferase (AMAT) is an enzyme responsible for the production of O-methyl anthranilate, an important aroma and flavor compound in the grapefruit. Tilahun et al. [21] also confirmed the same in kiwifruit. In this study, the gene that encodes AMAT was commonly downregulated in peach fruit in response to 1-MCP+CS and CO2+CS. Similarly, the genes that encode dihydroflavonol 4-reductase (DFR) and chalcone--flavonone isomerase (CHI) were downregulated commonly in 1-MCP+CS and CO2+CS, and CO2+CS, respectively. CHI and DFR catalyze the conversion of chalcones into flavanones and dihydroflavonols into flavan-3,4-diols, respectively [40,41]. Hence, the downregulation of genes related to color changes and flavonoid biosynthesis could be an indicator of delayed ripening due to both 1-MCP+CS and CO2+CS as compared to CS fruit.

4. Materials and Methods

4.1. Plant Material and Treatments

For this experiment, fruit of ‘Madoka’ peach cultivar, one of the commonly grown cultivars around Chuncheon, Korea, was selected and harvested at commercial maturity on September 20, 2019. After harvesting, fruit were transported immediately to the postharvest laboratory at the Department of Horticultural Sciences, Kangwon National University. Uniform fruits free of defects were carefully selected and kept at 8 °C for 3 h to remove field heat, and then were treated with 0.5 µL L−1 1-MCP (Smart Fresh, Agro fresh Korea Ltd., Seoul, Korea) for 24 h [42] and 30% CO2 for 6 h [10] in a sealed 62 L container at 0 °C [25]. Control fruit were treated at similar conditions without CO2 and 1-MCP treatment. Air in the sealed containers was ventilated and distributed by a fan (Coolertec CT8025L12RA-3P, Zhengzhou, China). Three containers were used for the treatments and control, and 30 fruit were placed in each container. The treated fruit were stored at 0 °C for 12 d (until the onset of chilling injury in the control fruit). Hence, the samples were categorized as fruit at commercial harvest (control), and three samples from the stored fruit on the 12 d (cold-stored (CS), 1-MCP+CS, and CO2+CS). Data for firmness, weight loss, respiration rate, ethylene production rate, and sensory evaluation were recorded at the beginning of the experiment and on the 12-d storage. Samples of fruit flesh were also taken for pectin content, polygalacturonase (PG) activity, and transcriptome analysis. The samples were frozen by liquid nitrogen and stored in a deep freezer (−80 °C) until analysis [21].

4.2. RNA Extraction and Sequencing Using Illumina Truseq Stranded mRNA Library Prep Kit

RNA extraction and sequencing were performed as described by Tilahun et al. [21] for three biological replicates from the control and treatments. Total RNA was extracted and pooled according to Park et al. [43]. RNA purity and integrity were checked as described by Johnson et al. [44], and mRNA sequencing was performed by the method followed by Kim [45].

4.3. Mapping Reads on a Reference Genome and Calculating Expression between Samples

Mapping and gene expression were performed according to Tilahun et al. [21]. Reads for each sample were mapped to the reference genome (Prunus persica (GCA_000346465.2)) by Tophat (v2.0.13) (http://ccb.jhu.edu/software/tophat/ accessed on 21 November 2020). The aligned results were then added to Cuffdiff (v2.2.0) (http://cole-trapnell-lab.github.io/cufflinks/cuffdiff/ accessed on 21 November 2020) to report differentially expressed genes. For library normalization and dispersion estimation, geometric and pooled methods (http://cole-trapnell-lab.github.io/cufflinks/cuffdiff/ accessed on 21 November 2020) were applied.

4.4. Identification of DEGs and Functional Enrichment Analysis

The method used by Kim [45] was implemented to detect DEGs between control and treatments after applying two filtering processes. Genes were filtered based on twofold change and p-value (p < 0.05), and DAVID (http://david.abcc.ncifcrf.gov/ accessed on 21 November 2020) was used to obtain a comprehensive set of functional annotations (Figure 6).

4.5. Verification of DEGs by RT-qPCR

Transcript accumulation of ERF113, ERF071, BAM3, TLP1, ZAT10, BZIP60, At1g64390, AMAT, EXPA6, EXPA4, PAE12, and DFR was evaluated via quantitative real-time RCR (RT-PCR) as described by Park et al. [43] using gene-specific primers (Table 3).

4.6. CI, Firmness, Pectin Content, and Polygalacturonase (PG) Activity

CI was assessed visually, and the CI index was calculated according to the method described by Lee [10]. Peach fruit firmness was measured by a Rheo meter (Sun Scientific Co. Ltd., Tokyo, Japan) from 10 fruit, two measurements per fruit, by a puncture at the equator with a maximum force of 10 kg and a 3 mm diameter round stainless steel probe with a flat end, as stated by Tilahun et al. [46]. PG activity and quantification of pectin were made following the methods described by Tilahun et al. [47].

4.7. Measurement of Weight loss, Respiration Rate, and Ethylene Production Rate

Fresh weight loss was measured as described by Tilahun et al. [48]. Peach fruit were weighed before storage and weighed again after 12-d storage to calculate percentage (%) weight loss during CS. Respiration rate and ethylene production rate of peach fruit was measured and expressed as described by Belew et al. [49].

4.8. Overall Sensory Evaluation

The overall acceptability of kiwifruit during the ripening period was evaluated as the mean value of the subjective scale made by 10 trained graduate students for flavor, color, sweetness, texture, and sponginess according to a subjective scale by Seo et al. [50] from bad (1) to excellent (5).

4.9. Statistical Analysis of Quality Parameters

Data of the considered quality parameters were expressed as means ± standard errors. SAS statistical software (SAS/STAT ® 9.1; SAS Institute Inc., Cary, NC, USA) was implemented for statistical analyses, and Duncan’s multiple range test was performed to observe differences between the treatment means.

5. Conclusions

The transcriptome analysis of ‘Madoka’ peach fruit treated with 1-MCP and high CO2 and stored for 12 d at 0 °C is reported in this study. To study the candidate genes linked to CI and cold storage of peach fruit, we compared the treated fruit with the control fruit. Several genes were differentially expressed in 1-MCP+CS- and CO2+CS-treated fruits as compared to CS. We also identified the list of genes that were expressed exclusively and commonly in the fruit treated by 1-MCP+CS and CO2+CS and compared them to the fruit quality parameters to study the changes observed after treatment. The findings showed that the effect of pre-storage treatments inhibited CI and delayed the process of ripening, which may lead to a longer storage period. An attempt was also made to identify and categorize genes related to softening, physiological changes, and other ripening-related changes. This study adds information on the molecular mechanisms of the pre-storage treatments during cold storage of peach fruit. Understanding the genetic response of susceptible cultivars uch as ‘Madoka’ to CI-reducing pre-storage treatments would help breeders release CI-resistant cultivars and could help postharvest technologists to develop more CI- reducing technologies.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/ijms22094437/s1. Table S1: List of commonly expressed and identified DEGs in the comparison of CS vs. CO2 + CS and 1-MCP + CS ‘Madoka’ peach fruit after 12 days storage. Table S2: List of exclusively expressed and identified DEGs in the comparison of control vs. CS with control vs. 1-MCP + CS ‘Madoka’ peach fruit after 12 days storage. Table S3: List of exclusively expressed and identified DEGs in the comparison of control vs. CS with control vs. CO2 + CS ‘Madoka’ peach fruit after 12 days storage.

Author Contributions

Conceptualization and methodology, H.R.C., S.T. and C.S.J.; data curation, M.W.B., M.J.J. and J.H.C.; software and formal analysis, S.T. and H.R.C.; resources, C.S.J.; original draft preparation, M.W.B., M.J.J., H.R.C. and H.C.L.; review and editing, S.T.; supervision, S.T. and C.S.J.; project administration, H.R.C.; funding acquisition, C.S.J. All authors have read and agreed to the published version of the manuscript.

Funding

Financial support from a scientific and technological support program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (NRF-2019R1F1A1063966) is gratefully acknowledged.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data sets are available upon reasonable request from the corresponding author.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Verde, I.; Abbott, A.G.; Scalabrin, S.; Jung, S.; Shu, S.; Marroni, F.; Zhebentyayeva, T.; Dettori, M.T.; Grimwood, J.; Cattonaro, F.; et al. The high-quality draft genome of peach (Prunus persica) identifies unique patterns of genetic diversity, domestication and genome evolution. Nat. Genet. 2013, 45, 487–494. [Google Scholar] [CrossRef] [Green Version]
  2. FAOSTAT. Food and Agriculture Organization of the United Nations Cropping Database. 2018. Available online: http://faostat3.fao.org/home/index.html (accessed on 20 December 2020).
  3. Byrne, D.H.; Noratto, G.; Cisneros-Zevallos, L.; Porter, W.; Vizzotto, M. Health benefits of peach, nectarine and plums. Acta Hortic. 2009, 841, 267–273. [Google Scholar] [CrossRef]
  4. Cevallos-Casals, B.A.; Byrne, D.; Okie, W.R.; Cisneros-Zevallos, L. Selecting new peach and plum genotypes rich in phenolic compounds and enhanced functional properties. Food Chem. 2006, 96, 273–280. [Google Scholar] [CrossRef]
  5. Gil, M.I.; Tomás-Barberán, F.A.; Hess-Pierce, B.; Kader, A.A. Antioxidant capacities, phenolic compounds, carotenoids, and vitamin C contents of nectarine, peach, and plum cultivars from California. J. Agric. Food Chem. 2002, 50, 4976–4982. [Google Scholar] [CrossRef] [PubMed]
  6. Vizzotto, M.; Cisneros-Zevallos, L.; Byrne, D.H.; Ramming, D.W.; Okie, W.R. Total phenolic, carotenoid, and anthocyanin content and antioxidant activity of peach and plum genotypes. Acta Hortic. 2006, 713, 453–455. [Google Scholar] [CrossRef]
  7. Lee, D.B.; Lee, G.J.; Kim, S.H.; Kang, I.K.; Choi, S.J.; Yun, H.K. Changes in fruit characteristics and expression of ripening-related genes in ‘madoka’ peaches treated with 1-methylcyclopropene and aminoethoxyvinylglycine. Hortic. Sci. Technol. 2020, 38, 32–43. [Google Scholar] [CrossRef]
  8. Taye, A.M.; Tilahun, S.; Seo, M.H.; Park, D.S.; Jeong, C.S. Effects of 1-MCP on quality and storability of cherry tomato (Solanum lycopersicum L.). Horticulturae 2019, 5, 29. [Google Scholar] [CrossRef] [Green Version]
  9. Rasori, A.; Ruperti, B.; Bonghi, C.; Tonutti, P.; Ramina, A. Characterization of two putative ethylene receptor genes expressed during peach fruit development and abscission. J. Exp. Bot. 2002, 53, 2333–2339. [Google Scholar] [CrossRef] [Green Version]
  10. Lee, E.J. Chilling injury and phytochemical composition of peach fruits as affected by high carbon dioxide treatment before cold storage. Hortic. Environ. Biotechnol. 2014, 55, 190–195. [Google Scholar] [CrossRef]
  11. Lee, G.; Lee, D.; Kim, S.; Choi, S.; Yun, H. Extended shelf-life of ‘Kumhong’ nectarine and ‘Madoka’ peach fruits by treating the trees with calcium compounds and chitosan. Korean J. Agric. Sci. 2019, 46, 737–754. [Google Scholar]
  12. Lurie, S.; Crisosto, C.H. Chilling injury in peach and nectarine. Postharvest Biol. Technol. 2005, 37, 195–208. [Google Scholar] [CrossRef]
  13. Dhanapal, A.P.; Crisosto, C.H. Association genetics of chilling injury susceptibility in peach (Prunus persica (L.) Batsch) across multiple years. 3 Biotech. 2013, 3, 481–490. [Google Scholar] [CrossRef] [Green Version]
  14. Lara, M.V.; Borsani, J.; Budde, C.O.; Lauxmann, M.A.; Lombardo, V.A.; Murray, R.; Andreo, C.S.; Drincovich, M.F. Biochemical and proteomic analysis of “Dixiland” peach fruit (Prunus persica) upon heat treatment. J. Exp. Bot. 2009, 60, 4315–4333. [Google Scholar] [CrossRef] [Green Version]
  15. Vizoso, P.; Meisel, L.A.; Tittarelli, A.; Latorre, M.; Saba, J.; Caroca, R.; Maldonado, J.; Cambiazo, V.; Campos-Vargas, R.; Gonzalez, M.; et al. Comparative EST transcript profiling of peach fruits under different post-harvest conditions reveals candidate genes associated with peach fruit quality. BMC Genom. 2009, 10, 423. [Google Scholar] [CrossRef] [Green Version]
  16. Jin, P.; Wang, K.; Shang, H.; Tong, J.; Zheng, Y. Low-temperature conditioning combined with methyl jasmonate treatment reduces chilling injury of peach fruit. J. Sci. Food Agric. 2009, 89, 1690–1696. [Google Scholar] [CrossRef]
  17. Jin, P.; Shang, H.; Chen, J.; Zhu, H.; Zhao, Y.; Zheng, Y. Effect of 1-Methylcyclopropene on Chilling Injury and Quality of Peach Fruit during Cold Storage. J. Food Sci. 2011, 76, S485–S491. [Google Scholar] [CrossRef]
  18. Maruyama, K.; Takeda, M.; Kidokoro, S.; Yamada, K.; Sakuma, Y.; Urano, K.; Fujita, M.; Yoshiwara, K.; Matsukura, S.; Morishita, Y.; et al. Metabolic pathways involved in cold acclimation identified by integrated analysis of metabolites and transcripts regulated by DREB1A and DREB2A. Plant Physiol. 2009, 150, 1972–1980. [Google Scholar] [CrossRef] [Green Version]
  19. Lurie, S.; Zhou, H.W.; Lers, A.; Sonego, L.; Alexandrov, S.; Shomer, I. Study of pectin esterase and changes in pectin methylation during normal and abnormal peach ripening. Physiol. Plant. 2003, 119, 287–294. [Google Scholar] [CrossRef]
  20. Zhang, L.; Chen, F.; Yang, H.; Sun, X.; Liu, H.; Gong, X.; Jiang, C.; Ding, C. Changes in firmness, pectin content and nanostructure of two crisp peach cultivars after storage. LWT-Food Sci. Technol. 2010, 43, 26–32. [Google Scholar] [CrossRef]
  21. Tilahun, S.; Choi, H.R.; Kwon, H.; Park, S.M.; Park, D.S.; Jeong, C.S. Transcriptome analysis of ‘Haegeum’gold kiwifruit following ethylene treatment to improve postharvest ripening quality. Agronomy 2020, 10, 487. [Google Scholar] [CrossRef] [Green Version]
  22. Wieczorek, K.; Golecki, B.; Gerdes, L.; Heinen, P.; Szakasits, D.; Durachko, D.M.; Cosgrove, D.J.; Kreil, D.P.; Puzio, P.S.; Bohlmann, H.; et al. Expansins are involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. Plant J. 2006, 48, 98–112. [Google Scholar] [CrossRef] [PubMed]
  23. Adair, W.S.; Apt, K.E. Cell wall regeneration in Chlamydomonas: Accumulation of mRNAs encoding cell wall hydroxyproline-rich glycoproteins. Proc. Natl. Acad. Sci. USA 1990, 87, 7355–7359. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Vajpai, M.; Mukherjee, M.; Sankararamakrishnan, R. Cooperativity in Plant Plasma Membrane Intrinsic Proteins (PIPs): Mechanism of Increased Water Transport in Maize PIP1 Channels in Hetero-tetramers. Sci. Rep. 2018, 8, 1–17. [Google Scholar] [CrossRef] [Green Version]
  25. Park, D.S.; Tilahun, S.; Park, K.C.; Choi, I.Y.; Jeong, C.S. Transcriptome analysis of astringent ‘Cheongdo-Bansi’ persimmon fruit treated with ethylene for removal of astringency. Postharvest Biol. Technol. 2019, 150, 52–59. [Google Scholar] [CrossRef]
  26. Müller, M.; Munné-Bosch, S. Ethylene response factors: A key regulatory hub in hormone and stress signaling. Plant Physiol. 2015, 169, 32–41. [Google Scholar] [CrossRef] [Green Version]
  27. Shin, D.; Moon, S.J.; Han, S.; Kim, B.G.; Park, S.R.; Lee, S.K.; Yoon, H.J.; Lee, H.E.; Kwon, H.B.; Baek, D.; et al. Expression of StMYB1R-1, a novel potato single MYB-like domain transcription factor, increases drought tolerance. Plant Physiol. 2011, 155, 421–432. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  28. Sakamoto, H.; Maruyama, K.; Sakuma, Y.; Meshi, T.; Iwabuchi, M.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Arabidopsis Cys2/His2-type zinc-finger proteins function as transcription repressors under drought, cold, and high-salinity stress conditions. Plant Physiol. 2004, 136, 2734–2746. [Google Scholar] [CrossRef] [Green Version]
  29. Iwata, Y.; Fedoroff, N.V.; Koizumi, N. Arabidopsis bZIP60 is a proteolysis-activated transcription factor involved in the endoplasmic reticulum stress response. Plant Cell 2008, 20, 3107–3121. [Google Scholar] [CrossRef] [Green Version]
  30. Sasaki, K.; Imai, R. Pleiotropic roles of cold shock domain proteins in plants. Front. Plant Sci. 2012, 2, 1–6. [Google Scholar] [CrossRef] [Green Version]
  31. Shao, H.; Wang, H.; Tang, X. NAC transcription factors in plant multiple abiotic stress responses: Progress and prospects. Front. Plant Sci. 2015, 6, 1–8. [Google Scholar] [CrossRef] [Green Version]
  32. Maynard, D.; Kumar, V.; Sproß, J.; Dietz, K.-J. 12-oxophytodienoic acid reductase 3 (OPR3) functions as NADPH-dependent α, β-ketoalkene reductase in detoxification and monodehydroascorbate reductase in redox homeostasis. Plant Cell Physiol. 2020, 61, 584–595. [Google Scholar] [CrossRef]
  33. Wang, J.; Song, L.; Gong, X.; Xu, J.; Li, M. Functions of jasmonic acid in plant regulation and response to abiotic stress. Int. J. Mol. Sci. 2020, 21, 1446. [Google Scholar] [CrossRef] [Green Version]
  34. Zeng, L.; Deng, R.; Guo, Z.; Yang, S.; Deng, X. Genome-wide identification and characterization of Glyceraldehyde-3-phosphate dehydrogenase genes family in wheat (Triticum aestivum). BMC Genom. 2016, 17, 1–10. [Google Scholar] [CrossRef] [Green Version]
  35. Kobayashi, S.; Ishimaru, M.; Ding, C.K.; Yakushiji, H.; Goto, N. Comparison of UDP-glucose: Flavonoid 3-O-glucosyltransferase (UFGT) gene sequences between white grapes (Vitis vinifera) and their sports with red skin. Plant Sci. 2001, 160, 543–550. [Google Scholar] [CrossRef]
  36. Li, X.; Gao, P.; Cui, D.; Wu, L.; Parkin, I.; Saberianfar, R.; Menassa, R.; Pan, H.; Westcott, N.; Gruber, M.Y. The Arabidopsis tt19-4 mutant differentially accumulates proanthocyanidin and anthocyanin through a 3’ amino acid substitution in glutathione S-transferase. Plant Cell Environ. 2011, 34, 374–388. [Google Scholar] [CrossRef]
  37. Nieto, B.; Forés, O.; Arró, M.; Ferrer, A. Arabidopsis 3-hydroxy-3-methylglutaryl-CoA reductase is regulated at the post-translational level in response to alterations of the sphingolipid and the sterol biosynthetic pathways. Phytochemistry 2009, 70, 53–59. [Google Scholar] [CrossRef]
  38. Sass-Kiss, A.; Kiss, J.; Milotay, P.; Kerek, M.M.; Toth-Markus, M. Differences in anthocyanin and carotenoid content of fruits and vegetables. Food Res. Int. 2005, 38, 1023–1029. [Google Scholar] [CrossRef]
  39. Wang, J.; Luca, V. De The biosynthesis and regulation of biosynthesis of Concord grape fruit esters, including “foxy” methylanthranilate. Plant J. 2005, 44, 606–619. [Google Scholar] [CrossRef]
  40. Fischer, T.C.; Halbwirth, H.; Meisel, B.; Stich, K.; Forkmann, G. Molecular cloning, substrate specificity of the functionally expressed dihydroflavonol 4-reductases from Malus domestica and Pyrus communis cultivars and the consequences for flavonoid metabolism. Arch. Biochem. Biophys. 2003, 412, 223–230. [Google Scholar] [CrossRef]
  41. Shirley, B.W.; Hanley, S.; Goodman, H.M. Effects of ionizing radiation on a plant genome: Analysis of two Arabidopsis transparent testa mutations. Plant Cell 1992, 4, 333–347. [Google Scholar]
  42. Menniti, A.M.; Gregori, R.; Donati, I. 1-Methylcyclopropene retards postharvest softening of plums. Postharvest Biol. Technol. 2004, 31, 269–275. [Google Scholar] [CrossRef]
  43. Park, D.S.; Tilahun, S.; Heo, J.Y.; Jeong, C.S. Quality and expression of ethylene response genes of ‘Daebong’ persimmon fruit during ripening at different temperatures. Postharvest Biol. Technol. 2017, 133. [Google Scholar] [CrossRef]
  44. Johnson, M.T.J.; Carpenter, E.J.; Tian, Z.; Bruskiewich, R.; Burris, J.N.; Carrigan, C.T.; Chase, M.W.; Clarke, N.D.; Covshoff, S.; dePamphilis, C.W.; et al. Evaluating Methods for Isolating Total RNA and Predicting the Success of Sequencing Phylogenetically Diverse Plant Transcriptomes. PLoS ONE 2012, 7. [Google Scholar] [CrossRef] [PubMed]
  45. Kim, S.H. Study on CEACAM1 Mediated Cell Death and Antitumor Effects of Metformin in 5-Fluorouracil Resistant Gastrointestinal Cancer Cells. Ph.D. Thesis, Seoul National University, Seoul, Korea, 2017. [Google Scholar]
  46. Tilahun, S.; Park, D.S.; Solomon, T.; Choi, H.R.; Jeong, C.S. Maturity stages affect nutritional quality and storability of tomato cultivars. CyTA-J. Food 2019. [Google Scholar] [CrossRef]
  47. Tilahun, S.; Choi, H.R.; Kim, S.H.; Park, D.S.; Lee, Y.M.; Solomon, T.; Jeong, C.S. Fruit Size and Placement in Packaging Affect Firmness-Related Quality Attributes of Muskmelon (Cucumis melo L.) Fruit. Korean J. Hortic. Sci. 2019, 37, 246–255. [Google Scholar]
  48. Tilahun, S.; Choi, H.R.; Park, D.S.; Lee, Y.M.; Choi, J.H.; Baek, M.W.; Hyok, K.; Park, S.M.; Jeong, C.S. Ripening quality of kiwifruit cultivars is affected by harvest time. Sci. Hortic. 2020, 261. [Google Scholar] [CrossRef]
  49. Belew, D.; Park, D.S.; Tilahun, S.; Jeong, C.S. The effects of treatment with ethylene-producing tablets on the quality and storability of Banana (Musa sp.). Hortic. Sci. Technol. 2016, 34, 746–754. [Google Scholar] [CrossRef]
  50. Seo, M.H.; Tilahun, S.; Jeong, C.S. Effect of ripening conditions on the quality and storability of muskmelon (Cucumis melo L.) fruits. Hortic. Sci. Technol. 2018, 36, 741–755. [Google Scholar]
Ijms 22 04437 g001 550
Figure 1. The percentage of genes in different GO sub-categories.
Figure 1. The percentage of genes in different GO sub-categories.
Ijms 22 04437 g001
Ijms 22 04437 g002 550
Figure 2. Numbers of commonly and exclusively expressed (A) upregulated and (B) downregulated genes based on twofold change and p-value < 0.05 during the comparison of control (control vs. CS), 1-MCP (control vs. 1-MCP+CS), and CO2 (control vs. CO2+CS) ‘Madoka’ peach fruit after 12 days storage at 0 °C.
Figure 2. Numbers of commonly and exclusively expressed (A) upregulated and (B) downregulated genes based on twofold change and p-value < 0.05 during the comparison of control (control vs. CS), 1-MCP (control vs. 1-MCP+CS), and CO2 (control vs. CO2+CS) ‘Madoka’ peach fruit after 12 days storage at 0 °C.
Ijms 22 04437 g002
Ijms 22 04437 g003 550
Figure 3. Heat map of commonly and exclusively expressed and identified DEGs in the comparison of CS vs. CO2+CS and 1-MCP+CS ‘Madoka’ peach fruit after 12 days storage.
Figure 3. Heat map of commonly and exclusively expressed and identified DEGs in the comparison of CS vs. CO2+CS and 1-MCP+CS ‘Madoka’ peach fruit after 12 days storage.
Ijms 22 04437 g003
Ijms 22 04437 g004 550
Figure 4. Firmness, total pectin, PG activity (A); weight loss, respiration rate, ethylene production rate (B); and fruit appearance, CI index, and sensory qualities (C) of ‘Madoka’ peach fruit at harvest and after 12 days storage at 0 °C with pre-storage 1-MCP and high CO2 treatments or without treatment (control). Data for firmness, CI index, and sensory quality are presented as a mean of 10 biological replicates ± standard errors. Total pectin, PG activity, weight loss, respiration rate, and ethylene production rate are presented as a mean of three replicates ± standard errors. Different letters on the bars indicate significant difference between treatments with Duncan’s multiple range test at p ≤ 0.05.
Figure 4. Firmness, total pectin, PG activity (A); weight loss, respiration rate, ethylene production rate (B); and fruit appearance, CI index, and sensory qualities (C) of ‘Madoka’ peach fruit at harvest and after 12 days storage at 0 °C with pre-storage 1-MCP and high CO2 treatments or without treatment (control). Data for firmness, CI index, and sensory quality are presented as a mean of 10 biological replicates ± standard errors. Total pectin, PG activity, weight loss, respiration rate, and ethylene production rate are presented as a mean of three replicates ± standard errors. Different letters on the bars indicate significant difference between treatments with Duncan’s multiple range test at p ≤ 0.05.
Ijms 22 04437 g004
Ijms 22 04437 g005 550
Figure 5. Transcript accumulation of the selected DEGs of ‘Madoka’ peach fruit by qRT-PCR for the comparison of fruit at harvest and after 12 days storage at 0 °C with pre-storage 1-MCP and high-CO2 treatments or without treatment (control). Vertical bars represent standard errors of the means (n = 3). Different letters on the bars indicate significant difference between treatments with Duncan’s multiple range test at p ≤ 0.05.
Figure 5. Transcript accumulation of the selected DEGs of ‘Madoka’ peach fruit by qRT-PCR for the comparison of fruit at harvest and after 12 days storage at 0 °C with pre-storage 1-MCP and high-CO2 treatments or without treatment (control). Vertical bars represent standard errors of the means (n = 3). Different letters on the bars indicate significant difference between treatments with Duncan’s multiple range test at p ≤ 0.05.
Ijms 22 04437 g005
Ijms 22 04437 g006 550
Figure 6. Flow chart of mRNA processing.
Figure 6. Flow chart of mRNA processing.
Ijms 22 04437 g006
Table
Table 1. Summary of the mapping rate at which readings for each peach sample are mapped to the reference genome.
Table 1. Summary of the mapping rate at which readings for each peach sample are mapped to the reference genome.
Sample NameTotal ReadsMapped ReadsMapping Rate
Control 44,051,17641,516,72194.25
CS62,460,60859,571,06195.37
1-MCP+CS 60,048,66058,007,00896.60
CO2+CS 62,411,25459,837,85295.88
Average 57,242,92554,733,16195.53
Table
Table 2. Summary of the average sequencing result.
Table 2. Summary of the average sequencing result.
Sample NameTotal BasesQ30 BasesRead Count% ≥Q30 Bases Mean Quality Score (PF)
Control 2,492,398,9172,350,084,08724,677,21794.2935.94
CS3,575,251,1263,410,220,66635,398,52695.3836.20
1-MCP+CS 3,269,381,1103,135,881,73732,370,11095.9136.31
CO2+CS 3,592,272,1513,442,927,01035,567,05195.8436.29
Table
Table 3. Selected genes and primers used for validation of the transcriptome analysis with the quantitative RT-PCR.
Table 3. Selected genes and primers used for validation of the transcriptome analysis with the quantitative RT-PCR.
Gene_IdGene DescriptionsPrimer Sequence 5’–3’-ForwardReverse
LOC18790383ethylene-responsive transcription factor ERF113 (ERF113)GGCTAGTGCATCTCCTCATTACCAGTGCCTGGCTTCGATAAA
LOC18781898thaumatin-like protein 1 (TLP1)GGGATCTGATGGAAGCGTAATGTCTCCGGCTTGTCGTTAG
LOC18777635beta-amylase 3, chloroplastic (BAM3)ACTCATGCAGCATTCCTCTACGGATTCCTCCTGCCTGATTT
LOC18767585ethylene-responsive transcription factor ERF071 (ERF071)TGGGATTCACTGGCACTATGGTTGGTAGGTAACCGTCTCTATG
LOC18792372zinc finger protein ZAT10 (ZAT10)CGAGACCTTTGACCTGAACATCGTCAATATCCTGGGCTTCTT
LOC18776076bZIP transcription factor 60 (BZIP60)CGTTGCTCTGCCTCTAATTCTCTCTTGGCCTTAGATCCACATT
LOC18776275endoglucanase 6 (At1g64390)CTGCAAGTGGTGAGCTTAGTGTAGTGGTCAGTGTTCCCATC
LOC18774729expansin-A6 (EXPA6)CGAGTACAGAGCTGGAATTGTAGTAACGGAAGCCGTTGATAG
LOC18773967expansin-A4 (EXPA4)CTCCTCTCCAGCACTTTGATTTTCTTCATACAGGGCACTCTTC
LOC18785045anthocyanidin 3-O-glucosyltransferase 2 (3GT)CGCCTCACCTGCTTGATTAATTAAGTCCGGAGAGCCAAAG
LOC18775995methanol O-anthraniloyltransferase (AMAT)CCCAAGGAGCAGATTCACTATCTCGTAATGCCAACGTGTAACT
LOC18775065pectin acetylesterase 12 (PAE12)TGGTGGGTTGGCATTGTAATATCTCCATAGGCCTCCAAGAA
LOC18782821glutathione S-transferase F12 (GSTF12)CCAGCAGTAGAAGATGGTGATTCTCCAGGGTTGTTCCCAATAG
LOC18788884dihydroflavonol 4-reductase (DFR)CGAAGAGCACCAGAAGTCATACCTAGAGTCTTGGAGGCGAAGTA
LOC187897991-aminocyclopropane-1-carboxylate oxidase (ACO1)GGAGACCAACTCTTCGGATTGGGATAGTAGTGGCACACAAAGG
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Choi, H.R.; Jeong, M.J.; Baek, M.W.; Choi, J.H.; Lee, H.C.; Jeong, C.S.; Tilahun, S. Transcriptome Analysis of Pre-Storage 1-MCP and High CO2-Treated ‘Madoka’ Peach Fruit Explains the Reduction in Chilling Injury and Improvement of Storage Period by Delaying Ripening. Int. J. Mol. Sci. 2021, 22, 4437. https://doi.org/10.3390/ijms22094437

AMA Style

Choi HR, Jeong MJ, Baek MW, Choi JH, Lee HC, Jeong CS, Tilahun S. Transcriptome Analysis of Pre-Storage 1-MCP and High CO2-Treated ‘Madoka’ Peach Fruit Explains the Reduction in Chilling Injury and Improvement of Storage Period by Delaying Ripening. International Journal of Molecular Sciences. 2021; 22(9):4437. https://doi.org/10.3390/ijms22094437

Chicago/Turabian Style

Choi, Han Ryul, Min Jae Jeong, Min Woo Baek, Jong Hang Choi, Hee Cheol Lee, Cheon Soon Jeong, and Shimeles Tilahun. 2021. "Transcriptome Analysis of Pre-Storage 1-MCP and High CO2-Treated ‘Madoka’ Peach Fruit Explains the Reduction in Chilling Injury and Improvement of Storage Period by Delaying Ripening" International Journal of Molecular Sciences 22, no. 9: 4437. https://doi.org/10.3390/ijms22094437

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop