Sustained Hypoxia Suppresses Joint Destruction in a Rat Model of Rheumatoid Arthritis via Negative Feedback of Hypoxia Inducible Factor-1α
Abstract
1. Introduction
2. Results
2.1. Effects of Sustained Hypoxia on HIF-1α in MH7A Cells
2.2. Effects of Deferoxamine (DFX) on HIF-1α after Sustained Hypoxia
2.3. Effects of Sustained Hypoxia on Arthritis
2.4. Histological Effects of Sustained Hypoxia on Arthritis
3. Discussion
4. Materials and Methods
4.1. Preparation of MH7A
4.2. Cultures under Different Levels of Oxygen Tension
4.3. Inhibition of PHD in Chronic Hypoxia
4.4. Real-Time Polymerase Chain Reaction (PCR)
4.5. Western Blot Analysis
4.6. CIA Model
4.7. Rearing Rats in a Hypoxic Chamber
4.8. Body Weight, Paw Volume, and Clinical Score
4.9. Histochemical Analysis
4.10. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- McInnes, I.B.; Schett, G. The pathogenesis of rheumatoid arthritis. N. Engl. J. Med. 2011, 365, 2205–2219. [Google Scholar] [CrossRef] [PubMed]
- Comella, N.F.L.; Matilla, M.F.; Cuesta, J.A.C. Have complementary therapies demonstrated effectiveness in rheumatoid arthritis? Reumatol. Clin. 2016, 12, 151–157. [Google Scholar] [CrossRef]
- Singh, J.A.; Wells, G.A.; Christensen, R.; Ghogomu, E.T.; Maxwell, L.; Macdonald, J.K.; Filippini, G.; Skoetz, N.; Francis, D.; Lopes, L.C.; et al. Adverse effects of biologics: A network meta-analysis and Cochrane overview. Cochrane Database Syst. Rev. 2011, 2011, CD008794. [Google Scholar] [CrossRef] [PubMed]
- Shimomura, S.; Inoue, H.; Arai, Y.; Nakagawa, S.; Fujii, Y.; Kishida, T.; Ichimaru, S.; Tsuchida, S.; Shirai, T.; Ikoma, K.; et al. Treadmill running ameliorates destruction of articular cartilage and subchondral bone, not only synovitis, in a rheumatoid arthritis rat model. Int. J. Mol. Sci. 2018, 19, 1653. [Google Scholar] [CrossRef] [PubMed]
- Lund-Olesen, K. Oxygen tension in synovial fluids. Arthritis Rheum. 1970, 13, 769–776. [Google Scholar] [CrossRef] [PubMed]
- Bruick, R.K.; McKnight, S.L. A conserved family of prolyl-4-hydroxylases that modify HIF. Science 2001, 294, 1337–1340. [Google Scholar] [CrossRef] [PubMed]
- Koh, M.Y.; Powis, G. Passing the baton: The HIF switch. Trends Biochem. Sci. 2012, 37, 364–372. [Google Scholar] [CrossRef] [PubMed]
- Yao, L.; Kan, E.M.; Lu, J.; Hao, A.; Dheen, S.T.; Kaur, C.; Ling, E.A. Toll-like receptor 4 mediates microglial activation and production of inflammatory mediators in neonatal rat brain following hypoxia: Role of TLR4 in hypoxic microglia. J. Neuroinflamm. 2013, 10, 785. [Google Scholar] [CrossRef] [PubMed]
- Gao, X.; Li, Y.; Wang, H.; Li, C.; Ding, J. Inhibition of HIF-1α decreases expression of pro-inflammatory IL-6 and TNF-α in diabetic retinopathy. Acta Ophthalmol. 2017, 95, e746–e750. [Google Scholar] [CrossRef] [PubMed]
- Uchida, T.; Rossignol, F.; Matthay, M.A.; Mounier, R.; Couette, S.; Clottes, E.; Clerici, C. Prolonged hypoxia differentially regulates hypoxia-inducible factor (HIF)-1 alpha and HIF-2 alpha expression in lung epithelial cells: Implications of natural antisense HIF-1 alpha. J. Biol. Chem. 2004, 279, 14871–14878. [Google Scholar] [CrossRef]
- Saxena, K.; Jolly, M.K. Acute vs. chronic vs. cyclic hypoxia: Their differential dynamics, molecular mechanisms, and effects on tumor progression. Biomolecules 2019, 9, 339. [Google Scholar] [CrossRef] [PubMed]
- Bartoszewski, R.; Moszynska, A.; Serocki, M.; Cabaj, A.; Polten, A.; Ochocka, R.; Dell’Italia, L.; Bartoszewska, S.; Kroliczewski, J.; Dabrowski, M.; et al. Primary endothelial cell-specific regulation of hypoxia-inducible factor (HIF)-1 and HIF-2 and their target gene expression profiles during hypoxia. FASEB J. 2019, 33, 7929–7941. [Google Scholar] [CrossRef] [PubMed]
- Lin, Q.; Cong, X.; Yun, Z. Differential hypoxic regulation of hypoxia-inducible factors 1 alpha and 2 alpha. Mol. Cancer Res. 2011, 9, 757–765. [Google Scholar] [CrossRef] [PubMed]
- Holmquist-Mengelbier, L.; Fredlund, E.; Lofstedt, T.; Noguera, R.; Navarro, S.; Nilsson, H.; Pietras, A.; Vallon-Christersson, J.; Borg, A.; Gradin, K.; et al. Recruitment of HIF-1α and HIF-2α to common target genes is differentially regulated in neuroblastoma: HIF-2α promotes an aggressive phenotype. Cancer Cell 2006, 10, 413–423. [Google Scholar] [CrossRef] [PubMed]
- Boissier, M.C. Cell and cytokine imbalances in rheumatoid synovitis. Jt. Bone Spine 2011, 78, 230–234. [Google Scholar] [CrossRef] [PubMed]
- Brennan, F.M.; McInnes, I.B. Evidence that cytokines play a role in rheumatoid arthritis. J. Clin. Investig. 2008, 118, 3537–3545. [Google Scholar] [CrossRef] [PubMed]
- Zwerina, J.; Hayer, S.; Tohidast-Akrad, M.; Bergmeister, H.; Redlich, K.; Feige, U.; Dunstan, C.; Kollias, G.; Steiner, G.; Smolen, J.; et al. Single and combined inhibition of tumor necrosis factor, interleukin-1, and RANKL pathways in tumor necrosis factor-induced arthritis: Effects on synovial inflammation, bone erosion, and cartilage destruction. Arthritis Rheum. 2004, 50, 277–290. [Google Scholar] [CrossRef]
- Williams, R.O.; Inglis, J.J.; Simelyte, E.; Criado, G.; Sumariwalla, P.F. Analysing the effect of novel therapies on cytokine expression in experimental arthritis. Int. J. Exp. Pathol. 2005, 86, 267–278. [Google Scholar] [CrossRef] [PubMed]
- Fujii, Y.; Inoue, H.; Arai, Y.; Shimomura, S.; Nakagawa, S.; Kishida, T.; Tsuchida, S.; Kamada, Y.; Kaihara, K.; Shirai, T.; et al. Treadmill running in established phase arthritis inhibits joint destruction in rat rheumatoid arthritis models. Int. J. Mol. Sci. 2019, 20, 5100. [Google Scholar] [CrossRef]
- Mitoma, H.; Horiuchi, T.; Tsukamoto, H.; Ueda, N. Molecular mechanisms of action of anti-TNF-α agents—Comparison among therapeutic TNF-α antagonists. Cytokine 2018, 101, 56–63. [Google Scholar] [CrossRef]
- Giatromanolaki, A.; Sivridis, E.; Maltezos, E.; Athanassou, N.; Papazoglou, D.; Gatter, K.C.; Harris, A.L.; Koukourakis, M.I. Upregulated hypoxia inducible factor-1 alpha and -2 alpha pathway in rheumatoid arthritis and osteoarthritis. Arthritis Res. Ther. 2003, 5, 193–201. [Google Scholar] [CrossRef]
- Yamaguchi, R.; Kamiya, N.; Adapala, N.S.; Drissi, H.; Kim, H.K. HIF-1-dependent IL-6 activation in articular chondrocytes initiating synovitis in femoral head ischemic osteonecrosis. J. Bone Jt. Surg. 2016, 98, 1122–1131. [Google Scholar] [CrossRef] [PubMed]
- Xing, J.; Lu, J. HIF-1 alpha activation attenuates IL-6 and TNF-alpha pathways in hippocampus of rats following transient global ischemia. Cell Physiol. Biochem. 2016, 39, 511–520. [Google Scholar] [CrossRef] [PubMed]
- Ng, C.T.; Biniecka, M.; Kennedy, A.; McCormick, J.; Fitzgerald, O.; Bresnihan, B.; Buggy, D.; Taylor, C.T.; O’Sullivan, J.; Fearon, U.; et al. Synovial tissue hypoxia and inflammation in vivo. Ann. Rheum. Dis. 2010, 69, 1389–1395. [Google Scholar] [CrossRef]
- Reiterer, M.; Colaço, R.; Emrouznejad, P.; Jensen, A.; Rundqvist, H.; Johnson, R.S.; Branco, C. Acute and chronic hypoxia differentially predispose lungs for metastases. Sci. Rep. 2019, 9, 10246. [Google Scholar] [CrossRef] [PubMed]
- Shi, M.; Cui, F.; Liu, A.J.; Ma, H.J.; Cheng, M.; Song, S.X.; Yuan, F.; Li, D.P.; Zhang, Y. The protective effects of chronic intermittent hypobaric hypoxia pretreatment against collagen-induced arthritis in rats. J. Inflamm. 2015, 25, 12–23. [Google Scholar]
- Tan, H.Y.; Wang, N.; Li, S.; Hong, M.; Wang, X.; Feng, Y. The reactive oxygen species in macrophage polarization: Reflecting its dual role in progression and treatment of human diseases. Oxid. Med. Cell Longev. 2016, 2016, 2795090. [Google Scholar] [CrossRef] [PubMed]
- Catrina, S.B.; Okamoto, K.; Pereira, T.; Brismar, K.; Poellinger, L. Hyperglycemia regulates hypoxia-inducible Factor-1α Protein Stability and function. Diabetes 2004, 53, 3226–3232. [Google Scholar] [CrossRef] [PubMed]
- Terraneo, L.; Virgili, E.; Caretti, A.; Bianciardi, P.; Samaja, M. In vivo hyperoxia induces hypoxia-inducible factor-1alpha overexpression in LNCaP tumors without affecting the tumor growth rate. Int. J. Biochem. Cell Biol. 2014, 51, 65–74. [Google Scholar] [CrossRef]
- Bakharevski, O.; Stein-Oakley, A.N.; Thomson, N.M.; Ryan, P.F. Collagen induced arthritis in rats. Contrasting effect of subcutaneous versus intradermal inoculation of type II collagen. J. Rheumatol. 1998, 25, 1945–1952. [Google Scholar]
- Jin, H.; Ma, N.; Li, X.; Kang, M.; Guo, M.; Song, L. Application of GC/MS-based metabonomic profiling in studying the therapeutic effects of Aconitum carmichaeli with Ampelopsis japonica extract on collagen-induced arthritis in rats. Molecules 2019, 24, 1934. [Google Scholar] [CrossRef] [PubMed]
- Weinberger, A.; Halpern, M.; Zahalka, M.A.; Quintana, F.; Traub, L.; Moroz, C. Placental immunomodulator ferritin, a novel immunoregulator, suppresses experimental arthritis. Arthritis Rheum. 2003, 48, 846–853. [Google Scholar] [CrossRef] [PubMed]






| Gene | Sequence | |
|---|---|---|
| 18S ribosomal RNA | forward reverse probe | 5′-ATGAGTCCACTTTAAATCCTTTAACGA-3′ 5′-CTTTAATATACGCTATTGGAGCTGGAA-3′ 5′-(FAM) ATCCATTGGAGGGCAAGTCTGGTGC (BHQ)-3′ |
| EGLN1 | forward reverse | 5′-CGACCTGATACGCCACTGT-3′ 5′-GTTCCATTGCCCGGATAAC-3′ |
| HIF1A | forward reverse | 5′-TTTTCAAGCAGTAGGAATTGGAA-3′ 5′-GTGATGTAGTAGCTGCATGATCG-3′ |
| VEGF | forward reverse | 5′-GCAGCTTGAGTTAAACGAACG-3′ 5′-GGTTCCCGAAACCCTGAG-3′ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kaihara, K.; Nakagawa, S.; Arai, Y.; Inoue, H.; Tsuchida, S.; Fujii, Y.; Kamada, Y.; Kishida, T.; Mazda, O.; Takahashi, K. Sustained Hypoxia Suppresses Joint Destruction in a Rat Model of Rheumatoid Arthritis via Negative Feedback of Hypoxia Inducible Factor-1α. Int. J. Mol. Sci. 2021, 22, 3898. https://doi.org/10.3390/ijms22083898
Kaihara K, Nakagawa S, Arai Y, Inoue H, Tsuchida S, Fujii Y, Kamada Y, Kishida T, Mazda O, Takahashi K. Sustained Hypoxia Suppresses Joint Destruction in a Rat Model of Rheumatoid Arthritis via Negative Feedback of Hypoxia Inducible Factor-1α. International Journal of Molecular Sciences. 2021; 22(8):3898. https://doi.org/10.3390/ijms22083898
Chicago/Turabian StyleKaihara, Kenta, Shuji Nakagawa, Yuji Arai, Hiroaki Inoue, Shinji Tsuchida, Yuta Fujii, Yoichiro Kamada, Tsunao Kishida, Osam Mazda, and Kenji Takahashi. 2021. "Sustained Hypoxia Suppresses Joint Destruction in a Rat Model of Rheumatoid Arthritis via Negative Feedback of Hypoxia Inducible Factor-1α" International Journal of Molecular Sciences 22, no. 8: 3898. https://doi.org/10.3390/ijms22083898
APA StyleKaihara, K., Nakagawa, S., Arai, Y., Inoue, H., Tsuchida, S., Fujii, Y., Kamada, Y., Kishida, T., Mazda, O., & Takahashi, K. (2021). Sustained Hypoxia Suppresses Joint Destruction in a Rat Model of Rheumatoid Arthritis via Negative Feedback of Hypoxia Inducible Factor-1α. International Journal of Molecular Sciences, 22(8), 3898. https://doi.org/10.3390/ijms22083898
