Quercetin Attenuates Brain Oxidative Alterations Induced by Iron Oxide Nanoparticles in Rats
Abstract
1. Introduction
2. Results
2.1. Size and Charge of IONPs
2.2. Brain Oxidative Stress and Anti-Oxidant Status
2.3. Brain Creatine Phosphokinase (CPK) and Acetylcholinesterase (AChE) Activities
2.4. Brain Epinephrine, Serotonin and Melatonin Hormones
2.5. Brain PGC-1α and mtTFA mRNA Expression
2.6. Hematoxylin (H) and Eosin (E) Staining Assessment of Brain Sections
2.7. Prussian Blue Staining Assessment of Brain Sections
2.8. Caspase 3 and Bcl2 Protein Levels in Brain Sections
3. Discussion
4. Materials and Methods
4.1. Reagents and Chemicals
4.2. Ethics Statement
4.3. Characterization of IONPs
4.4. Animals, Housing and Experimental Design
4.5. Sampling
4.6. Biochemical Analyses
4.7. mRNA Extraction and RT-PCR
4.8. Histopathological Examination
4.9. Immunohistochemical Examination
4.10. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Mazdeh, M.; Rahiminejad, M.E.; Nili-Ahmadabadi, A.; Ranjbar, A. Neurological Disorders and Oxidative Toxic Stress: A Role of Metal Nanoparticles. Jundishapur J. Nat. Pharm. Prod. 2016, 11, e27628. [Google Scholar] [CrossRef]
- Fidler, M.C.; Walczyk, T.; Davidsson, L.; Zeder, C.; Sakaguchi, N.; Juneja, L.R.; Hurrell, R.F. A micronised, dispersible ferric pyrophosphate with high relative bioavailability in man. Br. J. Nutr. 2004, 91, 107–112. [Google Scholar] [CrossRef]
- Ramimoghadam, D.; Bagheri, S.; Hamid, S.B.A. Progress in electrochemical synthesis of magnetic iron oxide nanoparticles. J. Magn. Magn. Mater. 2014, 368, 207–229. [Google Scholar] [CrossRef]
- Gaharwar, U.S.; Kumar, S.; Rajamani, P. Iron oxide nanoparticle-induced hematopoietic and immunological response in rats. RSC Adv. 2020, 10, 35753–35764. [Google Scholar] [CrossRef]
- Gaharwar, U.S.; Paulraj, R. Iron Oxide Nanoparticles Induced Oxidative Damage in Peripheral Blood Cells of Rat. J. Biomed. Sci. Eng. 2015, 8, 274–286. [Google Scholar] [CrossRef]
- Feng, Q.; Liu, Y.; Huang, J.; Chen, K.; Huang, J.; Xiao, K. Uptake, distribution, clearance, and toxicity of iron oxide nanoparticles with different sizes and coatings. Sci. Rep. 2018, 8, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Gaharwar, U.S.; Meena, R.; Rajamani, P. Biodistribution, clearance and morphological alterations of intravenously administered iron oxide nanoparticles in male wistar rats. Int. J. Nanomed. 2019, 14, 9677–9692. [Google Scholar] [CrossRef] [PubMed]
- Palmieri, B.; Sblendorio, V. Oxidative stress tests: Overview on reliability and use, Part II. Eur. Rev. Med. Pharmacol. Sci. 2007, 11, 383–399. [Google Scholar]
- Naqvi, S.; Samim, M.; Abdin, M.Z.; Ahmed, F.J.; Maitra, A.N.; Prashant, C.K.; Dinda, A.K. Concentration-dependent toxicity of iron oxide nanoparticles mediated by increased oxidative stress. Int. J. Nanomed. 2010, 5, 983–989. [Google Scholar] [CrossRef]
- David, A.V.A.; Arulmoli, R.; Parasuraman, S. Overviews of biological importance of quercetin: A bioactive flavonoid. Pharmacogn. Rev. 2016, 10, 84–89. [Google Scholar]
- Wu, W.; Li, R.; Li, X.; He, J.; Jiang, S.; Liu, S.; Yang, J. Quercetin as an Antiviral Agent Inhibits Influenza A Virus (IAV) Entry. Viruses 2015, 8, 6. [Google Scholar] [CrossRef]
- Akdemir, F.N.E.; Gülçin, İ.; Karagöz, B.; Soslu, R. Quercetin protects rat skeletal muscle from ischemia reperfusion injury. J. Enzym. Inhib. Med. Chem. 2016, 31, 162–166. [Google Scholar] [CrossRef] [PubMed]
- Barcelos, G.R.M.; Angeli, J.P.F.; Serpeloni, J.M.; Grotto, D.; Rocha, B.A.; Bastos, J.K.; Knasmüller, S.; Júnior, F.B. Quercetin protects human-derived liver cells against mercury-induced DNA-damage and alterations of the redox status. Mutat. Res. Genet. Toxicol. Environ. Mutagen. 2011, 726, 109–115. [Google Scholar] [CrossRef]
- Salem, I.B.; Boussabbeh, M.; Graiet, I.; Rhouma, A.; Bacha, H.; Essefi, S.A. Quercetin protects HCT116 cells from Dichlorvos-induced oxidative stress and apoptosis. Cell Stress Chaperones 2016, 21, 179–186. [Google Scholar] [CrossRef]
- Xu, X.R.; Yu, H.T.; Yang, Y.; Hang, L.; Yang, X.W.; Ding, S.H. Quercetin phospholipid complex significantly protects against oxidative injury in ARPE-19 cells associated with activation of Nrf2 pathway. Eur. J. Pharmacol. 2016, 770, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Periasamy, R.; Kalal, I.G.; Krishnaswamy, R.; Viswanadha, V. Quercetin protects human peripheral blood mononuclear cells from OTA-induced oxidative stress, genotoxicity, and inflammation. Environ. Toxicol. 2016, 31, 855–865. [Google Scholar] [CrossRef] [PubMed]
- El-Far, A.H.; Lebda, M.A.; Noreldin, A.E.; Atta, M.S.; Elewa, Y.H.A.; Elfeky, M.; Mousa, S.A. Quercetin Attenuates Pancreatic and Renal D-Galactose-Induced Aging-Related Oxidative Alterations in Rats. Int. J. Mol. Sci. 2020, 21, 4348. [Google Scholar] [CrossRef]
- Ferri, P.; Angelino, D.; Gennari, L.; Benedetti, S.; Ambrogini, P.; Del Grande, P.; Ninfali, P. Enhancement of flavonoid ability to cross the blood-brain barrier of rats by co-administration with α-tocopherol. Food Funct. 2015, 6, 394–400. [Google Scholar] [CrossRef] [PubMed]
- Lesjak, M.; Srai, S.K.S. Role of dietary flavonoids in iron homeostasis. Pharmaceuticals 2019, 12, 119. [Google Scholar] [CrossRef] [PubMed]
- Bagad, M.; Khan, Z.A. Poly(n-butylcyanoacrylate) nanoparticles for oral delivery of quercetin: Preparation, characterization, and pharmacokinetics and biodistribution studies in Wistar rats. Int. J. Nanomed. 2015, 10, 3921–3935. [Google Scholar] [CrossRef]
- Luo, S.; Ma, C.; Zhu, M.Q.; Ju, W.N.; Yang, Y.; Wang, X. Application of Iron Oxide Nanoparticles in the Diagnosis and Treatment of Neurodegenerative Diseases with Emphasis on Alzheimer’s Disease. Front. Cell. Neurosci. 2020, 14, 21. [Google Scholar] [CrossRef]
- Dhakshinamoorthy, V.; Manickam, V.; Perumal, E. Neurobehavioural Toxicity of Iron Oxide Nanoparticles in Mice. Neurotox. Res. 2017, 32, 187–203. [Google Scholar] [CrossRef]
- El-Sayed, E.H.K.; Mohammed, Z.A.; Ahmed, M.M. Ameliorative role of quercetin in iron overload induced heart and brain toxicity in adult male albino rats. J. Toxicol. Environ. Health Sci. Full Length Res. Pap. 2019, 11, 16–26. [Google Scholar] [CrossRef]
- Laurent, S.; Burtea, C.; Thirifays, C.; Häfeli, U.O.; Mahmoudi, M. Crucial Ignored Parameters on Nanotoxicology: The Importance of Toxicity Assay Modifications and “Cell Vision”. PLoS ONE 2012, 7, e29997. [Google Scholar] [CrossRef] [PubMed]
- Mahmoudi, M.; Laurent, S.; Shokrgozar, M.A.; Hosseinkhani, M. Toxicity evaluations of superparamagnetic iron oxide nanoparticles: Cell “vision” versus physicochemical properties of nanoparticles. ACS Nano 2011, 5, 7263–7276. [Google Scholar] [CrossRef] [PubMed]
- Reddy, U.A.; Prabhakar, P.V.; Mahboob, M. Biomarkers of oxidative stress for in vivo assessment of toxicological effects of iron oxide nanoparticles. Saudi J. Biol. Sci. 2017, 24, 1172–1180. [Google Scholar] [CrossRef] [PubMed]
- Wu, H.; Yin, J.J.; Wamer, W.G.; Zeng, M.; Lo, Y.M. Reactive oxygen species-related activities of nano-iron metal and nano-iron oxides. J. Food Drug Anal. 2014, 22, 86–94. [Google Scholar] [CrossRef]
- Sharma, P.; Jha, A.B.; Dubey, R.S.; Pessarakli, M. Reactive Oxygen Species, Oxidative Damage, and Antioxidative Defense Mechanism in Plants under Stressful Conditions. J. Bot. 2012, 2012, 1–26. [Google Scholar] [CrossRef]
- Shen, Y.; Gong, S.; Li, J.; Wang, Y.; Zhang, X.; Zheng, H.; Zhang, Q.; You, J.; Huang, Z.; Chen, Y. Co-loading antioxidant N-acetylcysteine attenuates cytotoxicity of iron oxide nanoparticles in hypoxia/ reoxygenation cardiomyocytes. Int. J. Nanomed. 2019, 14, 6103–6115. [Google Scholar] [CrossRef]
- Awaad, A.; Adly, M.A.; Hosny, D. Insulin-like 3 expression and fibrosis induction after intra-testicular injection of magnetic nanoparticles in rat testis and the ameliorative role of Echinacea purpurea extract. Biotech. Histochem. 2018, 93, 118–132. [Google Scholar] [CrossRef]
- Negut, I.; Grumezescu, V.; Grumezescu, A.M.; Bîrcă, A.C.; Holban, A.M.; Urzica, I.; Avramescu, S.M.; Gălățeanu, B.; Hudiță, A. Nanostructured Thin Coatings Containing Anthriscus sylvestris Extract with Dual Bioactivity. Molecules 2020, 25, 3866. [Google Scholar] [CrossRef]
- Dong, Y.S.; Wang, J.L.; Feng, D.Y.; Qin, H.Z.; Wen, H.; Yin, Z.M.; Gao, G.D.; Li, C. Protective effect of quercetin against oxidative stress and brain edema in an experimental rat model of subarachnoid hemorrhage. Int. J. Med. Sci. 2014, 11, 282–290. [Google Scholar] [CrossRef] [PubMed]
- Uzun, F.G.; Kalender, Y. Chlorpyrifos induced hepatotoxic and hematologic changes in rats: The role of quercetin and catechin. Food Chem. Toxicol. 2013, 55, 549–556. [Google Scholar] [CrossRef]
- Siems, W.; Crifo, C.; Capuozzo, E.; Uchida, K.; Grune, T.; Salerno, C. Metabolism of 4-hydroxy-2-nonenal in human polymorphonuclear leukocytes. Arch. Biochem. Biophys. 2010, 503, 248–252. [Google Scholar] [CrossRef]
- Singh, S.; Jamwal, S.; Kumar, P. Neuroprotective potential of Quercetin in combination with piperine against 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine-induced neurotoxicity. Neural Regen. Res. 2017, 12, 1137–1144. [Google Scholar] [CrossRef] [PubMed]
- Andres, R.H.; Ducray, A.D.; Schlattner, U.; Wallimann, T.; Widmer, H.R. Functions and effects of creatine in the central nervous system. Brain Res. Bull. 2008, 76, 329–343. [Google Scholar] [CrossRef] [PubMed]
- Venkataraman, P.; Krishnamoorthy, G.; Selvakumar, K.; Arunakaran, J. Oxidative stress alters creatine kinase system in serum and brain regions of polychlorinated biphenyl (Aroclor 1254)-exposed rats: Protective role of melatonin. Basic Clin. Pharmacol. Toxicol. 2009, 105, 92–97. [Google Scholar] [CrossRef] [PubMed]
- Lemmens, K.; Vrolijk, M.; Bouwman, F.; van der Vijgh, W.; Bast, A.; Haenen, G. The Minor Structural Difference between the Antioxidants Quercetin and 4′O-Methylquercetin Has a Major Impact on Their Selective Thiol Toxicity. Int. J. Mol. Sci. 2014, 15, 7475–7484. [Google Scholar] [CrossRef] [PubMed]
- Kumari, M.; Rajak, S.; Singh, S.P.; Kumari, S.I.; Kumar, P.U.; Murty, U.S.N.; Mahboob, M.; Grover, P.; Rahman, M.F. Repeated oral dose toxicity of iron oxide nanoparticles: Biochemical and histopathological alterations in different tissues of rats. J. Nanosci. Nanotechnol. 2012, 12, 2149–2159. [Google Scholar] [CrossRef] [PubMed]
- Rizo, J. Mechanism of neurotransmitter release coming into focus. Protein Sci. 2018, 27, 1364–1391. [Google Scholar] [CrossRef]
- Yousef, M.I.; Abuzreda, A.A.; Kamel, M.A.E.-N. Neurotoxicity and inflammation induced by individual and combined exposure to iron oxide nanoparticles and silver nanoparticles. J. Taibah Univ. Sci. 2019, 13, 570–578. [Google Scholar] [CrossRef]
- Zhao, Q.; Tian, Z.; Zhou, G.; Niu, Q.; Chen, J.; Li, P.; Dong, L.; Xia, T.; Zhang, S.; Wang, A. SIRT1-dependent mitochondrial biogenesis supports therapeutic effects of resveratrol against neurodevelopment damage by fluoride. Theranostics 2020, 10, 4822–4838. [Google Scholar] [CrossRef]
- Puigserver, P.; Wu, Z.; Park, C.W.; Graves, R.; Wright, M.; Spiegelman, B.M. A cold-inducible coactivator of nuclear receptors linked to adaptive thermogenesis. Cell 1998, 92, 829–839. [Google Scholar] [CrossRef]
- Yousef, M.; Abuzreda, A.; Kamel, M. Cardiotoxicity and lung toxicity in male rats induced by long-term exposure to iron oxide and silver nanoparticles. Exp. Ther. Med. 2019, 18, 4329–4339. [Google Scholar] [CrossRef]
- Sharma, D.R.; Sunkaria, A.; Wani, W.Y.; Sharma, R.K.; Verma, D.; Priyanka, K.; Bal, A.; Gill, K.D. Quercetin protects against aluminium induced oxidative stress and promotes mitochondrial biogenesis via activation of the PGC-1α signaling pathway. Neurotoxicology 2015, 51, 116–137. [Google Scholar] [CrossRef]
- Park, D.J.; Jeon, S.J.; Kang, J.B.; Koh, P.O. Quercetin Reduces Ischemic Brain Injury by Preventing Ischemia-induced Decreases in the Neuronal Calcium Sensor Protein Hippocalcin. Neuroscience 2020, 430, 47–62. [Google Scholar] [CrossRef] [PubMed]
- Pei, B.; Yang, M.; Qi, X.; Shen, X.; Chen, X.; Zhang, F. Quercetin ameliorates ischemia/reperfusion-induced cognitive deficits by inhibiting ASK1/JNK3/caspase-3 by enhancing the Akt signaling pathway. Biochem. Biophys. Res. Commun. 2016, 478, 199–205. [Google Scholar] [CrossRef] [PubMed]
- Khan, A.; Ali, T.; Rehman, S.U.; Khan, M.S.; Alam, S.I.; Ikram, M.; Muhammad, T.; Saeed, K.; Badshah, H.; Kim, M.O. Neuroprotective effect of quercetin against the detrimental effects of LPS in the adult mouse brain. Front. Pharmacol. 2018, 9, 1–16. [Google Scholar] [CrossRef] [PubMed]
- Sundarraj, K.; Manickam, V.; Raghunath, A.; Periyasamy, M.; Viswanathan, M.P.; Perumal, E. Repeated exposure to iron oxide nanoparticles causes testicular toxicity in mice. Environ. Toxicol. 2017, 32, 594–608. [Google Scholar] [CrossRef] [PubMed]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]
- Bancroft, J.D.; Layton, C. The hematoxylin and eosin. In Theory Practice of Histological Techniques, 7th ed.; Suvarna, S.K., Layton, C., Bancroft, J.D., Eds.; Churchill Livingstone of Elsevier: Philadelphia, PA, USA, 2013. [Google Scholar]
- Glat, M.; Skaat, H.; Menkes-Caspi, N.; Margel, S.; Stern, E.A. Age-dependent effects of microglial inhibition in vivo on Alzheimer’s disease neuropathology using bioactive-conjugated iron oxide nanoparticles. J. Nanobiotechnol. 2013, 11, 32. [Google Scholar] [CrossRef] [PubMed]
g/kg Diet | Ingredients |
---|---|
529.5 | Corn flour |
200 | Casein |
100 | Sucrose |
70 | Soybean oil |
50 | Cellulose |
35 | Mineral mix |
10 | Vitamin mix |
3 | l-cystine |
2.5 | Choline |
Gene | Primer Sequence (5′→3′) | |
---|---|---|
PGC-1α | F: | AAACTTGCTAGCGGTCCTCA |
R: | TGGCTGGTGCCAGTAAGAG | |
mTFA | F: | CCCTGGAAGCTTTCAGATACG |
R: | AATTGCAGCCATGTGGAGG | |
GAPDH | F: | GGGTGTGAACCACGAGAAATA |
R: | AGTTGTCATGGATGACCTTGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dora, M.F.; Taha, N.M.; Lebda, M.A.; Hashem, A.E.; Elfeky, M.S.; El-Sayed, Y.S.; Jaouni, S.A.; El-Far, A.H. Quercetin Attenuates Brain Oxidative Alterations Induced by Iron Oxide Nanoparticles in Rats. Int. J. Mol. Sci. 2021, 22, 3829. https://doi.org/10.3390/ijms22083829
Dora MF, Taha NM, Lebda MA, Hashem AE, Elfeky MS, El-Sayed YS, Jaouni SA, El-Far AH. Quercetin Attenuates Brain Oxidative Alterations Induced by Iron Oxide Nanoparticles in Rats. International Journal of Molecular Sciences. 2021; 22(8):3829. https://doi.org/10.3390/ijms22083829
Chicago/Turabian StyleDora, Mohamed F., Nabil M. Taha, Mohamed A. Lebda, Aml E. Hashem, Mohamed S. Elfeky, Yasser S. El-Sayed, Soad Al Jaouni, and Ali H. El-Far. 2021. "Quercetin Attenuates Brain Oxidative Alterations Induced by Iron Oxide Nanoparticles in Rats" International Journal of Molecular Sciences 22, no. 8: 3829. https://doi.org/10.3390/ijms22083829
APA StyleDora, M. F., Taha, N. M., Lebda, M. A., Hashem, A. E., Elfeky, M. S., El-Sayed, Y. S., Jaouni, S. A., & El-Far, A. H. (2021). Quercetin Attenuates Brain Oxidative Alterations Induced by Iron Oxide Nanoparticles in Rats. International Journal of Molecular Sciences, 22(8), 3829. https://doi.org/10.3390/ijms22083829