Identification of the Genetic Basis of Response to de-Acclimation in Winter Barley
Abstract
1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Plant Material and Growth Conditions
4.2. RNA Isolation
4.3. RNA Sequencing and Differential Expression Analysis
4.4. Gene Expression Analysis
4.5. Analysis of Oxidoreductase Activity
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
RNAseq | RNA sequencing |
RT-qPCR | Quantitative (real-time) PCR performed on cDNA samples |
CA | Cold acclimation |
DA | Cold de-acclimation |
RA | Re-acclimation to cold |
FDR | False discovery rate |
DEG | Differentially expressed gene |
GO | Gene ontology |
BLAST | Basic Local Alignment Search Tool |
sHSP | Small Heat Shock Protein |
PGU | PolyGalactoUronase |
LEA | Late Embryogenesis Abundant |
References
- Rapacz, M.; Ergon, Å.; Höglind, M.; Jørgensen, M.; Jurczyk, B.; Østrem, L.; Rognli, O.A.; Tronsmo, A.M. Overwintering of herbaceous plants in a changing climate. Still more questions than answers. Plant Sci. 2014, 225, 34–44. [Google Scholar] [CrossRef] [PubMed]
- Galiba, G.; Vágújfalvi, A.; Li, C.; Soltész, A.; Dubcovsky, J. Regulatory genes involved in the determination of frost tolerance in temperate cereals. Plant Sci. 2009, 176, 12–19. [Google Scholar] [CrossRef]
- Thomashow, M.F. Role of Cold-Responsive Genes in Plant Freezing Tolerance. Plant Physiol. 1998, 118, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Kalberer, S.R.; Wisniewski, M.; Arora, R. Deacclimation and reacclimation of cold-hardy plants: Current understanding and emerging concepts. Plant Sci. 2006, 171, 3–16. [Google Scholar] [CrossRef]
- Pagter, M.; Arora, R. Winter survival and deacclimation of perennials under warming climate: Physiological perspectives. Physiol. Plant. 2013, 147, 75–87. [Google Scholar] [CrossRef]
- Rapacz, M. Regulation of frost resistance during cold de-acclimation and re-acclimation in oilseed rape. A possible role of PSII redox state. Physiol. Plant. 2002, 115, 236–243. [Google Scholar] [CrossRef]
- Gu, L.; Hanson, P.J.; Post, W.M.; Kaiser, D.P.; Yang, B.; Nemani, R.; Pallardy, S.G.; Meyers, T. The 2007 Eastern US Spring Freeze: Increased Cold Damage in a Warming World? Bioscience 2008, 58, 253–262. [Google Scholar] [CrossRef]
- Hömmö, L.M. Hardening of Some Winter Wheat (Triticum aestivum L.), Rye (Secale cereals L.), Triticale (× Triticosecale Wittmack) and Winter Barley (Hordeum vulgare L.) Cultivars During Autumn and the Final Winter Survival in Finland. Plant Breed. 1994, 112, 285–293. [Google Scholar] [CrossRef]
- Rizza, F.; Crosatti, C.; Stanca, A.M.; Cattivelli, L. Studies for assessing the influence of hardening on cold tolerance of barley genotypes. Euphytica 1994, 75, 131–138. [Google Scholar] [CrossRef]
- Tyrka, M.; Rapacz, M.; Fiust, A.; Wójcik-Jaglła, M. Quantitative trait loci mapping of freezing tolerance and photosynthetic acclimation to cold in winter two- and six-rowed barley. Plant Breed. 2015, 134, 271–282. [Google Scholar] [CrossRef]
- Fiust, A.; Rapacz, M. Downregulation of three novel candidate genes is important for freezing tolerance of field and laboratory cold acclimated barley. J. Plant Physiol. 2020, 244, 153049. [Google Scholar] [CrossRef] [PubMed]
- Jeknić, Z.; Pillman, K.A.; Dhillon, T.; Skinner, J.S.; Veisz, O.; Cuesta-Marcos, A.; Hayes, P.M.; Jacobs, A.K.; Chen, T.H.H.; Stockinger, E.J. Hv-CBF2A overexpression in barley accelerates COR gene transcript accumulation and acquisition of freezing tolerance during cold acclimation. Plant Mol. Biol. 2014, 84, 67–82. [Google Scholar] [CrossRef] [PubMed]
- Zhu, B.; Choi, D.W.; Fenton, R.; Close, T.J. Expression of the barley dehydrin multigene family and the development of freezing tolerance. Mol. Gen. Genet. Mgg 2000, 264, 145–153. [Google Scholar] [CrossRef] [PubMed]
- Giorni, E.; Crosatti, C.; Baldi, P.; Grossi, M.; Marè, C.; Stanca, A.M.; Cattivelli, L. Cold-regulated gene expression during winter in frost tolerant and frost susceptible barley cultivars grown under field conditions. Euphytica 1999, 106, 149–157. [Google Scholar] [CrossRef]
- Rapacz, M.; Wolanin, B.; Hura, K.; Tyrka, M. The effects of cold acclimation on photosynthetic apparatus and the expression of COR14b in four genotypes of barley (Hordeum vulgare) contrasting in their tolerance to freezing and high-light treatment in cold conditions. Ann. Bot. 2008, 101, 689–699. [Google Scholar] [CrossRef]
- Soltész, A.; Smedley, M.; Vashegyi, I.; Galiba, G.; Harwood, W.; Vágújfalvi, A. Transgenic barley lines prove the involvement of TaCBF14 and TaCBF15 in the cold acclimation process and in frost tolerance. J. Exp. Bot. 2013, 64, 1849–1862. [Google Scholar] [CrossRef]
- Horvath, D.P.; Zhang, J.; Chao, W.S.; Mandal, A.; Rahman, M. Genome-Wide Association Studies and Transcriptome Changes during Acclimation and Deacclimation in Divergent Brassica napus Varieties. Int. J. Mol. Sci. 2020, 21, 9148. [Google Scholar] [CrossRef]
- Miki, Y.; Takahashi, D.; Kawamura, Y.; Uemura, M. Temporal proteomics of Arabidopsis plasma membrane during cold- and de-acclimation. J. Proteom. 2019, 197, 71–81. [Google Scholar] [CrossRef]
- Nakaminami, K.; Matsui, A.; Nakagami, H.; Minami, A.; Nomura, Y.; Tanaka, M.; Morosawa, T.; Ishida, J.; Takahashi, S.; Uemura, M.; et al. Analysis of Differential Expression Patterns of mRNA and Protein During Cold-acclimation and De-acclimation in Arabidopsis. Mol. Cell Proteom. 2014, 13, 3602–3611. [Google Scholar] [CrossRef]
- Firtzlaff, V.; Oberländer, J.; Geiselhardt, S.; Hilker, M.; Kunze, R. Pre-exposure of Arabidopsis to the abiotic or biotic environmental stimuli “chilling” or “insect eggs” exhibits different transcriptomic responses to herbivory. Sci. Rep. 2016, 6, 1–13. [Google Scholar] [CrossRef]
- Juszczak, I.; Cvetkovic, J.; Zuther, E.; Hincha, D.K.; Baier, M. Natural variation of cold deacclimation correlates with variation of cold-acclimation of the plastid antioxidant system in Arabidopsis thaliana accessions. Front. Plant Sci. 2016, 7, 1–17. [Google Scholar] [CrossRef] [PubMed]
- Oono, Y.; Seki, M.; Satou, M.; Iida, K.; Akiyama, K.; Sakurai, T.; Fujita, M.; Yamaguchi-Shinozaki, K.; Shinozaki, K. Monitoring expression profiles of Arabidopsis genes during cold acclimation and deacclimation using DNA microarrays. Funct. Integr. Genom. 2006, 6, 212–234. [Google Scholar] [CrossRef] [PubMed]
- Pagter, M.; Alpers, J.; Erban, A.; Kopka, J.; Zuther, E.; Hincha, D.K. Rapid transcriptional and metabolic regulation of the deacclimation process in cold acclimated Arabidopsis thaliana. BMC Genom. 2017, 18, 1–17. [Google Scholar] [CrossRef] [PubMed]
- Zuther, E.; Juszczak, I.; Ping Lee, Y.; Baier, M.; Hincha, D.K. Time-dependent deacclimation after cold acclimation in Arabidopsis thaliana accessions. Sci. Rep. 2015, 5, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Borovik, O.A.; Pomortsev, A.V.; Korsukova, A.V.; Polyakova, E.A.; Fomina, E.A.; Zabanova, N.S.; Grabelnych, O.I. Effect of Cold Acclimation and Deacclimation on the Content of Soluble Carbohydrates and Dehydrins in the Leaves of Winter Wheat. J. Stress Physiol. Biochem. 2019, 15, 62–67. [Google Scholar]
- Rapacz, M.; Jurczyk, B.; Sasal, M. Deacclimation may be crucial for winter survival of cereals under warming climate. Plant Sci. 2017, 256, 5–15. [Google Scholar] [CrossRef]
- Rys, M.; Pociecha, E.; Oliwa, J.; Ostrowska, A.; Jurczyk, B.; Saja, D.; Janeczko, A. Deacclimation of winter oilseed rape-insight into physiological changes. Agronomy 2020, 10. [Google Scholar] [CrossRef]
- Chen, F.; He, J.; Jin, G.; Chen, Z.H.; Dai, F. Identification of novel microRNAs for cold deacclimation in barley. Plant Growth Regul. 2020, 92, 389–400. [Google Scholar] [CrossRef]
- Espevig, T.; Höglind, M.; Aamlid, T.S. Dehardening resistance of six turfgrasses used on golf greens. Env. Exp. Bot. 2014, 106, 182–188. [Google Scholar] [CrossRef]
- Hoffman, L.; DaCosta, M.; Scott Ebdon, J. Examination of cold deacclimation sensitivity of annual bluegrass and creeping bentgrass. Crop Sci. 2014, 54, 413–420. [Google Scholar] [CrossRef]
- Hoffman, L.; DaCosta, M.; Bertrand, A.; Castonguay, Y.; Ebdon, J.S. Comparative assessment of metabolic responses to cold acclimation and deacclimation in annual bluegrass and creeping bentgrass. Env. Exp. Bot. 2014, 106, 197–206. [Google Scholar] [CrossRef]
- Jørgensen, M.; Østrem, L.; Höglind, M. De-hardening in contrasting cultivars of timothy and perennial ryegrass during winter and spring. Grass Forage Sci. 2010, 65, 38–48. [Google Scholar] [CrossRef]
- Li, X.; Cai, J.; Liu, F.; Zhou, Q.; Dai, T.; Cao, W.; Jiang, D. Wheat plants exposed to winter warming are more susceptible to low temperature stress in the spring. Plant Growth Regul. 2015, 77, 11–19. [Google Scholar] [CrossRef]
- Rapacz, M.; Plazek, A.; Niemczyk, E. Frost de-acclimation of barley (Hordeum vulgare L.) and meadow fescue (Festuca pratensis Huds.). Relationship between soluble carbohydrate content and resistance to frost and the fungal pathogen Bipolaris sorokiniana (Sacc.) Shoem. Ann. Bot. 2000, 86, 539–545. [Google Scholar] [CrossRef]
- Rapacz, M. Cold-deacclimation of oilseed rape (Brassica napus var. oleifera) in response to fluctuating temperatures and photoperiod. Ann. Bot. 2002, 89, 543–549. [Google Scholar] [CrossRef]
- Nagano, A.J.; Kawagoe, T.; Sugisaka, J.; Honjo, M.N.; Iwayama, K.; Kudoh, H. Annual transcriptome dynamics in natural environments reveals plant seasonal adaptation. Nat. Plants 2019, 5, 74–83. [Google Scholar] [CrossRef]
- Chinnusamy, V.; Zhu, J.K. Epigenetic regulation of stress responses in plants. Curr. Opin. Plant Biol. 2009, 12, 133–139. [Google Scholar] [CrossRef]
- Millar, A.H.; Heazlewood, J.L.; Giglione, C.; Holdsworth, M.J.; Bachmair, A.; Schulze, W.X. The Scope, Functions, and Dynamics of Posttranslational Protein Modifications. Annu. Rev. Plant Biol. 2019, 70, 119–151. [Google Scholar] [CrossRef]
- Wang, Q.L.; Chen, J.H.; He, N.Y.; Guo, F.Q. Metabolic reprogramming in chloroplasts under heat stress in plants. Int. J. Mol. Sci. 2018, 19, 849. [Google Scholar] [CrossRef]
- Skinner, J.S.; Von Zitzewitz, J.; Szűcs, P.; Marquez-Cedillo, L.; Filichkin, T.; Amundsen, K.; Stockinger, E.J.; Thomashow, M.F.; Chen, T.H.H.; Hayes, P.M. Structural, functional, and phylogenetic characterization of a large CBF gene family in barley. Plant Mol. Biol. 2005, 59, 533–551. [Google Scholar] [CrossRef]
- Oliveros, J.C. Venny. An Interactive Tool for Comparing Lists with Venn Diagrams. 2007. Available online: https://bioinfogp.cnb.csic.es/tools/venny_old/venny.php (accessed on 2 April 2019).
- Wójcik-Jagła, M.; Rapacz, M.; Dubas, E.; Krzewska, M.; Kopeć, P.; Nowicka, A.; Ostrowska, A.; Malaga, S.; Żur, I. Candidate genes for freezing and drought tolerance selected on the basis of proteome analysis in doubled haploid lines of barley. Int. J. Mol. Sci. 2020, 21, 2062. [Google Scholar] [CrossRef] [PubMed]
- Braham Bioinformatics. FastQC. Available online: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ (accessed on 3 December 2018).
- Mascher, M.; Gundlach, H.; Himmelbach, A.; Beier, S.; Twardziok, S.O.; Wicker, T.; Radchuk, V.; Dockter, C.; Hedley, P.E.; Russell, J. A chromosome conformation capture ordered sequence of the barley genome. Nature 2017, 544, 427–433. [Google Scholar] [CrossRef] [PubMed]
- Bray, N.L.; Pimentel, H.; Melsted, P.; Pachter, L. Near-optimal probabilistic RNA-seq quantification. Nat. Biotechnol. 2016, 34, 525–527. [Google Scholar] [CrossRef] [PubMed]
- Love, M.; Anders, S.; Huber, W. Differential analysis of count data–the DESeq2 package. Genome Biol 2014, 15, 10–1186. [Google Scholar]
- AgriGo. Volume 2. Available online: http://systemsbiology.cau.edu.cn/agriGOv2/specises_analysis.php?&SpeciseID=23&latin=Hordeum_vulgare (accessed on 5 January 2019).
- UniProt. Available online: https://www.uniprot.org/uniprot/ (accessed on 10 March 2019).
- Basic Local Alignment Search Tool. Available online: https://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 5 April 2019).
- Primer3Plus. Available online: https://primer3plus.com/cgi-bin/dev/primer3plus.cgi (accessed on 20 October 2019).
- Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3--new capabilities and interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef]
- EnsemblPlants. Available online: https://plants.ensembl.org/index.html (accessed on 5 September 2019).
- Howe, K.L.; Contreras-Moreira, B.; De Silva, N.; Maslen, G.; Akanni, W.; Allen, J.; Alvarez-Jarreta, J.; Barba, M.; Bolser, D.M.; Cambell, L.; et al. Ensembl Genomes 2020—enabling non-vertebrate genomic research. Nucleic Acids Res. 2020, 48, D689–D695. [Google Scholar] [CrossRef]
- EMBL-EBI. Lalign. Available online: https://www.ebi.ac.uk/Tools/psa/lalign/ (accessed on 2 September 2019).
- EMBL-EBI. Clustal Omega. Available online: https://www.ebi.ac.uk/Tools/msa/clustalo/ (accessed on 5 September 2019).
- EMBL-EBI. Kalign. Available online: https://www.ebi.ac.uk/Tools/msa/kalign/ (accessed on 5 September 2019).
- Bustin, S.A. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J. Mol. Endocrinol. 2000, 25, 169–193. [Google Scholar] [CrossRef]
- Holland, P.M.; Abramson, R.D.; Watson, R.; Gelfand, D.H. Detection of specific polymerase chain reaction product by utilizing the 5’—3’exonuclease activity of Thermus aquaticus DNA polymerase. Proc. Natl. Acad. Sci. USA 1991, 88, 7276–7280. [Google Scholar] [CrossRef]
- Kutyavin, I.V.; Afonina, I.A.; Mills, A.; Gorn, V.V.; Lukhtanov, E.A.; Belousov, E.S.; Singer, M.J.; Walburger, D.K.; Lokhov, S.G.; Gall, A.A. 3′-minor groove binder-DNA probes increase sequence specificity at PCR extension temperatures. Nucleic Acids Res. 2000, 28, 655–661. [Google Scholar] [CrossRef]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Nakano, Y.; Asada, K. Hydrogen Peroxide is Scavenged by Ascorbate-specific Peroxidase in Spinach Chloroplasts. Plant Cell Physiol. 1981, 22, 867–880. [Google Scholar] [CrossRef]
- Wendel, A.B.T.M. Glutathione peroxidase. In Detoxication and Drug Metabolism: Conjugation and Related Systems; Jakoby, W.B., Ed.; Academic Press: Cambridge, MA, USA, 1981; pp. 325–333. ISBN 0076-6879. [Google Scholar]
- Harrach, B.D.; Fodor, J.; Pogány, M.; Preuss, J.; Barna, B. Antioxidant, ethylene and membrane leakage responses to powdery mildew infection of near-isogenic barley lines with various types of resistance. Eur. J. Plant Pathol. 2008, 121, 21–33. [Google Scholar] [CrossRef]
- Żur, I.; Dubas, E.; Golemiec, E.; Szechyńska-Hebda, M.; Gołębiowska, G.; Wędzony, M. Stress-related variation in antioxidative enzymes activity and cell metabolism efficiency associated with embryogenesis induction in isolated microspore culture of triticale (x Triticosecale Wittm.). Plant Cell Rep. 2009, 28, 1279–1287. [Google Scholar] [CrossRef] [PubMed]
- Aebi, H.B.T.M. Catalase in vitro. In Oxygen Radicals in Biological Systems; Kaplan, N., Colowick, N., Eds.; Academic Press: Cambridge, MA, USA, 1984; pp. 121–126. ISBN 0076-6879. [Google Scholar]
- Guengerich, F.P.; Martin, M.V.; Sohl, C.D.; Cheng, Q. Measurement of cytochrome P450 and NADPH–cytochrome P450 reductase. Nat. Protoc. 2009, 4, 1245–1251. [Google Scholar] [CrossRef]
- Quayle, J.R.B.T.M. Formate dehydrogenase. In Carbohydrate Metabolism; Wood, W.A., Ed.; Academic Press: Cambridge, MA, USA, 1966; Volume 9, pp. 360–364. ISBN 0076-6879. [Google Scholar]
Ontology | Description | Number of DEGs and Direction of Regulation Referred to Cold-Acclimated State; T—Tolerant, S—Susceptible |
---|---|---|
Biological Process | phosphorylation | 39 upregulated (12 T, 27 S) |
Biological Process | cellular protein modification process | 44 upregulated (13 T, 31 S) |
Biological Process | cell recognition | 6 upregulated (S) |
Biological Process | localization/transport | 40 S (25 upregulated, 15 downregulated) |
Biological Process | phosphate-containing compound metabolic process | 27 upregulated (S) |
Biological Process | ion transmembrane transport | 8 downregulated (S) |
Biological Process | ATP metabolic process | 9 downregulated (S) |
Biological Process | ribonucleoside monophosphate metabolic process | 9 downregulated (S) |
Biological Process | cellular nitrogen (including nucleobase-containing) compound metabolic process | 24 (23) downregulated (S) |
Molecular Function | adenyl ribonucleotide binding | 50 upregulated (15 T, 35 S) |
Molecular Function | ATP binding | 32 upregulated (S) |
Molecular Function | transferase activity | 44 upregulated (S) |
Molecular Function | catalytic activity | 91 upregulated (S) |
DEG Number | UniProt Accession Number | Gene | Encoded Protein | BLAST |
---|---|---|---|---|
DEGs downregulated in tolerant to de-acclimation accessions | ||||
HORVU1HR1G085470 | A0A287GKC1 | N/A | Unknown function protein | 26S proteasome non-ATPase regulatory subunit 5 [Triticum urartu] |
HORVU2HR1G105740 | F2DG27 | N/A | Predicted protein | late embryogenesis abundant protein 18 [Aegilops tauschii subsp. tauschii] |
HORVU3HR1G084590 | A0A287M0T9 | N/A | Alkyl transferase | Dehydrodolichyl diphosphate synthase 2 [Triticum urartu] |
HORVU3HR1G097770 | A0A287MG44 | N/A | HMA domain-containing protein | heavy metal-associated isoprenylated plant protein 35-like [Aegilops tauschii subsp. tauschii] |
HORVU4HR1G011740 | M0VPD2 | N/A | Unknown function protein | auxin-repressed 12.5 kDa protein [Triticum aestivum] |
HORVU5HR1G081720 | A0A287S0C8 | N/A | Unknown function protein | PREDICTED: Aegilops tauschii subsp. tauschii pentatricopeptide repeat-containing protein At4g01400, mitochondrial-like (LOC109778148), mRNA |
HORVU5HR1G114630 | A0A287STL3 | N/A | Unknown function protein | pentatricopeptide repeat-containing protein At1g74850, chloroplastic-like [Aegilops tauschii subsp. tauschii] |
HORVU6HR1G037610 | A0A287TY77 | N/A | Unknown function protein | RNA-binding protein cabeza-like isoform X2 [Aegilops tauschii subsp. tauschii] |
HORVU6HR1G066450 | A0A287UH95 | N/A | Unknown function protein | MYB-related protein [Triticum aestivum] |
HORVU6HR1G087460 | A0A287V2G5 | N/A | Translocase of chloroplast | betaine aldehyde dehydrogenase [Hordeum vulgare subsp. vulgare] |
HORVU6HR1G091300 | A0A287V699 | N/A | Unknown function protein | P-loop NTPase domain-containing protein LPA1-like [Aegilops tauschii subsp. tauschii] |
HORVU7HR1G086180 | A0A287X6D2 | N/A | Unknown function protein | MscS family inner membrane protein ynaI [Triticum urartu] |
HORVU7HR1G086810 | M0UF38 | N/A | Translocase of chloroplast | putative GATA transcription factor 22 [Aegilops tauschii subsp. tauschii] |
HORVU7HR1G116770 | F2DRR5 | N/A | Dirigent protein | dirigent protein 21-like [Aegilops tauschii subsp. tauschii] |
DEGs upregulated in tolerant to de-acclimation accessions | ||||
HORVU1HR1G012240 | M0Y6Q6 | N/A | Unknown function protein | adenine/guanine permease AZG1 [Aegilops tauschii subsp. tauschii] |
HORVU1HR1G029850 | A0A287F1D6 | N/A | Unknown function protein | probable calcium-binding protein CML18 [Aegilops tauschii subsp. tauschii] |
HORVU1HR1G053440 | A0A287FMG9 | N/A | Proline dehydrogenase | - |
HORVU1HR1G070390 | A0A287G4C9 | N/A | Exocyst subunit Exo70 family protein | exocyst complex component EXO70B1-like [Aegilops tauschii subsp. tauschii] |
HORVU1HR1G086070 | A0A287GKY6 | N/A | Auxin-responsive protein | auxin-responsive protein IAA19-like [Aegilops tauschii subsp. tauschii] |
HORVU2HR1G014930 | A0A287H5G1 | N/A | Unknown function protein | putative lectin receptor-type protein kinase [Hordeum vulgare subsp. vulgare] |
HORVU2HR1G029900 | A0A287HJ83 | N/A | Unknown function protein | SNF1-type serine-threonine protein kinase [Triticum polonicum] |
HORVU2HR1G066100 | A0A287I9A8 | N/A | Unknown function protein | transcription factor bHLH35-like [Aegilops tauschii subsp. tauschii] |
HORVU2HR1G103890 | F2DF45 | N/A | Predicted protein | putative serine/threonine-protein kinase isoform X1 [Aegilops tauschii subsp. tauschii] |
HORVU2HR1G121310 | A0A287JPV5 | N/A | Unknown function protein | G-type lectin S-receptor-like serine/threonine-protein kinase At2g19130 [Setaria italica] |
HORVU3HR1G000150 | A0A287JUW2 | N/A | Unknown function protein | hypothetical protein TRIUR3_14872 [Triticum urartu] |
HORVU3HR1G084170 | A0A287M0E1 | N/A | Unknown function protein | glucan endo-1,3-beta-glucosidase 14-like isoform X1 [Aegilops tauschii subsp. tauschii] |
HORVU3HR1G084830 | A0A287M160 | N/A | Unknown function protein | nematode resistance protein-like HSPRO1 [Aegilops tauschii subsp. tauschii] |
HORVU3HR1G086240 | A0A287M2U9 | N/A | Unknown function protein | elicitor-responsive protein 1-like [Aegilops tauschii subsp. tauschii] |
HORVU3HR1G098150 | A0A287MG87 | N/A | Unknown function protein | Disease resistance protein RGA2 [Triticum urartu] |
HORVU4HR1G002710 | A0A287MXN9 | N/A | N-acetyltransferase domain-containing protein | Acyl-CoA N-acyltransferase (NAT) superfamily protein [Zea mays] |
HORVU5HR1G034830 | M0W8U1 | N/A | Unknown function protein | putative WRKY transcription factor 41 [Triticum urartu] |
HORVU5HR1G042740 | M0V1H8 | N/A | Glycosyltransferase | crocetin glucosyltransferase, chloroplastic-like [Aegilops tauschii subsp. tauschii] |
HORVU5HR1G067010 | A0A287RL26 | N/A | Unknown function protein | homeobox-leucine zipper protein HOX11-like [Aegilops tauschii subsp. tauschii] |
HORVU5HR1G072020 | M0X915 | N/A | Unknown function protein | probable WRKY transcription factor 2 [Aegilops tauschii subsp. tauschii] |
HORVU5HR1G099670 | A0A287SHF0 | N/A | GAT domain-containing protein | target of Myb protein 1-like isoform X1 [Aegilops tauschii subsp. tauschii] |
HORVU6HR1G012170 | A0A287TC05 | N/A | Terpene_synth_C domain-containing protein | S-(+)-linalool synthase, chloroplastic-like [Aegilops tauschii subsp. tauschii] |
HORVU6HR1G023340 | M0W8I2 | N/A | Unknown function protein | Tyrosine-sulfated glycopeptide receptor 1 [Triticum urartu] |
HORVU6HR1G028220 | A0A287TPZ1 | N/A | Unknown function protein | Disease resistance protein RPP13 [Dichanthelium oligosanthes] |
HORVU6HR1G062220 | A0A287UE62 | N/A | Unknown function protein | phospholipase A1-Ibeta2, chloroplastic-like [Aegilops tauschii subsp. tauschii] |
HORVU7HR1G076310 | A0A287WYF9 | N/A | Unknown function protein | MADS-box transcription factor 26 isoform X2 [Aegilops tauschii subsp. tauschii] |
HORVU2HR1G094780 | A0A287J0H6 | N/A | RNase H domain-containing protein | Bidirectional sugar transporter SWEET14 [Triticum urartu] |
HORVU3HR1G085690 | A0A287M208 | N/A | Unknown function protein | hypothetical protein TRIUR3_20661 [Triticum urartu] |
HORVU4HR1G071670 | M0VAZ0 | N/A | GRAS domain-containing protein | scarecrow-like protein 21 [Aegilops tauschii subsp. tauschii] |
DEGs upregulated in susceptible to de-acclimation accessions | ||||
HORVU0HR1G039970 | A0A287EDG6 | N/A | Unknown function protein | putative receptor-like protein kinase At3g47110 [Oryza sativa Japonica Group] |
HORVU1HR1G001950 | M0YQK2 | N/A | Unknown function protein | 12-oxophytodienoic acid reductase 1-A2a [Triticum aestivum] |
HORVU1HR1G004150 | M0ZD08 | N/A | Unknown function protein | CI2D [Hordeum vulgare subsp. Vulgare] |
HORVU1HR1G011990 | A0A287EN93 | N/A | Unknown function protein | CI2D [Hordeum vulgare subsp. Vulgare] |
HORVU1HR1G012240 | M0Y6Q6 | N/A | Unknown function protein | adenine/guanine permease AZG1 [Aegilops tauschii subsp. tauschii] |
HORVU1HR1G037250 | A0A287F5H3 | N/A | ABC transporter domain-containing protein | ABC transporter G family member 28-like isoform X1 [Aegilops tauschii subsp. tauschii] |
HORVU1HR1G040720 | A0A287F8T6 | N/A | Long-chain-alcohol oxidase | long-chain-alcohol oxidase FAO1-like [Aegilops tauschii subsp. tauschii] |
HORVU1HR1G042370 | A0A287FAK6 | N/A | Unknown function protein | putative receptor-like protein kinase At4g00960 isoform X1 [Aegilops tauschii subsp. tauschii] |
HORVU1HR1G051450 | M0VBP8 | N/A | Unknown function protein | urea-proton symporter DUR3 [Brachypodium distachyon] |
HORVU1HR1G053440 | A0A287FMG9 | N/A | Proline dehydrogenase | - |
HORVU1HR1G070730 | A0A287G4Q8 | N/A | Ammonium transporter | ammonium transporter 2 member 1 isoform X2 [Aegilops tauschii subsp. Tauschii] |
HORVU1HR1G072910 | A0A287G793 | N/A | Unknown function protein | Rop guanine nucleotide exchange factor 1 [Triticum urartu] |
HORVU1HR1G092240 | A0A287GRA5 | N/A | Unknown function protein | Glucan endo-1,3-beta-glucosidase 3 [Triticum urartu] |
HORVU1HR1G093480 | A0A287GSJ3 | N/A | Unknown function protein | tryptophan synthase alpha subunit [Secale cereale] |
HORVU2HR1G004280 | A0A287GXX3 | N/A | Unknown function protein | 1-aminocyclopropane-1-carboxylate oxidase homolog 1-like [Aegilops tauschii subsp. tauschii] |
HORVU2HR1G018440 | F2CV55 | N/A | Peroxidase | Peroxidase 2 [Triticum urartu] |
HORVU2HR1G018570 | F2D6Z5 | N/A | Peroxidase | Peroxidase 2 [Triticum urartu] |
HORVU2HR1G032680 | A0A287HLZ8 | N/A | Unknown function protein | LRR receptor-like serine/threonine-protein kinase RPK2 [Aegilops tauschii subsp. tauschii] |
HORVU2HR1G038940 | F2DNU6 | N/A | Predicted protein | photosystem II 10 kDa polypeptide, chloroplastic [Aegilops tauschii subsp. tauschii] |
HORVU2HR1G044520 | A0A287HUX4 | N/A | Unknown function protein | Cysteine-rich receptor-like protein kinase 25 [Triticum urartu] |
HORVU2HR1G064160 | A0A287I7L8 | N/A | Unknown function protein | sugar transport protein 1-like [Aegilops tauschii subsp. tauschii] |
HORVU2HR1G090160 | A0A287IW42 | N/A | Cytokin-bind domain-containing protein | hypothetical protein BRADI_5g16083v3 [Brachypodium distachyon] |
HORVU2HR1G094840 | A0A287J0D9 | N/A | Unknown function protein | RING-H2 finger protein ATL28 [Triticum urartu] |
HORVU2HR1G098450 | A0A287J3Q1 | N/A | Unknown function protein | probable LRR receptor-like serine/threonine-protein kinase At1g56130 [Aegilops tauschii subsp. tauschii] |
HORVU2HR1G108180 | A0A287JDG1 | N/A | Epimerase domain-containing protein | Anthocyanidin reductase [Triticum urartu] |
HORVU2HR1G116880 | A0A287JKB3 | N/A | Unknown function protein | Receptor-like serine/threonine-protein kinase SD1-8 [Triticum urartu] |
HORVU2HR1G117290 | A0A287JKU9 | N/A | Serine/threonine-protein kinase | G-type lectin S-receptor-like serine/threonine-protein kinase B120 [Aegilops tauschii subsp. tauschii] |
HORVU3HR1G001390 | M0YW91 | N/A | Unknown function protein | Putative serine/threonine-protein kinase-like protein CCR3 [Triticum urartu] |
HORVU3HR1G013180 | A0A287K4Z4 | N/A | Unknown function protein | G-type lectin S-receptor-like serine/threonine-protein kinase At2g19130 [Aegilops tauschii subsp. tauschii] |
HORVU3HR1G013650 | A0A287K5J2 | N/A | Unknown function protein | glutathione hydrolase 3 [Oryza sativa Japonica Group] |
HORVU3HR1G019750 | M0X3Y1 | N/A | Auxin-responsive protein | Auxin-responsive protein IAA16 [Triticum urartu] |
HORVU3HR1G022780 | A0A287KER6 | N/A | Unknown function protein | wall-associated receptor kinase-like 20 [Aegilops tauschii subsp. tauschii] |
HORVU3HR1G031020 | F2D225 | N/A | Predicted protein | cytochrome P450 71A1-like [Aegilops tauschii subsp. tauschii] |
HORVU3HR1G035170 | F2DLR2 | N/A | Predicted protein | protein TPR1 [Aegilops tauschii subsp. tauschii] |
HORVU3HR1G062170 | M0WTL9 | N/A | Non-lysosomal glucosylceramidase | non-lysosomal glucosylceramidase-like [Aegilops tauschii subsp. tauschii] |
HORVU3HR1G071470 | A0A287LKZ5 | N/A | Unknown function protein | ABC transporter G family member 32-like [Aegilops tauschii subsp. tauschii] |
HORVU3HR1G071750 | A0A287LLA5 | N/A | Unknown function protein | WRKY transcription factor 39 [Hordeum vulgare subsp. vulgare] |
HORVU3HR1G077670 | M0Y6H3 | N/A | Unknown function protein | disease resistance protein RPS2-like [Aegilops tauschii subsp. tauschii] |
HORVU3HR1G081300 | A0A287LX11 | N/A | RING-type E3 ubiquitin transferase | U-box domain-containing protein 16 [Brachypodium distachyon] |
HORVU3HR1G084170 | A0A287M0E1 | N/A | Unknown function protein | Glucan endo-1,3-beta-glucosidase 14 [Triticum urartu] |
HORVU3HR1G090170 | A0A287M894 | N/A | Unknown function protein | tropinone reductase homolog At5g06060-like isoform X3 [Aegilops tauschii subsp. tauschii] |
HORVU3HR1G092460 | A0A287MAB7 | N/A | Unknown function protein | auxin-responsive protein SAUR71-like [Aegilops tauschii subsp. tauschii] |
HORVU3HR1G096360 | A0A287MER1 | N/A | Unknown function protein | acyl transferase 4-like [Aegilops tauschii subsp. tauschii] |
HORVU3HR1G109590 | M0YBT1 | N/A | Unknown function protein | glycosyltransferase [Triticum aestivum] |
HORVU4HR1G019410 | M0ZB44 | N/A | Unknown function protein | alkaline invertase [Triticum aestivum] |
HORVU4HR1G026770 | A0A287NMD2 | N/A | LEA_2 domain-containing protein | NDR1/HIN1-like protein 13 [Aegilops tauschii subsp. Tauschii] |
HORVU4HR1G052490 | A0A287P258 | N/A | Unknown function protein | R2R3-MYB protein [Triticum aestivum] |
HORVU4HR1G071360 | F2CZ96 | N/A | Cytochrome b561 and DOMON domain-containing protein | cytochrome b561 and DOMON domain-containing protein At4g12980-like [Aegilops tauschii subsp. tauschii] |
HORVU4HR1G072880 | A0A287PM62 | N/A | Phosphoserine aminotransferase | phosphoserine aminotransferase 1, chloroplastic [Brachypodium distachyon] |
HORVU4HR1G074250 | F2DUL1 | N/A | Unknown function protein | BEL1-like homeodomain protein 7 [Aegilops tauschii subsp. tauschii] |
HORVU4HR1G082710 | A0A287PVS7 | MLO | MLO-like protein | MLO [Triticum aestivum] |
HORVU4HR1G083210 | A0A287PXC8 | N/A | Unknown function protein | anthranilate phosphoribosyltransferase, chloroplastic [Aegilops tauschii subsp. tauschii] |
HORVU4HR1G084590 | F2DV82 | N/A | Predicted protein | homeobox protein BEL1 homolog [Aegilops tauschii subsp. tauschii] |
HORVU4HR1G085250 | A0A287PY55 | N/A | Unknown function protein | tonoplast intrinsic protein [Hordeum vulgare subsp. vulgare] |
HORVU5HR1G000640 | A0A287Q624 | N/A | Unknown function protein | ATPase 2 [Hordeum vulgare subsp. Vulgare] |
HORVU5HR1G014170 | A0A287QEN1 | N/A | Unknown function protein | bZIP6 [Triticum aestivum] |
HORVU5HR1G041660 | A0A287QYD2 | N/A | Unknown function protein | probable LRR receptor-like protein kinase At1g51890 [Aegilops tauschii subsp. tauschii] |
HORVU5HR1G055850 | F2D5N7 | N/A | Predicted protein | sugar transport protein 14 [Aegilops tauschii subsp. Tauschii] |
HORVU5HR1G059090 | F2DCK3 | N/A | Hexosyltransferase | hydroxyproline O-galactosyltransferase GALT3-like [Aegilops tauschii subsp. tauschii] |
HORVU5HR1G061930 | A0A287RGQ6 | N/A | Unknown function protein | cytochrome P450 71A1-like [Aegilops tauschii subsp. tauschii] |
HORVU5HR1G061950 | A0A287RH10 | N/A | Unknown function protein | cytochrome P450 71A1-like [Aegilops tauschii subsp. tauschii] |
HORVU5HR1G064020 | F2DY24 | N/A | Predicted protein | hypothetical protein TRIUR3_10720 [Triticum urartu] |
HORVU5HR1G066360 | M0ZDV2 | N/A | Unknown function protein | putative high-affinity sulfate transporter [Triticum turgidum subsp. durum] |
HORVU5HR1G067010 | A0A287RL26 | N/A | Unknown function protein | homeobox-leucine zipper protein HOX11 [Brachypodium distachyon] |
HORVU5HR1G070360 | A0A287RPR9 | N/A | Unknown function protein | putative wall-associated receptor kinase-like 16 [Aegilops tauschii subsp. tauschii] |
HORVU5HR1G080340 | M0YYJ0 | CBF12C | CBF12C | CBF12C [Hordeum vulgare subsp. Vulgare] |
HORVU5HR1G080350 | Q3SAT4 | CBF14 | CBF14 | HvCBF14 [Hordeum vulgare subsp. Vulgare] |
HORVU5HR1G080860 | A0A287RZG2 | N/A | Unknown function protein | UDP-D-glucose epimerase 3 [Hordeum vulgare] |
HORVU5HR1G085710 | D2KZ48 | HvNIP1;2 | Nodulin-26 like intrinsic protein | nodulin-26 like intrinsic protein [Hordeum vulgare subsp. vulgare] |
HORVU5HR1G093090 | A0A287S9R4 | N/A | AA_permease_C domain-containing protein | cationic amino acid transporter 1-like [Aegilops tauschii subsp. tauschii] |
HORVU5HR1G093660 | F2EFG2 | N/A | Nonspecific serine/threonine protein kinase | CBL-interacting protein kinase 7 [Triticum aestivum] |
HORVU5HR1G094430 | A0A287SBM8 | N/A | Unknown function protein | cadmium/zinc-transporting P1B-ATPase 3 isoform HMA3.1 [Hordeum vulgare subsp. vulgare] |
HORVU5HR1G097270 | A0A287SF79 | N/A | Peroxidase | peroxidase 50-like [Aegilops tauschii subsp. tauschii] |
HORVU5HR1G099670 | A0A287SHF0 | N/A | GAT domain-containing protein | target of Myb protein 1-like isoform X1 [Aegilops tauschii subsp. tauschii] |
HORVU5HR1G105930 | M0UPG3 | N/A | CASP-like protein | CASP-like protein 1U3 [Aegilops tauschii subsp. tauschii] |
HORVU5HR1G109040 | A0A287SNK5 | N/A | Unknown function protein | lipid transfer protein [Triticum aestivum] |
HORVU5HR1G110180 | A0A287SPK7 | N/A | Unknown function protein | phosphate transporter [Hordeum vulgare subsp. vulgare] |
HORVU6HR1G008640 | A0A287T8X2 | N/A | Catalase | RecName: Full = Catalase isozyme 2 [Hordeum vulgare] |
HORVU6HR1G037850 | F2DCG6 | N/A | Predicted protein | F-box/kelch-repeat protein At1g55270-like [Aegilops tauschii subsp. tauschii] |
HORVU6HR1G061280 | A0A287UDJ5 | N/A | Unknown function protein | probable receptor-like protein kinase At1g33260 [Aegilops tauschii subsp. tauschii] |
HORVU6HR1G061450 | M0XJI0 | N/A | Unknown function protein | iron-phytosiderophore transporter [Hordeum vulgare subsp. Vulgare] |
HORVU6HR1G069400 | A0A287UKB1 | N/A | 2-Hacid_dh domain-containing protein | formate dehydrogenase [Triticum aestivum] |
HORVU6HR1G073660 | M0VY04 | N/A | Unknown function protein | nudix hydrolase 17, mitochondrial-like [Aegilops tauschii subsp. tauschii] |
HORVU6HR1G076510 | F2DC11 | N/A | Predicted protein | metalloendoproteinase 1 precursor [Zea mays] |
HORVU7HR1G007480 | A0A287VFS1 | N/A | Unknown function protein | probable LRR receptor-like serine/threonine-protein kinase At3g47570 [Brachypodium distachyon] |
HORVU7HR1G007520 | A0A287VFT7 | N/A | Unknown function protein | LRR receptor-like serine/threonine-protein kinase FLS2 [Triticum urartu] |
HORVU7HR1G011250 | A0A287VI73 | N/A | Unknown function protein | probable E3 ubiquitin-protein ligase XBOS36 [Aegilops tauschii subsp. tauschii] |
HORVU7HR1G013710 | A0A287VJQ7 | N/A | 3-phosphoshikimate 1-carboxyvinyltransferase | chloroplast 5-enolpyruvylshikimate-3-phosphate synthase [Triticum aestivum] |
HORVU7HR1G024670 | F2D5K9 | N/A | Predicted protein | UCW116, putative lipase [Hordeum vulgare subsp. Vulgare] |
HORVU7HR1G025670 | A0A287VRC7 | N/A | Unknown function protein | protein NRT1/PTR FAMILY 2.3-like [Aegilops tauschii subsp. tauschii] |
HORVU7HR1G030380 | A0A287VWN6 | N/A | Unknown function protein | cinnamoyl-CoA reductase 1-like [Aegilops tauschii subsp. tauschii] |
HORVU7HR1G048970 | F2D5L5 | N/A | Predicted protein | tricin synthase 1-like [Aegilops tauschii subsp. tauschii] |
HORVU7HR1G052560 | A0A287WI67 | N/A | Calcium-transporting ATPase | calcium-transporting ATPase 8, plasma membrane-type-like isoform X1 [Aegilops tauschii subsp. tauschii] |
HORVU7HR1G086580 | A0A287X6Z2 | N/A | Unknown function protein | U-box domain-containing protein 34-like [Aegilops tauschii subsp. tauschii] |
HORVU7HR1G089360 | A0A287X975 | N/A | Peroxidase | peroxidase P7-like [Aegilops tauschii subsp. tauschii] |
HORVU7HR1G108530 | A0A287XRG5 | N/A | Peroxidase | peroxidase 70-like [Aegilops tauschii subsp. tauschii] |
HORVU7HR1G113510 | A0A287XV75 | N/A | Unknown function protein | L-type lectin-domain-containing receptor kinase IX.1-like [Aegilops tauschii subsp. tauschii] |
HORVU7HR1G114660 | A0A287XVT0 | N/A | Unknown function protein | Indole-3-glycerol phosphate synthase, chloroplastic [Triticum urartu] |
HORVU1HR1G002410 | A0A287EGE7 | N/A | LRRNT_2 domain-containing protein | polygalacturonase inhibitor-like [Aegilops tauschii subsp. tauschii] |
HORVU1HR1G011430 | M0UHV3 | N/A | IU_nuc_hydro domain-containing protein | unnamed protein product [Triticum turgidum subsp. durum] |
HORVU1HR1G011730 | A0A287EMY8 | N/A | Protein kinase domain-containing protein | receptor like protein kinase S.2-like isoform X1 [Aegilops tauschii subsp. tauschii] |
HORVU1HR1G023220 | A0A287EX35 | N/A | Unknown function protein | predicted protein [Hordeum vulgare subsp. vulgare] |
HORVU1HR1G052010 | A0A287FKD1 | N/A | C2 NT-type domain-containing protein | protein PLASTID MOVEMENT IMPAIRED 1-like [Aegilops tauschii subsp. tauschii] |
HORVU1HR1G070720 | A0A287G4Q3 | N/A | Unknown function protein | unknown [Zea mays] |
HORVU1HR1G080860 | A0A287GGB7 | N/A | Unknown function protein | predicted protein [Hordeum vulgare subsp. vulgare] |
HORVU2HR1G010560 | A0A287H1T4 | N/A | Unknown function protein | - |
HORVU2HR1G019180 | A0A287H8Z0 | N/A | NAD(P)-bd_dom domain-containing protein | UDP-D-glucuronate decarboxylase [Hordeum vulgare] |
HORVU2HR1G030660 | M0VWF8 | N/A | Unknown function protein | unnamed protein product [Triticum turgidum subsp. durum] |
HORVU2HR1G032360 | A0A287HLF8 | N/A | Unknown function protein | predicted protein [Hordeum vulgare subsp. vulgare] |
HORVU2HR1G096230 | M0UYR4 | N/A | Aa_trans domain-containing protein | lysine histidine transporter-like 8 [Brachypodium distachyon] |
HORVU3HR1G027700 | A0A287KJ28 | N/A | DJ-1_PfpI domain-containing protein | protein DJ-1 homolog B-like [Aegilops tauschii subsp. tauschii] |
HORVU3HR1G073280 | M0WFD0 | N/A | Unknown function protein | hypothetical protein TRIUR3_04936 [Triticum urartu] |
HORVU3HR1G075150 | F2D9C7 | N/A | Predicted protein | protein LURP-one-related 5-like [Aegilops tauschii subsp. tauschii] |
HORVU4HR1G009140 | A0A287N4V6 | N/A | PfkB domain-containing protein | putative ribokinase [Triticum turgidum subsp. Durum] |
HORVU4HR1G060260 | M0Y821 | N/A | Unknown function protein | predicted protein [Hordeum vulgare subsp. vulgare] |
HORVU4HR1G067840 | M0YH93 | N/A | TPT domain-containing protein | GDP-mannose transporter GONST3-like isoform X1 [Aegilops tauschii subsp. tauschii] |
HORVU4HR1G076750 | M0WWI7 | N/A | AB hydrolase-1 domain-containing protein | salicylic acid-binding protein 2-like [Aegilops tauschii subsp. tauschii] |
HORVU4HR1G085150 | M0UZW0 | N/A | Unknown function protein | unnamed protein product [Triticum turgidum subsp. durum] |
HORVU5HR1G002340 | A0A287Q7I1 | N/A | Unknown function protein | predicted protein [Hordeum vulgare subsp. vulgare] |
HORVU5HR1G040970 | A0A287QXS7 | N/A | DUF3700 domain-containing protein | stem-specific protein TSJT1 [Aegilops tauschii subsp. tauschii] |
HORVU5HR1G049370 | A0A287R4Y8 | N/A | Hydrolase_4 domain-containing protein | caffeoylshikimate esterase [Brachypodium distachyon] |
HORVU5HR1G084700 | F2EJL0 | N/A | Predicted protein | predicted protein [Hordeum vulgare subsp. vulgare] |
HORVU5HR1G104050 | A0A287SK30 | N/A | Unknown function protein | purine permease 3-like [Aegilops tauschii subsp. tauschii] |
HORVU6HR1G070610 | A0A287UL09 | N/A | Unknown function protein | M55 family metallopeptidase [Oscillibacter sp. 1–3] |
HORVU6HR1G093860 | M0YBQ9 | N/A | Unknown function protein | protein LAZY 1 [Aegilops tauschii subsp. tauschii] |
HORVU7HR1G036780 | A0A287W267 | N/A | Unknown function protein | protein EXORDIUM-like [Aegilops tauschii subsp. tauschii] |
DEGs downregulated in susceptible to de-acclimation accessions | ||||
HORVU0HR1G002870 | A0A287DV08 | N/A | Unknown function protein | E3 ubiquitin-protein ligase RDUF1-like [Aegilops tauschii subsp. tauschii] |
HORVU0HR1G003900 | A0A287DVH9 | N/A | Unknown function protein | glycine-rich cell wall structural protein-like [Aegilops tauschii subsp. tauschii] |
HORVU0HR1G021760 | M0V2B7 | N/A | Unknown function protein | ent-kaurene oxidase 1 [Hordeum vulgare subsp. Vulgare] |
HORVU1HR1G052560 | A0A287FKY6 | N/A | Unknown function protein | DDB1- and CUL4-associated factor 8 [Triticum urartu] |
HORVU1HR1G053080 | A0A287FLT1 | N/A | Unknown function protein | carotene epsilon-monooxygenase, chloroplastic [Aegilops tauschii subsp. tauschii] |
HORVU1HR1G076190 | A0A287GAV2 | N/A | Unknown function protein | heat shock protein 101 [Triticum aestivum] |
HORVU1HR1G083420 | F2D3K2 | HsfA2c | Heat shock factor A2c | heat shock factor A2c [Hordeum vulgare subsp. vulgare] |
HORVU1HR1G087070 | A0A287GLN9 | N/A | Unknown function protein | DnaJ homolog subfamily B member 13 [Triticum urartu] |
HORVU1HR1G094480 | A0A287GTJ4 | N/A | ATP-dependent Clp protease proteolytic subunit | PREDICTED: ATP-dependent Clp protease proteolytic subunit-related protein 1, chloroplastic [Oryza brachyantha] |
HORVU2HR1G071860 | A0A287IEE1 | N/A | Predicted protein | 3-beta hydroxysteroid dehydrogenase/isomerase family protein [Zea mays] |
HORVU2HR1G076530 | M0VD73 | N/A | Unknown function protein | hypothetical protein TRIUR3_05260 [Triticum urartu] |
HORVU2HR1G081670 | M0WB36 | N/A | Unknown function protein | ATP-dependent 6-phosphofructokinase 2 [Brachypodium distachyon] |
HORVU3HR1G030950 | F2DNE0 | N/A | Predicted protein | cytochrome P450 71A1-like [Aegilops tauschii subsp. tauschii] |
HORVU3HR1G042770 | A0A287KWA3 | N/A | Predicted protein | putative anion transporter 1, chloroplastic [Triticum urartu] |
HORVU3HR1G063620 | A0A287LBU9 | N/A | Unknown function protein | 65-kDa microtubule-associated protein 3 [Brachypodium distachyon] |
HORVU3HR1G067380 | A0A287LGC6 | N/A | Unknown function protein | probable protein phosphatase 2C 50 [Aegilops tauschii subsp. tauschii] |
HORVU3HR1G074780 | A0A287LPG5 | N/A | Unknown function protein | protein STRICTOSIDINE SYNTHASE-LIKE 10-like [Aegilops tauschii subsp. tauschii] |
HORVU3HR1G078270 | A0A287LT80 | N/A | Unknown function protein | type II metacaspase [Triticum aestivum] |
HORVU3HR1G081960 | A0A287LXY1 | N/A | SUEL-type lectin domain-containing protein | beta-galactosidase 3-like [Aegilops tauschii subsp. tauschii] |
HORVU3HR1G085100 | A0A287M173 | N/A | Unknown function protein | protein ENHANCED PSEUDOMONAS SUSCEPTIBILTY 1 [Brachypodium distachyon] |
HORVU3HR1G089300 | A0A287M6P9 | N/A | Unknown function protein | dehydrin [Hordeum vulgare subsp. Vulgare] |
HORVU3HR1G106720 | A0A287MKT2 | N/A | Pyrroline-5-carboxylate reductase | pyrroline-5-carboxylate reductase [Triticum aestivum] |
HORVU3HR1G113340 | A0A287MR98 | N/A | Unknown function protein | probable aspartyl aminopeptidase [Aegilops tauschii subsp. tauschii] |
HORVU4HR1G018180 | A0A287NFC0 | N/A | Unknown function protein | methylsterol monooxygenase 1–2 [Brachypodium distachyon] |
HORVU4HR1G027150 | M0XWK0 | N/A | Unknown function protein | Mitochondrial uncoupling protein 3 [Triticum urartu] |
HORVU4HR1G072620 | M0XE93 | N/A | Unknown function protein | ABC transporter G family member 22 [Triticum urartu] |
HORVU4HR1G085590 | F2DTJ0 | N/A | Predicted protein | subtilisin-like protease SBT1.2 [Brachypodium distachyon] |
HORVU5HR1G006780 | A0A287Q9A7 | N/A | Unknown function protein | 5-methyltetrahydropteroyltriglutamate—homocysteine methyltransferase 1-like [Aegilops tauschii subsp. tauschii] |
HORVU5HR1G056620 | A0A287RBF6 | N/A | Unknown function protein | NAD kinase 4 [Triticum aestivum] |
HORVU5HR1G059860 | A0A287RE25 | N/A | Unknown function protein | DEAD-box ATP-dependent RNA helicase 22 [Triticum urartu] |
HORVU5HR1G062310 | F2DDU3 | N/A | Predicted protein | 20 kDa chaperonin, chloroplastic-like [Aegilops tauschii subsp. tauschii] |
HORVU5HR1G106790 | A0A287SML9 | N/A | Unknown function protein | probable GTP-binding protein OBGC2 isoform X1 [Oryza sativa Japonica Group] |
HORVU6HR1G031480 | A0A287TST0 | N/A | Succinate-semialdehyde dehydrogenase | succinate-semialdehyde dehydrogenase, mitochondrial [Aegilops tauschii subsp. Tauschii] |
HORVU6HR1G065710 | A0A287UGU3 | N/A | Unknown function protein | SPX domain-containing membrane protein Os02g45520 [Aegilops tauschii subsp. tauschii] |
HORVU6HR1G068490 | M0WYY1 | N/A | LAGLIDADG_2 domain-containing protein | pentatricopeptide repeat-containing protein OTP51, chloroplastic [Brachypodium distachyon] |
HORVU6HR1G069260 | A0A287UK48 | N/A | Unknown function protein | universal stress protein A-like protein [Aegilops tauschii subsp. tauschii] |
HORVU6HR1G077710 | A0A287UT21 | N/A | SHSP domain-containing protein | 24.1 kDa heat shock protein, mitochondrial-like isoform X2 [Aegilops tauschii subsp. tauschii] |
HORVU6HR1G091300 | A0A287V699 | N/A | Unknown function protein | P-loop NTPase domain-containing protein LPA1-like [Aegilops tauschii subsp. tauschii] |
HORVU6HR1G095270 | A0A287VAF7 | N/A | Protein DETOXIFICATION | protein DETOXIFICATION 45, chloroplastic isoform X1 [Aegilops tauschii subsp. tauschii] |
HORVU7HR1G027560 | M0WGG7 | N/A | Unknown function protein | CONSTANS-like protein CO8 [Hordeum vulgare subsp. vulgare] |
HORVU7HR1G034990 | A0A287W0Z9 | N/A | Kinesin-like protein | kinesin-like protein KIN-7D, chloroplastic isoform X1 [Aegilops tauschii subsp. tauschii] |
HORVU7HR1G047700 | F2CWR0 | N/A | Formate dehydrogenase, mitochondrial | RecName: Full = Formate dehydrogenase, mitochondrial; Short = FDH; AltName: Full = NAD-dependent formate dehydrogenase; Flags: Precursor [Hordeum vulgare] |
HORVU7HR1G098580 | A0A287XIG8 | N/A | Lipase_GDSL domain-containing protein | acetylajmalan esterase-like [Aegilops tauschii subsp. tauschii] |
HORVU7HR1G110170 | A0A287XSX0 | N/A | Histone H2B | Histone H2B.2 [Triticum urartu] |
HORVU7HR1G116770 | F2DRR5 | N/A | Dirigent protein | dirigent protein 21-like [Aegilops tauschii subsp. tauschii] |
HORVU0HR1G034940 | A0A287KZ68 | N/A | Unknown function protein | putative protein 137 [Sorghum arundinaceum] |
HORVU1HR1G030000 | A0A287F1D9 | N/A | Unknown function protein | predicted protein [Hordeum vulgare subsp. vulgare] |
HORVU1HR1G072220 | A0A287G6E5 | N/A | Unknown function protein | Heat shock cognate 70 kDa protein 4 [Triticum urartu] |
HORVU1HR1G078350 | M0Y7A7 | N/A | Methyltransf_11 domain-containing protein | phosphomethylethanolamine N-methyltransferase-like [Aegilops tauschii subsp. tauschii] |
HORVU2HR1G087490 | A0A287ITE4 | N/A | Unknown function protein | protein trichome birefringence-like 10 [Aegilops tauschii subsp. tauschii] |
HORVU3HR1G048810 | A0A287KZ68 | N/A | Unknown function protein | putative protein 137 [Sorghum arundinaceum] |
HORVU3HR1G059610 | A0A287L8L9 | N/A | Unknown function protein | Phosphoglycerate mutase family protein [Zea mays] |
HORVU4HR1G065180 | F2DC44 | N/A | Predicted protein | predicted protein [Hordeum vulgare subsp. vulgare] |
HORVU5HR1G016810 | A0A287QGT4 | N/A | HVA22-like protein | HVA22-like protein e [Aegilops tauschii subsp. tauschii] |
HORVU5HR1G069360 | F2DJC5 | N/A | Predicted protein | oil body-associated protein 1A [Brachypodium distachyon] |
HORVU6HR1G049490 | A0A287KZ68 | N/A | Unknown function protein | putative protein 137 [Sorghum arundinaceum] |
HORVU6HR1G060020 | M0Z5W3 | N/A | BRO1 domain-containing protein | hypothetical protein TRIUR3_13310 [Triticum urartu] |
HORVU6HR1G063480 | A0A287UES2 | N/A | PALP domain-containing protein | cysteine synthase-like isoform X1 [Aegilops tauschii subsp. tauschii] |
HORVU6HR1G073040 | A0A287UNF9 | N/A | MADS-box domain-containing protein | MADS-box transcription factor TaAGL17 [Triticum aestivum] |
HORVU6HR1G082360 | A0A287UXN4 | N/A | SHSP domain-containing protein | 18.6 kDa class III heat shock protein-like [Aegilops tauschii subsp. tauschii] |
HORVU7HR1G051730 | A0A287WH78 | N/A | Unknown function protein | unnamed protein product [Triticum turgidum subsp. durum] |
HORVU7HR1G091670 | A0A287KZ68 | N/A | Unknown function protein | putative protein 137 [Sorghum arundinaceum] |
Gene | Forward Primer 3′-5′ | Reverse Primer 3′-5′ | Probe 3′-5′ |
---|---|---|---|
Peroxidase | GCACTTCCACGACTGCTTTG | CCATGCCAGACAGCAGAACA | FAM-CCAAGGTTGTGACGCGT-MGB |
Catalase | GGACCTGCTCGGCAACAA | GGGCTTGAAGGCGTGGAT | FAM-CCCCGTCTTCTTCA-MGB |
CBF14 | CAGCATCCATCTCTCCCAAGTC | TGTGGAGTAAGCAGCGTGTTTT | FAM-CAGCGCAGCAGCT-MGB |
PGU inhibitor-like | TACCACTTTGCGTCCTGGAC | TCAGCATCACAGTCGACGTC | FAM-GCCCGACTCCGCCTGTTGC-MGB |
sHSP | GTCGCCATCGCCTGATCT | TGACAAACGCCGATGAGGTA | FAM-TACCTCAGTCGCGCCAG-MGB |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wójcik-Jagła, M.; Daszkowska-Golec, A.; Fiust, A.; Kopeć, P.; Rapacz, M. Identification of the Genetic Basis of Response to de-Acclimation in Winter Barley. Int. J. Mol. Sci. 2021, 22, 1057. https://doi.org/10.3390/ijms22031057
Wójcik-Jagła M, Daszkowska-Golec A, Fiust A, Kopeć P, Rapacz M. Identification of the Genetic Basis of Response to de-Acclimation in Winter Barley. International Journal of Molecular Sciences. 2021; 22(3):1057. https://doi.org/10.3390/ijms22031057
Chicago/Turabian StyleWójcik-Jagła, Magdalena, Agata Daszkowska-Golec, Anna Fiust, Przemysław Kopeć, and Marcin Rapacz. 2021. "Identification of the Genetic Basis of Response to de-Acclimation in Winter Barley" International Journal of Molecular Sciences 22, no. 3: 1057. https://doi.org/10.3390/ijms22031057
APA StyleWójcik-Jagła, M., Daszkowska-Golec, A., Fiust, A., Kopeć, P., & Rapacz, M. (2021). Identification of the Genetic Basis of Response to de-Acclimation in Winter Barley. International Journal of Molecular Sciences, 22(3), 1057. https://doi.org/10.3390/ijms22031057