Genetic Analysis of Hexaploid Wheat (Triticum aestivum L.) Using the Complete Sequencing of Chloroplast DNA and Haplotype Analysis of the Wknox1 Gene
Abstract
:1. Introduction
- Triticum turgidum subsp. palaeocolchicum (Menabde) A. Love
- Triticum turgidum subsp. carthlicum (Nevski) A. Love
- Triticum timopheevii subsp. zhukovskyi (Menabde & Ericzjan) L. B. Cai
- Triticum zhukovskyi Menabde & Ericzjan
- Triticum aestivum subsp. macha (Dekapr. & Menabde) McKey
2. Results
2.1. Complete cpDNA Sequence of Hexaploid Wheats
2.2. PCR Analysis of Three Homoeologous Loci of Wheat Wknox1 Gene
2.2.1. Wknox1d Fourth Intron Region
2.2.2. Fifth-to-Sixth Exon Region of Wknox1b
3. Discussion
4. Materials and Methods
4.1. Plant Material, DNA Isolation, PCR Analysis, Genomic DNA Library Preparation and Sequencing on an Illumina NovaSeq 6000 Platform
4.2. Construction of Shotgun Genomic DNA Libraries
4.3. Sequencing of Libraries in the NovaSeq
4.4. PCR Analysis of Three Homoeologous Wheat Wknox1 Gene
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Dvorak, J.; Deal, K.R.; Luo, M.-C.; You, F.M.; Von Borstel, K.; Denghani, H. The Origin of Spelt and Free-Threshing Hexaploid Wheat. J. Hered. 2012, 103, 426–441. [Google Scholar] [CrossRef] [Green Version]
- Yen, C.; Yang, J. Biosystematics of Triticeae: Volume I. Triticum-Aegilops Complex; Springer Nature: Basingstoke, UK, 2020; Available online: https://link.springer.com/book/10.1007/978-981-13-9931-2 (accessed on 5 November 2021).
- Kuckuck, H. On the origin of Triticum carthlicum Nevski (Triticum persicum Vav.). Wheat Inf. Serv. 1979, 50, 1–5. [Google Scholar]
- Dekaprelevich, L.L. The role of Georgia in the origin of wheat. Soobsch. Akad. Nauk Gruz. SSR 1941, 2, 915–922. [Google Scholar]
- Menabde, V.L. Wheats of Georgia. Edition of Academy of Science of Georgian SSR; Georgian Academy of Sciences Press: Tbilisi, Georgia, 1948; 272p. (In Russian) [Google Scholar]
- Menabde, V.L. Cultivated flora of Georgia. In Botanical Excursions over Georgia; Sakhokia, M.F., Ed.; Publishing House of the Academy of Sciences of Georgian SSR: Tbilisi, Georgia, 1961; pp. 69–76. (In Russian) [Google Scholar]
- Hammer, K.; Filatenko, A.A.; Pistrick, K. Taxonomic remarks on Triticum L. and ×Triticosecale Wittm. Genet. Resour. Crop Evol. 2011, 58, 3–10. [Google Scholar] [CrossRef]
- Gogniashvili, M.; Naskidashvili, P.; Bedoshvili, D.; Kotorashvili, A.; Kotaria, N.; Beridze, T. Complete chloroplast DNA sequences of Zanduri wheat (Triticum spp.). Genet. Resour. Crop Evol. 2015, 62, 1269–1277. [Google Scholar] [CrossRef]
- Beridze, T. The ‘Wheat Puzzle’ and Kartvelians route to the Caucasus. Genet. Resour. Crop Evol. 2019, 66, 921–927. [Google Scholar] [CrossRef]
- Pagel, M.; Atkinson, Q.D.; Calude, A.S.; Meade, A. Ultraconserved words point to deep language ancestry across Eurasia. Proc. Natl. Acad. Sci. USA 2013, 110, 8471–8476. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schaal, B.A.; Olsen, K.M. Gene genealogies and population variation in plants. Proc. Natl. Acad. Sci. USA 2000, 97, 7024–7029. [Google Scholar] [CrossRef] [Green Version]
- Yamane, K.; Kawahara, T. Intra- and interspecific phylogenetic relationships among diploid Triticum-Aegilops species (Poaceae) based on base-pair substitutions, indels, and microsatellites in chloroplast noncoding sequences. Am. J. Bot. 2005, 92, 1887–1898. [Google Scholar] [CrossRef]
- Matsuoka, Y.; Mori, N.; Kawahara, T. Genealogical use of chloroplast DNA variation for intraspecific studies of Aegilops tauschii Coss. Theor. Appl. Genet. 2005, 111, 265–271. [Google Scholar] [CrossRef]
- Tabidze, V.; Baramidze, G.; Pipia, I.; Gogniashvili, M.; Ujmajuridze, L.; Beridze, T.; Hernandez, A.G.; Schaal, B. The complete chloroplast DNA sequence of eleven grape cultivars. Simultaneous resequencing methodology. J. Int. Sci. Vigne Vin 2014, 48, 99–109. [Google Scholar] [CrossRef] [Green Version]
- Gogniashvili, M.; Maisaia, I.; Kotorashvili, A.; Kotaria, N.; Beridze, T. Complete chloroplast DNA sequences of Georgian indigenous polyploid wheats and B plasmon evolution. Genet. Resour. Crop Evol. 2018, 65, 1995–2002. [Google Scholar] [CrossRef]
- Gogniashvili, M.; Jinjikhadze, T.; Maisaia, I.; Akhalkatsi, M.; Kotorashvili, A.; Kotaria, N.; Beridze, T.; Dudnikov, A.Y. Complete chloroplast genomes of Aegilops tauschii Coss. and Ae.cylindrica Host sheds light on plasmon D evolution. Curr. Genet. 2016, 62, 791–798. [Google Scholar] [CrossRef]
- Morimoto, R.; Kosugi, T.; Nakamura, C.; Takumi, S. Intragenic diversity and functional conservation of the three homoeologous loci of the KN1-type homeobox gene Wknox1 in common wheat. Plant Mol. Biol. 2005, 57, 907–924. [Google Scholar] [CrossRef] [Green Version]
- Takumi, S.; Morimoto, R. Implications of an inverted duplication in the wheat KN1-type homeobox gene Wknox1 for the origin of Persian wheat. Genes Genet. Syst. 2015, 90, 115–120. [Google Scholar] [CrossRef] [Green Version]
- Dvorak, J.; Luo, M.C.; Yang, Z.L.; Zhang, H.B. The structure of the Aegilops tauschii genepool and the evolution of hexaploid wheat. Theor. Appl. Genet. 1998, 97, 657–670. [Google Scholar] [CrossRef]
- Schneider, A.; Molnar, I.; Molnar-Lang, M. Utilisation of Aegilops (goatgrass) species to widen the genetic diversity of cultivated wheat. Euphytica 2008, 163, 1–19. [Google Scholar] [CrossRef]
- Dubcovsky, J.; Dvorak, J. Genome plasticity a key factor in the success of polyploidy wheat under domestication. Science 2007, 316, 1862–1866. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, J.; Luo, M.-C.; Chen, Z.; You, F.M.; Wei, Y.; Zheng, Y.; Dvorak, J. Aegilops tauschii single nucleotide polymorphisms shed light on the origins of wheat D-genome genetic diversity and pinpoint the geographic origin of hexaploid wheat. New Phytol. 2013, 198, 925–937. [Google Scholar] [CrossRef]
- Jorgensen, C.; Luo, M.-C.; Ramasamy, R.; Dawson, M.; Gill, B.S.; Korol, A.B.; Distelfeld, A.; Dvorak, J. A high-density genetic map of wild emmer wheat from the Karaca Dağ region provides new evidence on the structure and evolution of wheat chromosomes. Front. Plant Sci. 2017, 8, 1798. [Google Scholar] [CrossRef] [Green Version]
- Allaby, R.G.; Stevens, C.; Lucas, L.; Maeda, O.; Fuller, D.Q. Geographic mosaics and changing rates of cereal domestication. Philos. Trans. R. Soc. B 2017, 372, 20160429. [Google Scholar] [CrossRef] [Green Version]
- Ketskhoveli, N. Plant guide book of Georgia. Metsniereba Edition; Metsniereba: Tbilisi, Georgia, 1969; Volume 2, p. 481. [Google Scholar]
- Kolakovskii, A. Flora of Abkhazia. Metsniereba Edition; Metsniereba: Tbilisi, Georgia, 1986; p. 164. [Google Scholar]
- Dekaprelevich, L.L.; Menabde, V.L. Spelt wheats of Western Georgia (Western Transcaucasia). Bull. Appl. Bot. Leningrad. 1932, 1, 3–46. [Google Scholar]
- Dorofeev, V.F.; Filatenko, A.A.; Migushova, E.F.; Udaczin, R.A.; Jakubziner, M.M. Wheat. In Flora of Cultivated Plants; Dorofeev, V.F., Korovina, O.N., Eds.; Leningrad: St. Petersburg, Russia, 1979; Volume 1, p. 346. (In Russian) [Google Scholar]
- Tsunewaki, K. Origin and phylogenetic differentiation of common wheat revealed by comparative gene analysis. In Third International Wheat Genetics; Finlay, K.W., Shepherd, K.W., Eds.; Australian Academy of Science: Canberra, Australia, 1968; pp. 71–85. [Google Scholar]
- Hirosawa, S.; Takumi, S.; Ishii, T.; Kawahara, T.; Nakamura, C.; Mori, N. Chloroplast and nuclear DNA variation in common wheat: Insight into the origin and evolution of common wheat. Genes Genet. Syst. 2004, 79, 271–282. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, A.; Liu, D.; Yang, W.; Kishii, M.; Mao, L. Synthetic Hexaploid Wheat: Yesterday, Today, and Tomorrow. Engineering 2018, 4, 552–558. [Google Scholar] [CrossRef]
- Liu, C.; Shi, Y.; Zhu, Y.; Chen, H.; Zhang, J.; Lin, X.; Guan, X. CpGAVAS, an integrated web server for the annotation, visualization, analysis, and GenBank submission of completely sequenced chloroplast genome sequences. BMC Genom. 2012, 13, 715. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Katoh, K.; Rozewicki, J.; Yamada, K.D. MAFFT online service: Multiple sequence alignment, interactive sequence choice and visualization. Brief Bioinform. 2019, 20, 1160–1166. [Google Scholar] [CrossRef] [Green Version]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
Species | Genome | Plasmon | |
---|---|---|---|
Hulled T. zhukovskyi | GGAuAuAmAm | G | |
Hulled T. aestivum | |||
T. aestivum subsp. spelta Thell. | BBAuAuDD | B | |
T. aestivum subsp. macha (Dekapr. and Menabde) Mackey | |||
T. aestivum subsp. vavilovii Jakubz. | |||
Free-threshing T. aestivum | T. aestivum subsp. aestivum | ||
T. aestivum subsp. compactum (Host) Mackey | |||
T. aestivum subsp. sphaerococcum (Percival) Mackey | |||
T. aestivum subsp. carthlicoides nom. nud. |
Congretio | Species | Distribution Areas | Habits |
---|---|---|---|
Hexaploidea | Cultivated hulled | ||
2n = 42 | T. zhukovskyi Men.et Er. | Georgia | Springness |
T. macha Dek.et Men. | Georgia | Winterness | |
T. spelta L. | Iran, south Germany, Spain | Winterness, Springness | |
Cultivated naked grain | |||
T. aestivum L. | All over the world | Springness, winterness, half winterness | |
T. compactum Host | Transcaucasia, Kazakhstan, Asia Minor, Afghan, Chile | Springness, winterness, half-winterness | |
T. vavilovii Jakubz. | Armenia | Winterness | |
T. sphaerococcum Perc. | Pakistan, India | Springness |
Botanical Name | GenBank Accession Number | ||
---|---|---|---|
Hulled | |||
M1 | Triticum aestivum L. subsp. macha (Dekapr. and Menabde) Mackey var. megrelicum (Menabde) | LC372826 | ISU |
M2 | Triticum aestivum L. subsp. macha (Dekapr. and Menabde) Mackey var. georgicum (Menabde) | LC373211 | ISU |
M3 | Triticum aestivum L. subsp. macha (Dekapr. and Menabde) Mackey var. colchicum (Dekapr. and Menabde) | LC375536 | ISU |
M4 | Triticum aestivum L. subsp. macha (Dekapr. and Menabde) Mackey var. scharaschidzei (Menabde) | LC374397 | ISU |
M5 | Triticum aestivum L. subsp. macha (Dekapr. and Menabde) Mackey var. palaeoimereticum (Dekapr. and Menabde) | LC375773 | ISU |
M6 | Triticum aestivum L. subsp. macha (Dekapr. and Menabde) Mackey var. palaeocolchicum (Dekapr. and Menabde) | NC_025955 | ISU |
M7 | Triticum aestivum L. subsp. macha (Dekapr. and Menabde) Mackey var. ericzjanae Menabde | ISU | |
M8 | Triticum aestivum L. subsp. macha (Dekapr. and Menabde) Mackey var. ibericum Dekapr. and Menabde | ISU | |
M9 | Triticum aestivum L. subsp. macha (Dekapr. and Menabde) Mackey var. letshchumicum Dekapr. and Menabde | ISU | |
M10 | Triticum aestivum L. subsp. macha (Dekapr. and Menabde) Mackey var. subcolchicum Dekapr. and Menabde | ISU | |
M11 | Triticum aestivum L. subsp. macha (Dekapr. and Menabde) Mackey var. submegrelicum Dekapr. and Menabde | ISU | |
M12 | Triticum aestivum L. subsp. macha (Dekapr. and Menabde) Mackey var. subletshchumicum Dekapr. and Menabde | ISU | |
Splt2 | Triticum aestivum L. subsp. spelta (L.) Thell. | LC625352 | PI 348000 |
Splt1 | Triticum aestivum L. subsp. spelta (L.) Thell. | LC625353 | PI 348220 |
Splt3 | Triticum aestivum L. subsp. spelta (L.) Thell. | LC625866 | PI 191393 |
Vav1 | Triticum vavilovii Jakubz. | LC621349 | PI 326319 |
Vav2 | Triticum vavilovii Jakubz. | LC625865 | PI 428342 |
Free-threshing | |||
RD | Triticum aestivum L. subsp. aestivum var. ferrugineum (Alef.) Mansf. cv. ‘Red Doly’ | LC377169 | ISU |
CS | Triticum aestivum L. subsp. aestivum cv. ‘Chinese Spring’ | LC622404 | |
Cc1 | Triticum aestivum L. subsp. carthlicoides nom. nud. | LC621350 | PI 262678 |
Cc3 | Triticum aestivum L. subsp. carthlicoides nom. nud. | LC621195 | SRCA |
Cc2 | Triticum aestivum L. subsp. carthlicoides nom. nud. | LC622405 | PI 532901 |
Cc4 | Triticum aestivum L. subsp. carthlicoides nom. nud. | LC621194 | SRCA |
Com2 | Triticum aestivum L. subsp. compactum (Host) Mackey | LC623766 | KU-9873 |
Com1 | Triticum aestivum L. subsp. compactum (Host) Mackey | LC623764 | ISU |
Sph1 | Triticum aestivum L. subsp. sphaerococcum (Percival) Mackey | LC623765 | Cltr17737 |
Nucleotide Position According to CS | Locus | CS | M6 | Vav1 | Cc2 | Cc1, Cc3, Cc4 | RD | Sph1 | M2, M3, M5 | M4 | M1 | Com1 | Com2 | Splt1 | Splt2 | Splt3 | Vav2 | Amino Acid Substitution |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
2903 | Gene matK | G | C | A–G | ||||||||||||||
3400 | Intergenic matK-trnK-UUU | C | A | A | A | A | ||||||||||||
4918 | Intron rps16 | T | C | |||||||||||||||
13,015 | Intergenic trnfM-CAT-trnT-GGT | T | C | C | C | C | ||||||||||||
14,580 | Intergenic trnfM-CAT-trnT-GGT | C | G | |||||||||||||||
15,371 | Intergenic trnY-GTA-trnD-GTC | A | G | G | G | G | ||||||||||||
16,481 | Intergenic trnD-GTC-psbM | C | T | T | T | T | ||||||||||||
20,853 | Gene rpoB | C | T | T | T | T | Syn | |||||||||||
25,444 | Gene rpoC2 | C | A | A | A | A | Syn | |||||||||||
32,710 | Intergenic atpH-atpF | C | T | |||||||||||||||
44,509 | Intergenic ycf3 trnS-GGA | C | A | |||||||||||||||
45,856 | Intergenic rps4-trnT-TGT | A | C | C | C | C | ||||||||||||
46,434 | Intergenic trnT-TGT trnF-GAA | G | T | T | T | T | ||||||||||||
47,628 | Intergenic trnT-TGT-trnF-GAA | G | A | A | G | G | G | G | ||||||||||
50,332 | Intergenic ndhC-trnM-CAT | G | T | T | T | T | ||||||||||||
50,716 | Intergenic ndhC-trnM-CAT | T | C | C | C | C | ||||||||||||
52,295 | Gene atpB | G | T | T | T | T | Q–K | |||||||||||
56,472 | Intergenic rbcL-psaI | A | G | G | G | G | G | |||||||||||
56,670 | Intergenic rbcL-psaI | C | T | T | T | T | ||||||||||||
63,289 | Gene petG | A | T | T | T | T | Syn | |||||||||||
64,318 | Intergenic psaJ-rpl33 | C | T | T | T | T | ||||||||||||
72,207 | Intergenic petB-petD | C | T | T | T | T | ||||||||||||
73,742 | Intergenic petD-rpoA | T | C | C | C | C | ||||||||||||
78,113 | Intron rpl16 | C | T | T | T | T | ||||||||||||
78,732 | Intergenic rpl16-rps3 | G | T | T | T | T | ||||||||||||
82,499 | Intergenic rpl23-trnI-CAT | T | G | |||||||||||||||
100,961 | Gene rps15 | T | G | Syn | ||||||||||||||
102,561 | Gene ndhF | C | T | T | T | Syn | ||||||||||||
104,993 | Intergenic rpl32-trnL-TAG | A | C | C | C | C | ||||||||||||
105,477 | Intergenic rpl32-trnL-TAG | C | A | A | A | A | ||||||||||||
106,672 | Gene ccsA | C | T | T | T | T | Syn | |||||||||||
113,487 | Gene ndhH | T | G | Syn | ||||||||||||||
114,943 | Gene rps15 | A | C | F–L | ||||||||||||||
133,405 | Intergenic trnI-CAT-rpl23 | A | C |
Nucleotide Position According to CS | Locus | CS | M6 | Vav1 | Cc2 | Cc1, Cc3, Cc4 | RD | Sph1 | M2, M3, M5 | M4 | M1 | Com2 | Com1 | Splt1 | Splt2 | Splt3 | Vav2 |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
4175 | Intergenic matK-rps16 | - | AAAAT | AAAAT | AAAAT | AAAAT | |||||||||||
7422 | Intergenic psbI-trnS-GCT | 15T | 18T | 12T | 12T | 12T | |||||||||||
8219 | Intergenic trnS-GCT-psbD | 10T | 11T | ||||||||||||||
8407 | Intergenic trnS-GCT-psbD | - | TATTTCT | ATTTCT | ATTTCT | ATTTCT | ATTTCT | ||||||||||
11,183 | Intergenic psbC-trnS-TGA | 14A | 13A | 13A | 13A | 13A | |||||||||||
17,991 | Intergenic petN-trnC-GCA | 10A | 11A | 11A | 11A | 11A | 11A | 11A | 11A | ||||||||
18,757 | Intergenic trnC-GCA-rpoB | 19C | 9C | 8C | 8C | ||||||||||||
31,609 | Intergenic atpI-atpH | 12T | 11T | ||||||||||||||
32,442 | Intergenic atpH-atpF | +A | +A | +A | +A | ||||||||||||
33,718 | IntronatpH | 14A | 13A | 13A | 13A | 13A | 12A | ||||||||||
42,920 | I intron ycf3 | 10T | 9T | 9T | 9T | ||||||||||||
42,931 | I intron ycf3 | 3T | 2T | ||||||||||||||
45,993 | Intergenic rps4-trnT-TGT | 8A | 9A | 9A | 9A | 9A | |||||||||||
47,788 | Intergenic trnF-GAA-ndhJ | 15A | 14A | 11A | 11A | 11A | 10A | ||||||||||
56,724 | Intergenic rbcL-psaI | 10T | 9T | ||||||||||||||
60,767 | Intergenic petA psbJ | +CATT | +CATT | +CATT | +CATT | ||||||||||||
60,773 | Intergenic petA-psbJ | 17T | 16T | 16T | 16T | 16T | 16T | 16T | 16T | 16T | 16T | 15T | 16T | ||||
62,041 | Intergenic psbE-petL | - | +TA | +TA | +TA | +TA | |||||||||||
Duplication_70,856 | Intron petB | TATT | TATT | TATT | TATT | ||||||||||||
71,219 | Intron petB | 6T | 7T | 7T | 7T | 7T | |||||||||||
73,586 | Intergenic petD-rpoA | 5T | 6T | 6T | 6T | 6T | |||||||||||
75,699 | Intergenic rpl36-infA | 10A | 11A | 11A | 11A | ||||||||||||
76,051-62_duplication | Intergenic infA-rps8 | CTGTCATATTTT | |||||||||||||||
76,599 | Intergenic rps8-rpl14 | 10T | 11T | 11T | 11T | 9T | 9T | 9T | |||||||||
77,140 | Intergenic rpl14-rpl16 | 10T | 9T | 9T | 9T | 9T | 9T | ||||||||||
86,581 | IntronndhB | 5T | 4T | ||||||||||||||
104,113 | Intergenic ndhF-rpl32 | 13A | 11A | 12A | 14A | ||||||||||||
129,319 | IntronndhB | 5A | 4A |
Nucleotide Position According to CS | Locus | Splt1, Splt2, Splt3, Vav2 | Length | |
---|---|---|---|---|
79,532 | Gene rpl22 | GATGGATCTAAAGGTTATTTAGATTTCTTTACTAT | Insertion | 35 bp |
105,139–105,196 | Intergenic rpl32—trnL-TAG | ACTTTTCATAATTTTCATAATAGAATCCT CATATTTTATTATGAAAATTATGAAAAGT | Inversion with 14 bp loop | 58 bp |
106,795–106,819 | Intergenic ccsA—ndhD | AAAACCTTCATGAAATGAAGGTTTT | Inversion with 3 bp loop | 25 bp |
135,896-52 | Intergenic rps19—psbA | AAAGACAGAAATACCCAATATCTTGCTA GAACAAGATATTGGGTATTTCTGTCTTT | Inversion with 6 bp loop | 56 bp |
Sample | PCR Product, bp | ||||
---|---|---|---|---|---|
277, 284 | 375 | 400 | 411 | 453 | |
Triticum aestivum subsp.aestivum cv. ‘Chinese Spring’ (CS) | + | + | + | ||
Triticum aestivum subsp. aestivum var. ferrugineum (Alef.) Mansf. cv. ‘Red Doly’ (RD) | + | + | + | ||
Triticum aestivum subsp. carthlicoides (Cc1, Cc2. Cc3. Cc4) | + | + | + | ||
Triticum aestivum subsp. compactum (Com2) | + | ||||
Triticum aestivum subsp. compactum (Com1) | + | + | + | ||
Triticum aestivum subsp. sphaerococcum (Sph1) | + | + | + | ||
Triticum aestivum subsp. macha (M6, M9) | + | + | + | ||
Triticum aestivum subsp. macha (M1, M2, M3, M4, M5, M7, M8 M10, M11, M12) | + | + | + | ||
Triticum aestivum subsp. spelta (splt1, splt2, splt3) | + | + | + | ||
Triticum vavilovii (Arm) (Vav1) | + | + | + | ||
Triticum vavilovii (Eur) (Vav2) | + | + | + | ||
Triticum turgidum subsp. carthlicum var. rubiginosum | + | ||||
Triticum turgidum subsp. durum cv. ‘Langdon’ (Ldn) | + |
Sample | PCR Product, bp | |||
---|---|---|---|---|
410 | 429, 430 | 560 | 588 | |
Triticum aestivum subsp.aestivum cv. ‘Chinese Spring’ (CS) | + | + | + | |
Triticum aestivum subsp. aestivum var. ferrugineum cv. ‘Red Doly’ (RD) | + | + | + | |
Triticum aestivum subsp. carthlicoides (Cc1, Cc2, Cc3, Cc4) | + | |||
Triticum aestivum subsp. compactum (Com2) | + | + | + | |
Triticum aestivum subsp. compactum (Com1) | + | |||
Triticum aestivum subsp. sphaerococcum (Sph1) | + | + | + | |
Triticum aestivum subsp. macha (M6, M9) | + | |||
Triticum aestivum subsp. macha (M1, M2, M3, M4, M5, M7, M 8, M10, M11, M12) | + | |||
Triticum aestivum subsp. spelta (splt1, splt2, splt3) | + | + | + | |
Triticum vavilovii (Arm) (Vav1) | + | + | ||
Triticum vavilovii (Eur) (Vav2) | + | + | + | |
Triticum turgidum subsp. carthlicum var. rubiginosum | + | |||
Triticum turgidum subsp. durum cv. ‘Langdon’ (Ldn) | + | + | + |
Triticum aestivum subsp. carthlicoides (Cc1, Cc2, Cc3, Cc4) |
Triticum aestivum subsp. compactum (Host) (Com1) |
Triticum aestivum subsp. macha (M6, M9) |
Triticum vavilovii (Arm) (Vav1) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gogniashvili, M.; Matsuoka, Y.; Beridze, T. Genetic Analysis of Hexaploid Wheat (Triticum aestivum L.) Using the Complete Sequencing of Chloroplast DNA and Haplotype Analysis of the Wknox1 Gene. Int. J. Mol. Sci. 2021, 22, 12723. https://doi.org/10.3390/ijms222312723
Gogniashvili M, Matsuoka Y, Beridze T. Genetic Analysis of Hexaploid Wheat (Triticum aestivum L.) Using the Complete Sequencing of Chloroplast DNA and Haplotype Analysis of the Wknox1 Gene. International Journal of Molecular Sciences. 2021; 22(23):12723. https://doi.org/10.3390/ijms222312723
Chicago/Turabian StyleGogniashvili, Mari, Yoshihiro Matsuoka, and Tengiz Beridze. 2021. "Genetic Analysis of Hexaploid Wheat (Triticum aestivum L.) Using the Complete Sequencing of Chloroplast DNA and Haplotype Analysis of the Wknox1 Gene" International Journal of Molecular Sciences 22, no. 23: 12723. https://doi.org/10.3390/ijms222312723