Pleiotropic Roles of NOTCH1 Signaling in the Loss of Maturational Arrest of Human Osteoarthritic Chondrocytes
Abstract
1. Introduction
2. Results
2.1. NOTCH1 Expression Is Higher in 2-D Compared to 3-D Chondrocyte Culture
2.2. NOTCH1 Transient Silencing Is Efficient at Both Protein and RNA Level
2.3. NOTCH1 KD Determines Biphasic Effects on Cell Proliferation
2.4. NOTCH1 KD Determines a Delayed Differentiation in 3-D Culture
2.4.1. Reduced Transcription of Differentiation Related Genes
2.4.2. Reduced Expression of RUNX2 Protein and Reduced Deposition of Glycosaminoglycan and Calcium
2.4.3. Reduced Release of Matrix Remodeling Enzymes
2.4.4. Reduced Terminal Differentiation and Increased Viability
3. Discussion
4. Materials and Methods
4.1. Establishment of Chondrocyte Cultures
4.2. Small Interfering RNA Mediated NOTCH1 Gene Silencing
4.3. Cell Cycle Assessment
4.4. Chondrocyte Cultures
4.5. PicoGreen Assessment of Cell Growth
4.6. Western Blot
4.7. Immunofluorescence and Immunohistochemistry
4.8. MMPs Quantitative Assessment
4.9. Evaluation of Progressed Chondrocyte Terminal Differentiation/Cell Viability
4.10. Real-Time RT-PCR Analysis
4.11. Statistics
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Jafarzadeh, S.R.; Felson, D.T. Updated Estimates Suggest a Much Higher Prevalence of Arthritis in United States Adults Than Previous Ones. Arthritis Rheumatol. 2018, 70, 185–192. [Google Scholar] [CrossRef]
- Li, Z.; Huang, Z.; Bai, L. Cell Interplay in Osteoarthritis. Front. Cell Dev. Biol. 2021, 9, 720477. [Google Scholar] [CrossRef]
- Van der Kraan, P.M.; van den Berg, W.B. Osteoarthritis in the context of ageing and evolution. Loss of chondrocyte differentiation block during ageing. Ageing Res. Rev. 2008, 7, 106–113. [Google Scholar] [CrossRef]
- Aigner, T.; Gerwin, N. Growth plate cartilage as developmental model in osteoarthritis research--potentials and limitations. Curr. Drug Targets 2007, 8, 377–385. [Google Scholar] [CrossRef]
- D’Adamo, S.; Cetrullo, S.; Panichi, V.; Mariani, E.; Flamigni, F.; Borzi, R.M. Nutraceutical Activity in Osteoarthritis Biology: A Focus on the Nutrigenomic Role. Cells 2020, 9, 1232. [Google Scholar] [CrossRef]
- Green, J.D.; Tollemar, V.; Dougherty, M.; Yan, Z.; Yin, L.; Ye, J.; Collier, Z.; Mohammed, M.K.; Haydon, R.C.; Luu, H.H.; et al. Multifaceted signaling regulators of chondrogenesis: Implications in cartilage regeneration and tissue engineering. Genes Dis. 2015, 2, 307–327. [Google Scholar] [CrossRef] [PubMed]
- Zanotti, S.; Canalis, E. Notch Signaling and the Skeleton. Endocr. Rev. 2016, 37, 223–253. [Google Scholar] [CrossRef] [PubMed]
- Saito, T.; Tanaka, S. Molecular mechanisms underlying osteoarthritis development: Notch and NF-kappaB. Arthritis Res. Ther. 2017, 19, 94. [Google Scholar] [CrossRef]
- Ottaviani, S.; Tahiri, K.; Frazier, A.; Hassaine, Z.N.; Dumontier, M.F.; Baschong, W.; Rannou, F.; Corvol, M.T.; Savouret, J.F.; Richette, P. Hes1, a new target for interleukin 1beta in chondrocytes. Ann. Rheum. Dis. 2010, 69, 1488–1494. [Google Scholar] [CrossRef]
- Long, F.; Ornitz, D.M. Development of the endochondral skeleton. Cold Spring Harb. Perspect. Biol. 2013, 5, a008334. [Google Scholar] [CrossRef]
- Mirando, A.J.; Liu, Z.; Moore, T.; Lang, A.; Kohn, A.; Osinski, A.M.; O’Keefe, R.J.; Mooney, R.A.; Zuscik, M.J.; Hilton, M.J. RBP-Jkappa-dependent Notch signaling is required for murine articular cartilage and joint maintenance. Arthritis Rheum. 2013, 65, 2623–2633. [Google Scholar] [PubMed]
- Ustunel, I.; Ozenci, A.M.; Sahin, Z.; Ozbey, O.; Acar, N.; Tanriover, G.; Celik-Ozenci, C.; Demir, R. The immunohistochemical localization of notch receptors and ligands in human articular cartilage, chondroprogenitor culture and ultrastructural characteristics of these progenitor cells. Acta Histochem. 2008, 110, 397–407. [Google Scholar] [CrossRef] [PubMed]
- Grogan, S.P.; Miyaki, S.; Asahara, H.; D’Lima, D.D.; Lotz, M.K. Mesenchymal progenitor cell markers in human articular cartilage: Normal distribution and changes in osteoarthritis. Arthritis Res. Ther. 2009, 11, R85. [Google Scholar] [CrossRef]
- Guan, Y.J.; Li, J.; Yang, X.; Du, S.; Ding, J.; Gao, Y.; Zhang, Y.; Yang, K.; Chen, Q. Evidence that miR-146a attenuates aging- and trauma-induced osteoarthritis by inhibiting Notch1, IL-6, and IL-1 mediated catabolism. Aging Cell 2018, 17, e12752. [Google Scholar] [CrossRef]
- Hosaka, Y.; Saito, T.; Sugita, S.; Hikata, T.; Kobayashi, H.; Fukai, A.; Taniguchi, Y.; Hirata, M.; Akiyama, H.; Chung, U.I.; et al. Notch signaling in chondrocytes modulates endochondral ossification and osteoarthritis development. Proc. Natl. Acad. Sci. USA 2013, 110, 1875–1880. [Google Scholar] [CrossRef]
- Karlsson, C.; Brantsing, C.; Egell, S.; Lindahl, A. Notch1, Jagged1, and HES5 are abundantly expressed in osteoarthritis. Cells Tissues Organs 2008, 188, 287–298. [Google Scholar] [CrossRef]
- Lin, N.Y.; Distler, A.; Beyer, C.; Philipi-Schobinger, A.; Breda, S.; Dees, C.; Stock, M.; Tomcik, M.; Niemeier, A.; Dell’Accio, F.; et al. Inhibition of Notch1 promotes hedgehog signalling in a HES1-dependent manner in chondrocytes and exacerbates experimental osteoarthritis. Ann. Rheum. Dis. 2016, 75, 2037–2044. [Google Scholar] [CrossRef]
- Culley, K.L.; Dragomir, C.L.; Chang, J.; Wondimu, E.B.; Coico, J.; Plumb, D.A.; Otero, M.; Goldring, M.B. Mouse models of osteoarthritis: Surgical model of posttraumatic osteoarthritis induced by destabilization of the medial meniscus. Methods Mol. Biol. 2015, 1226, 143–173. [Google Scholar] [PubMed]
- Glasson, S.S.; Blanchet, T.J.; Morris, E.A. The surgical destabilization of the medial meniscus (DMM) model of osteoarthritis in the 129/SvEv mouse. Osteoarthr. Cartil. 2007, 15, 1061–1069. [Google Scholar] [CrossRef]
- Johnston, D.A.; Dong, B.; Hughes, C.C. TNF induction of jagged-1 in endothelial cells is NFkappaB-dependent. Gene 2009, 435, 36–44. [Google Scholar] [CrossRef]
- Gardiner, M.D.; Vincent, T.L.; Driscoll, C.; Burleigh, A.; Bou-Gharios, G.; Saklatvala, J.; Nagase, H.; Chanalaris, A. Transcriptional analysis of micro-dissected articular cartilage in post-traumatic murine osteoarthritis. Osteoarthr. Cartil. 2015, 23, 616–628. [Google Scholar] [CrossRef] [PubMed]
- Shang, X.; Wang, J.; Luo, Z.; Wang, Y.; Morandi, M.M.; Marymont, J.V.; Hilton, M.J.; Dong, Y. Notch signaling indirectly promotes chondrocyte hypertrophy via regulation of BMP signaling and cell cycle arrest. Sci. Rep. 2016, 6, 25594. [Google Scholar] [CrossRef]
- Sugita, S.; Hosaka, Y.; Okada, K.; Mori, D.; Yano, F.; Kobayashi, H.; Taniguchi, Y.; Mori, Y.; Okuma, T.; Chang, S.H.; et al. Transcription factor Hes1 modulates osteoarthritis development in cooperation with calcium/calmodulin-dependent protein kinase 2. Proc. Natl. Acad. Sci. USA 2015, 112, 3080–3085. [Google Scholar] [CrossRef]
- Liu, Z.; Chen, J.; Mirando, A.J.; Wang, C.; Zuscik, M.J.; O’Keefe, R.J.; Hilton, M.J. A dual role for NOTCH signaling in joint cartilage maintenance and osteoarthritis. Sci. Signal. 2015, 8, ra71. [Google Scholar] [CrossRef] [PubMed]
- Blaise, R.; Mahjoub, M.; Salvat, C.; Barbe, U.; Brou, C.; Corvol, M.T.; Savouret, J.F.; Rannou, F.; Berenbaum, F.; Bausero, P. Involvement of the Notch pathway in the regulation of matrix metalloproteinase 13 and the dedifferentiation of articular chondrocytes in murine cartilage. Arthritis Rheum. 2009, 60, 428–439. [Google Scholar] [CrossRef]
- Xiao, D.; Bi, R.; Liu, X.; Mei, J.; Jiang, N.; Zhu, S. Notch Signaling Regulates MMP-13 Expression via Runx2 in Chondrocytes. Sci. Rep. 2019, 9, 15596. [Google Scholar] [CrossRef]
- Sassi, N.; Gadgadi, N.; Laadhar, L.; Allouche, M.; Mourali, S.; Zandieh-Doulabi, B.; Hamdoun, M.; Nulend, J.K.; Makni, S.; Sellami, S. Notch signaling is involved in human articular chondrocytes de-differentiation during osteoarthritis. J. Recept. Signal Transduct. Res. 2014, 34, 48–57. [Google Scholar] [CrossRef]
- Minguzzi, M.; Panichi, V.; Cattini, L.; Filardo, G.; Mariani, E.; Borzì, R. Effects of notch-1 knockdown on the proliferation and the differentiation of human osteoarthritis chondrocytes. Osteoarthr. Cartil. 2018, 26, S110–S111. [Google Scholar] [CrossRef]
- Olivotto, E.; Borzi, R.M.; Vitellozzi, R.; Pagani, S.; Facchini, A.; Battistelli, M.; Penzo, M.; Li, X.; Flamigni, F.; Li, J.; et al. Differential requirements for IKKalpha and IKKbeta in the differentiation of primary human osteoarthritic chondrocytes. Arthritis Rheum. 2008, 58, 227–239. [Google Scholar] [CrossRef]
- Guidotti, S.; Minguzzi, M.; Platano, D.; Cattini, L.; Trisolino, G.; Mariani, E.; Borzi, R.M. Lithium Chloride Dependent Glycogen Synthase Kinase 3 Inactivation Links Oxidative DNA Damage, Hypertrophy and Senescence in Human Articular Chondrocytes and Reproduces Chondrocyte Phenotype of Obese Osteoarthritis Patients. PLoS ONE 2015, 10, e0143865. [Google Scholar] [CrossRef]
- Lei, Y.; Guanghui, Z.; Xi, W.; Yingting, W.; Xialu, L.; Fangfang, Y.; Goldring, M.B.; Xiong, G.; Lammi, M.J. Cellular responses to T-2 toxin and/or deoxynivalenol that induce cartilage damage are not specific to chondrocytes. Sci. Rep. 2017, 7, 2231. [Google Scholar] [CrossRef]
- Alabi, R.O.; Lora, J.; Celen, A.B.; Maretzky, T.; Blobel, C.P. Analysis of the Conditions That Affect the Selective Processing of Endogenous Notch1 by ADAM10 and ADAM17. Int. J. Mol. Sci. 2021, 22, 1846. [Google Scholar] [CrossRef]
- Lee, C.R.; Park, Y.H.; Kim, Y.R.; Peterkofsky, A.; Seok, Y. Phosphorylation-Dependent Mobility Shift of Proteins on SDS-PAGE is Due to Decreased Binding of SDS. Bull. Korean Chem. Soc. 2013, 34, 2063–2066. [Google Scholar] [CrossRef]
- Lee, H.J.; Kim, M.Y.; Park, H.S. Phosphorylation-dependent regulation of Notch1 signaling: The fulcrum of Notch1 signaling. BMB Rep. 2015, 48, 431–437. [Google Scholar] [CrossRef]
- Bartlett, D.W.; Davis, M.E. Insights into the kinetics of siRNA-mediated gene silencing from live-cell and live-animal bioluminescent imaging. Nucleic Acids Res. 2006, 34, 322–333. [Google Scholar] [CrossRef] [PubMed]
- Sarmento, L.M.; Huang, H.; Limon, A.; Gordon, W.; Fernandes, J.; Tavares, M.J.; Miele, L.; Cardoso, A.A.; Classon, M.; Carlesso, N. Notch1 modulates timing of G1-S progression by inducing SKP2 transcription and p27 Kip1 degradation. J. Exp. Med. 2005, 202, 157–168. [Google Scholar] [CrossRef] [PubMed]
- Murata, K.; Hattori, M.; Hirai, N.; Shinozuka, Y.; Hirata, H.; Kageyama, R.; Sakai, T.; Minato, N. Hes1 directly controls cell proliferation through the transcriptional repression of p27Kip1. Mol. Cell Biol. 2005, 25, 4262–4271. [Google Scholar] [CrossRef] [PubMed]
- Eglen, R.M.; Randle, D.H. Drug Discovery Goes Three-Dimensional: Goodbye to Flat High-Throughput Screening? Assay Drug Dev. Technol. 2015, 13, 262–265. [Google Scholar] [CrossRef]
- Balistreri, C.R.; Madonna, R.; Melino, G.; Caruso, C. The emerging role of Notch pathway in ageing: Focus on the related mechanisms in age-related diseases. Ageing Res. Rev. 2016, 29, 50–65. [Google Scholar] [CrossRef] [PubMed]
- Oeckinghaus, A.; Ghosh, S. The NF-kappaB family of transcription factors and its regulation. Cold Spring Harb. Perspect Biol. 2009, 1, a000034. [Google Scholar] [CrossRef]
- Goldring, M.B.; Otero, M.; Plumb, D.A.; Dragomir, C.; Favero, M.; El Hachem, K.; Hashimoto, K.; Roach, H.I.; Olivotto, E.; Borzi, R.M.; et al. Roles of inflammatory and anabolic cytokines in cartilage metabolism: Signals and multiple effectors converge upon MMP-13 regulation in osteoarthritis. Eur. Cell Mater. 2011, 21, 202–220. [Google Scholar] [CrossRef] [PubMed]
- Troeberg, L.; Nagase, H. Proteases involved in cartilage matrix degradation in osteoarthritis. Biochim. Biophys. Acta 2012, 1824, 133–145. [Google Scholar] [CrossRef]
- Ulivi, V.; Giannoni, P.; Gentili, C.; Cancedda, R.; Descalzi, F. p38/NF-kB-dependent expression of COX-2 during differentiation and inflammatory response of chondrocytes. J. Cell Biochem. 2008, 104, 1393–1406. [Google Scholar] [CrossRef] [PubMed]
- Ruscitto, A.; Scarpa, V.; Morel, M.; Pylawka, S.; Shawber, C.J.; Embree, M.C. Notch Regulates Fibrocartilage Stem Cell Fate and Is Upregulated in Inflammatory TMJ Arthritis. J. Dent. Res. 2020, 99, 1174–1181. [Google Scholar] [CrossRef]
- Kohn, A.; Dong, Y.; Mirando, A.J.; Jesse, A.M.; Honjo, T.; Zuscik, M.J.; O’Keefe, R.J.; Hilton, M.J. Cartilage-specific RBPjkappa-dependent and -independent Notch signals regulate cartilage and bone development. Development 2012, 139, 1198–1212. [Google Scholar] [CrossRef]
- Jakob, M.; Demarteau, O.; Schafer, D.; Stumm, M.; Heberer, M.; Martin, I. Enzymatic digestion of adult human articular cartilage yields a small fraction of the total available cells. Connect. Tissue Res. 2003, 44, 173–180. [Google Scholar] [CrossRef]
- Kolettas, E.; Buluwela, L.; Bayliss, M.T.; Muir, H.I. Expression of cartilage-specific molecules is retained on long-term culture of human articular chondrocytes. J. Cell Sci. 1995, 108, 1991–1999. [Google Scholar] [CrossRef]
- Rani, A.; Greenlaw, R.; Smith, R.A.; Galustian, C. HES1 in immunity and cancer. Cytokine Growth Factor Rev. 2016, 30, 113–117. [Google Scholar] [CrossRef]
- Pfeuty, B. A computational model for the coordination of neural progenitor self-renewal and differentiation through Hes1 dynamics. Development 2015, 142, 477–485. [Google Scholar] [CrossRef]
- Giovannini, C.; Gramantieri, L.; Minguzzi, M.; Fornari, F.; Chieco, P.; Grazi, G.L.; Bolondi, L. CDKN1C/P57 is regulated by the Notch target gene Hes1 and induces senescence in human hepatocellular carcinoma. Am. J. Pathol. 2012, 181, 413–422. [Google Scholar] [CrossRef]
- Karlsson, C.; Jonsson, M.; Asp, J.; Brantsing, C.; Kageyama, R.; Lindahl, A. Notch and HES5 are regulated during human cartilage differentiation. Cell Tissue Res. 2007, 327, 539–551. [Google Scholar] [CrossRef]
- Khan, I.M.; Palmer, E.A.; Archer, C.W. Fibroblast growth factor-2 induced chondrocyte cluster formation in experimentally wounded articular cartilage is blocked by soluble Jagged-1. Osteoarthr. Cartil. 2010, 18, 208–219. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Wang, S.; Kawashima, N.; Sakamoto, K.; Katsube, K.; Umezawa, A.; Suda, H. Osteogenic differentiation of mouse mesenchymal progenitor cell, Kusa-A1 is promoted by mammalian transcriptional repressor Rbpj. Biochem. Biophys. Res. Commun. 2010, 400, 39–45. [Google Scholar] [CrossRef] [PubMed]
- Caron, M.M.; Emans, P.J.; Coolsen, M.M.; Voss, L.; Surtel, D.A.; Cremers, A.; van Rhijn, L.W.; Welting, T.J. Redifferentiation of dedifferentiated human articular chondrocytes: Comparison of 2D and 3D cultures. Osteoarthr. Cartil. 2012, 20, 1170–1178. [Google Scholar] [CrossRef] [PubMed]
- Otero, M.; Favero, M.; Dragomir, C.; Hachem, K.E.; Hashimoto, K.; Plumb, D.A.; Goldring, M.B. Human chondrocyte cultures as models of cartilage-specific gene regulation. Methods Mol. Biol. 2012, 806, 301–336. [Google Scholar]
- Battistelli, M.; Borzi, R.M.; Olivotto, E.; Vitellozzi, R.; Burattini, S.; Facchini, A.; Falcieri, E. Cell and matrix morpho-functional analysis in chondrocyte micromasses. Microsc. Res. Tech. 2005, 67, 286–295. [Google Scholar] [CrossRef]
- Sandell, L.J.; Aigner, T. Articular cartilage and changes in arthritis. An introduction: Cell biology of osteoarthritis. Arthritis Res. 2001, 3, 107–113. [Google Scholar] [CrossRef] [PubMed]
- Drissi, H.; Zuscik, M.; Rosier, R.; O’Keefe, R. Transcriptional regulation of chondrocyte maturation: Potential involvement of transcription factors in OA pathogenesis. Mol. Aspects Med. 2005, 26, 169–179. [Google Scholar] [CrossRef] [PubMed]
- Borzi, R.M.; Olivotto, E.; Pagani, S.; Vitellozzi, R.; Neri, S.; Battistelli, M.; Falcieri, E.; Facchini, A.; Flamigni, F.; Penzo, M.; et al. Matrix metalloproteinase 13 loss associated with impaired extracellular matrix remodeling disrupts chondrocyte differentiation by concerted effects on multiple regulatory factors. Arthritis Rheum. 2010, 62, 2370–2381. [Google Scholar] [CrossRef]
- Olivotto, E.; Otero, M.; Astolfi, A.; Platano, D.; Facchini, A.; Pagani, S.; Flamigni, F.; Goldring, M.B.; Borzi, R.M.; Marcu, K.B. IKKalpha/CHUK regulates extracellular matrix remodeling independent of its kinase activity to facilitate articular chondrocyte differentiation. PLoS ONE 2013, 8, e73024. [Google Scholar] [CrossRef]
- Guidotti, S.; Minguzzi, M.; Platano, D.; Santi, S.; Trisolino, G.; Filardo, G.; Mariani, E.; Borzi, R.M. Glycogen Synthase Kinase-3beta Inhibition Links Mitochondrial Dysfunction, Extracellular Matrix Remodelling and Terminal Differentiation in Chondrocytes. Sci. Rep. 2017, 7, 12059. [Google Scholar] [CrossRef]
- Zanotti, S.; Canalis, E. Interleukin 6 mediates selected effects of Notch in chondrocytes. Osteoarthr. Cartil. 2013, 21, 1766–1773. [Google Scholar] [CrossRef]
- Philipot, D.; Guerit, D.; Platano, D.; Chuchana, P.; Olivotto, E.; Espinoza, F.; Dorandeu, A.; Pers, Y.M.; Piette, J.; Borzi, R.M.; et al. p16INK4a and its regulator miR-24 link senescence and chondrocyte terminal differentiation-associated matrix remodeling in osteoarthritis. Arthritis Res. Ther. 2014, 16, R58. [Google Scholar] [CrossRef]
- Barksby, H.E.; Milner, J.M.; Patterson, A.M.; Peake, N.J.; Hui, W.; Robson, T.; Lakey, R.; Middleton, J.; Cawston, T.E.; Richards, C.D.; et al. Matrix metalloproteinase 10 promotion of collagenolysis via procollagenase activation: Implications for cartilage degradation in arthritis. Arthritis Rheum. 2006, 54, 3244–3253. [Google Scholar] [CrossRef]
- Martel-Pelletier, J.; Raynauld, J.P.; Mineau, F.; Abram, F.; Paiement, P.; Delorme, P.; Pelletier, J.P. Levels of serum biomarkers from a two-year multicentre trial are associated with treatment response on knee osteoarthritis cartilage loss as assessed by magnetic resonance imaging: An exploratory study. Arthritis Res. Ther. 2017, 19, 169. [Google Scholar] [CrossRef] [PubMed]
- Marcu, K.B.; Otero, M.; Olivotto, E.; Borzi, R.M.; Goldring, M.B. NF-kappaB signaling: Multiple angles to target OA. Curr. Drug Targets 2010, 11, 599–613. [Google Scholar] [CrossRef]
- Pagani, S.; Minguzzi, M.; Sicuro, L.; Veronesi, F.; Santi, S.; Scotto D’Abusco, A.; Fini, M.; Borzi, R.M. The N-Acetyl Phenylalanine Glucosamine Derivative Attenuates the Inflammatory/Catabolic Environment in a Chondrocyte-Synoviocyte Co-Culture System. Sci. Rep. 2019, 9, 13603. [Google Scholar] [CrossRef]
- Veronesi, F.; Giavaresi, G.; Maglio, M.; Scotto d‘Abusco, A.; Politi, L.; Scandurra, R.; Olivotto, E.; Grigolo, B.; Borzi, R.M.; Fini, M. Chondroprotective activity of N-acetyl phenylalanine glucosamine derivative on knee joint structure and inflammation in a murine model of osteoarthritis. Osteoarthr. Cartil. 2017, 25, 589–599. [Google Scholar] [CrossRef] [PubMed]
- Zandi, E.; Rothwarf, D.M.; Delhase, M.; Hayakawa, M.; Karin, M. The IkappaB kinase complex (IKK) contains two kinase subunits, IKKalpha and IKKbeta, necessary for IkappaB phosphorylation and NF-kappaB activation. Cell 1997, 91, 243–252. [Google Scholar] [CrossRef]
- Anest, V.; Hanson, J.L.; Cogswell, P.C.; Steinbrecher, K.A.; Strahl, B.D.; Baldwin, A.S. A nucleosomal function for IkappaB kinase-alpha in NF-kappaB-dependent gene expression. Nature 2003, 423, 659–663. [Google Scholar] [CrossRef] [PubMed]
- Yamamoto, Y.; Verma, U.N.; Prajapati, S.; Kwak, Y.T.; Gaynor, R.B. Histone H3 phosphorylation by IKK-alpha is critical for cytokine-induced gene expression. Nature 2003, 423, 655–659. [Google Scholar] [CrossRef] [PubMed]
- Hao, L.; Rizzo, P.; Osipo, C.; Pannuti, A.; Wyatt, D.; Cheung, L.W.; Sonenshein, G.; Osborne, B.A.; Miele, L. Notch-1 activates estrogen receptor-alpha-dependent transcription via IKKalpha in breast cancer cells. Oncogene 2010, 29, 201–213. [Google Scholar] [CrossRef] [PubMed]
- Song, L.L.; Peng, Y.; Yun, J.; Rizzo, P.; Chaturvedi, V.; Weijzen, S.; Kast, W.M.; Stone, P.J.; Santos, L.; Loredo, A.; et al. Notch-1 associates with IKKalpha and regulates IKK activity in cervical cancer cells. Oncogene 2008, 27, 5833–5844. [Google Scholar] [CrossRef] [PubMed]
- Zhao, G.; Zhang, H. Notch-1 siRNA and Methotrexate towards a Multifunctional Approach in Rhematoid Arthritis Management: A Nanomedicine Approach. Pharm. Res. 2018, 35, 123. [Google Scholar] [CrossRef]
- Cavallo, C.; Merli, G.; Borzi, R.M.; Zini, N.; D’Adamo, S.; Guescini, M.; Grigolo, B.; di Martino, A.; Santi, S.; Filardo, G. Small Extracellular Vesicles from adipose derived stromal cells significantly attenuate in vitro the NF-kappaB dependent inflammatory/catabolic environment of osteoarthritis. Sci. Rep. 2021, 11, 1053. [Google Scholar] [CrossRef]
- Finger, F.; Schorle, C.; Zien, A.; Gebhard, P.; Goldring, M.B.; Aigner, T. Molecular phenotyping of human chondrocyte cell lines T/C-28a2, T/C-28a4, and C-28/I2. Arthritis Rheum. 2003, 48, 3395–3403. [Google Scholar] [CrossRef]
- Gupta-Rossi, N.; le Bail, O.; Gonen, H.; Brou, C.; Logeat, F.; Six, E.; Ciechanover, A.; Israel, A. Functional interaction between SEL-10, an F-box protein, and the nuclear form of activated Notch1 receptor. J. Biol. Chem. 2001, 276, 34371–34378. [Google Scholar] [CrossRef]







| Gene | Forward Primer | Reverse Primer | Amplicon Size |
|---|---|---|---|
| (Annealing T) | |||
| GAPDH | TGGTATCGTGGAAGGACTCA | GCAGGGATGAGTTCTGGA | 123 bp (56 °C) |
| NOTCH1 | CCTGAAGAACGGGGCTAACA | GATGTCCCGGTTGGCAAAGT | 127 bp (60 °C) |
| HES1 | AAGAAAGATAGCTCGCGGCA | TACTTCCCCAGCACACTTGG | 134 bp (60 °C) |
| ADAMTS5 | GCACTTCAGCCACCATCAC | AGGCGAGCACAGACATCC | 187 bp (58 °C) |
| MMP-13 | TCACGATGGCATTGCT | GCCGGTGTAGGTGTAGA | 277 bp (58 °C) |
| ACAN | TCGAGGACAGCGAGGCC | TCGAGGGTGTAGCGTGTAGAGA | 85 bp (60 °C) |
| RUNX2 | GGAATGCCTCTGCTGTTATG | AGACGGTTATGGTCAAGGTG | 105 bp (58 °C) |
| NFKB1 | CAGGAGACGTGAAGATGCTG | AGTTGAGAATGAAGGTGGATGA | 109 bp (60 °C) |
| CHUK (IKKα) | GCACAGAGATGGTGAAAATCATTG | CAACTTGCTCAAATGACCAAACAG | 86 bp (60 °C) |
| IL6 | TAGTGAGGAACAAGCCAGAG | GCGCAGAATGAGATGAGTTG | 184 bp (60 °C) |
| IL8 | CCAAACCTTTCCACCC | ACTTCTCCACAACCCT | 153 bp (60 °C) |
| VEGFA | TGATGATTCTGCCCTCCTC | GCCTTGCCTTGCTGCTC | 82 bp (58 °C) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Minguzzi, M.; Panichi, V.; D’Adamo, S.; Cetrullo, S.; Cattini, L.; Flamigni, F.; Mariani, E.; Borzì, R.M. Pleiotropic Roles of NOTCH1 Signaling in the Loss of Maturational Arrest of Human Osteoarthritic Chondrocytes. Int. J. Mol. Sci. 2021, 22, 12012. https://doi.org/10.3390/ijms222112012
Minguzzi M, Panichi V, D’Adamo S, Cetrullo S, Cattini L, Flamigni F, Mariani E, Borzì RM. Pleiotropic Roles of NOTCH1 Signaling in the Loss of Maturational Arrest of Human Osteoarthritic Chondrocytes. International Journal of Molecular Sciences. 2021; 22(21):12012. https://doi.org/10.3390/ijms222112012
Chicago/Turabian StyleMinguzzi, Manuela, Veronica Panichi, Stefania D’Adamo, Silvia Cetrullo, Luca Cattini, Flavio Flamigni, Erminia Mariani, and Rosa Maria Borzì. 2021. "Pleiotropic Roles of NOTCH1 Signaling in the Loss of Maturational Arrest of Human Osteoarthritic Chondrocytes" International Journal of Molecular Sciences 22, no. 21: 12012. https://doi.org/10.3390/ijms222112012
APA StyleMinguzzi, M., Panichi, V., D’Adamo, S., Cetrullo, S., Cattini, L., Flamigni, F., Mariani, E., & Borzì, R. M. (2021). Pleiotropic Roles of NOTCH1 Signaling in the Loss of Maturational Arrest of Human Osteoarthritic Chondrocytes. International Journal of Molecular Sciences, 22(21), 12012. https://doi.org/10.3390/ijms222112012

