Comparison of the Effects of Resveratrol and Its Derivatives on the Radiation Response of MCF-7 Breast Cancer Cells
Abstract
:1. Introduction
2. Results
2.1. Cell Viability
2.2. Apoptosis
2.3. Apoptotic Gene Expression
2.4. Western Blot Analysis
2.5. Antioxidant Enzyme Activities
2.5.1. Catalase
2.5.2. Superoxide Dismutase
2.5.3. Glutathione Peroxidases
3. Discussion
4. Materials and Methods
4.1. Cell Line
4.2. Chemicals and Reagents
4.3. Cytotoxicity Assays Using the MTT Test
4.4. Detection of Apoptosis and Necrosis by Flow Cytometry
4.5. Antioxidant Enzyme Activity Assay
Preparation of Cell Lysates
4.6. Gene Expression Analysis by Real-Time PCR
4.7. Cell Lysate and Immunoblotting
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bray, F.; Ferlay, J.; Soerjomataram, I.; Siegel, R.L.; Torre, L.A.; Jemal, A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2018, 68, 394–424. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rastelli, F.; Crispino, S. Factors Predictive of Responsa to hormone therapy in breast cancer. Tumori 2008, 94, 370–383. [Google Scholar] [CrossRef]
- Nair, C.K.; Parida, D.K.; Nomura, T. Radioprotectors in radiotherapy. J. Radiat. Res. 2001, 42, 21–37. [Google Scholar] [CrossRef] [PubMed]
- Garg, A.K.; Buchholz, T.A.; Aggarwal, B.B. Chemosensitization and radiosensitization of tumors by plant polyphenols. Antioxid. Redox Signal. 2005, 7, 1630–1647. [Google Scholar] [CrossRef]
- Hazra, B.; Ghosh, S.; Kumar, A.; Pandey, B.N. The prospective role of plant products in radiotherapy of cancer: A current overview. Front. Pharm. 2012, 2, 94. [Google Scholar] [CrossRef] [Green Version]
- Niedzwiecki, A.; Roomi, M.W.; Kalinovsky, T.; Rath, M. Anticancer efficacy of polyphenols and their combinations. Nutrients 2016, 8, 552. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Abbaszadeh, H.; Keikhaei, B.; Mottaghi, S. A review of molecular mechanisms involved in anticancer and antiangiogenic effects of natural polyphenolic compounds. Phytother. Res. 2019, 33, 2002–2014. [Google Scholar] [CrossRef] [PubMed]
- Delmas, D.; Aires, V.; Limagne, E.; Dutartre, P.; Mazué, F.; Ghiringhelli, F.; Latruffe, N. Transport, stability, and biological activity of resveratrol. Ann. N. Y. Acad. Sci. 2011, 1215, 48–59. [Google Scholar] [CrossRef]
- Delmas, D.; Lançon, A.; Colin, D.; Jannin, B.; Latruffe, N. Resveratrol as a chemopreventive agent: A promising molecule for fighting cancer. Curr. Drug Targets 2006, 7, 423–442. [Google Scholar] [CrossRef] [PubMed]
- Gerszon, J.; Rodacka, A.; Puchała, M. Antioxidant properties of resveratrol and its protective effects in neurodegenerative diseases. Adv. Cell Biol. 2014, 4, 97–117. [Google Scholar] [CrossRef] [Green Version]
- Regev-Shoshani, G.; Shoseyov, O.; Bilkis, I.; Kerem, Z. Glycosylation of resveratrol protects it from enzymic oxidation. Biochem. J. 2003, 374, 157–163. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Soleas, G.J.; Goldberg, D.M.; Grass, L.; Levesque, M.; Diamandis, E.P. Do wine polyphenols modulate p53 gene expression in human cancer cell lines? Clin. Biochem. 2001, 34, 415–420. [Google Scholar] [CrossRef]
- Orsini, F.; Pelizzoni, F.; Verotta, L.; Aburjai, T.; Rogers, C.B. Isolation, synthesis, and antiplatelet aggregation activity of resveratrol 3-O-beta-D-glucopyranoside and related compounds. J. Nat. Prod. 1997, 60, 1082–1087. [Google Scholar] [CrossRef]
- Fulda, S. Resveratrol and derivatives for the prevention and treatment of cancer. Drug Discov. Today 2010, 15, 757–765. [Google Scholar] [CrossRef] [PubMed]
- Szekeres, T.; Saiko, P.; Fritzer-Szekeres, M.; Djavan, B.; Jäger, W. Chemopreventive effects of resveratrol and resveratrol derivatives. Ann. N. Y. Acad. Sci. 2011, 1215, 89–95. [Google Scholar] [CrossRef] [PubMed]
- Janicke, R. MCF-7 breast carcinoma cells do not express caspase-3. Breast Cancer Res. Treat. 2009, 117, 219–221. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ferlay, J.; Soerjomataram, I.; Dikshit, R.; Eser, S.; Mathers, C.; Rebelo, M.; Parkin, D.M.; Forman, D.; Bray, F. Cancer incidence and mortality worldwide: Sources, methods and major patterns in globocan 2012. Int. J. Cancer 2015, 136, E359–E386. [Google Scholar] [CrossRef]
- Tutt, A.; Yarnold, J. Radiobiology of breast cancer. Clin. Oncol. 2006, 18, 166–178. [Google Scholar] [CrossRef]
- Jabbari, N.; Zarei, L.; Esmaeili Govarchin Galeh, H.; Mansori Motlagh, B. Assessment of synergistic effect of combining hyperthermia with irradiation and calcium carbonate nanoparticles on proliferation of human breast adenocarcinoma cell line (mcf-7 cells). Artif. Cells Nanomed. Biotechnol. 2018, 46, 364–372. [Google Scholar] [CrossRef] [Green Version]
- Malik, A.; Sultana, M.; Qazi, A.; Qazi, M.H.; Parveen, G.; Waquar, S.; Ashraf, A.B.; Rasool, M. Role of natural radiosensitizers and cancer cell radioresistance: An update. Anal. Cell Pathol. Amst. 2016, 2016, 6146595. [Google Scholar] [CrossRef] [Green Version]
- Calvaruso, M.; Pucci, G.; Musso, R.; Bravatà, V.; Cammarata, F.P.; Russo, G.; Forte, G.I.; Minafra, L. Nutraceutical compounds as sensitizers for cancer treatment in radiation therapy. Int. J. Mol. Sci. 2019, 20, 5267. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rashid, A.; Liu, C.; Sanli, T.; Tsiani, E.; Singh, G.; Bristow, R.G.; Dayes, I.; Lukka, H.; Wright, J.; Tsakiridis, T. Resveratrol enhances prostate cancer cell response to ionizing radiation. Modulation of the AMPK, Akt and mTOR pathways. Radiat. Oncol. 2011, 6, 144. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Luo, H.; Wang, L.; Schulte, B.A.; Yang, A.; Tang, S.; Wang, G.Y. Resveratrol enhances ionizing radiation-induced premature senescence in lung cancer cells. Int. J. Oncol. 2013, 43, 1999–2006. [Google Scholar] [CrossRef] [Green Version]
- Tan, Y.; Wei, X.; Zhang, W.; Wang, X.; Wang, K.; Du, B.; Xiao, J. Resveratrol enhances the radiosensitivity of nasopharyngeal carcinoma cells by downregulating E2F1. Oncol. Rep. 2017, 37, 1833–1841. [Google Scholar] [CrossRef] [Green Version]
- Da Costa Araldi, I.C.; Bordin, F.P.R.; Cadoná, F.C.; Barbisan, F.; Azzolin, V.F.; Teixeira, C.F.; Baumhardt, T.; da Cruz, I.B.M.; Duarte, M.M.M.F.; Bauermann, L.F. The in vitro radiosensitizer potential of resveratrol on MCF-7 breast cancer cells. Chem. Biol. Interact. 2018, 282, 85–92. [Google Scholar] [CrossRef]
- Wang, X.; Ma, S.; Meng, N.; Yao, N.; Zhang, K.; Li, Q.; Zhang, Y.; Xing, Q.; Han, K.; Song, J.; et al. Resveratrol Exerts Dosage-Dependent Effects on the Self-Renewal and Neural Differentiation of hUC-MSCs. Mol. Cells 2016, 39, 418–425. [Google Scholar] [CrossRef] [Green Version]
- Rajah, T.; Du, N.; Drews, N.; Cohn, R. Genistein in the presence of 17beta-estradiol inhibits proliferation of ERbeta breast cancer cells. Pharmacology 2009, 84, 68–73. [Google Scholar] [CrossRef] [PubMed]
- Vo, N.T.P.; Madlener, S.; Bago-Horvath, Z.; Herbacek, I.; Stark, N.; Gridling, M.; Probst, P.; Giessrigl, B.; Bauer, S.; Vonach, C.; et al. Pro- and anticarcinogenic mechanisms of piceatannol are activated dose dependently in MCF-7 breast cancer cells. Carcinogenesis 2010, 31, 2074–2081. [Google Scholar] [CrossRef] [Green Version]
- Xiong, W.; Yin, A.; Mao, X.; Zhang, W.; Huang, H.; Zhang, X. Resveratrol suppresses human glioblastoma cell migration and invasion via activation of RhoA/ROCK signaling pathway. Oncol. Lett. 2016, 11, 484–490. [Google Scholar] [CrossRef] [PubMed]
- Rai, Y.; Pathak, R.; Kumari, N.; Sah, D.K.; Pandey, S.; Kalra, N.; Soni, R.; Dawarakanath, B.S.; Bhatt, A.N. Mitochondrial biogenesis and metabolic hyperactivation limits the application of MTT assay in the estimation of radiation induced growth inhibition. Sci. Rep. 2018, 8, 1531. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hantusch, A.; Rehm, M.; Brunner, T. Counting on Death—Quantitative aspects of Bcl-2 family regulation. FEBS J. 2018, 285, 4124–4138. [Google Scholar] [CrossRef] [Green Version]
- Elmore, S. Apoptosis: A review of programmed cell death. Toxicol. Pathol. 2007, 35, 495–516. [Google Scholar] [CrossRef] [PubMed]
- Amini, P.; Nodooshan, S.J.; Ashrafizadeh, M.; Eftekhari, S.M.; Aryafar, T.; Khalafi, L.; Musa, A.E.; Mahdavi, S.R.; Najafi, M.; Farhood, B. Resveratrol Induces Apoptosis and Attenuates Proliferation of MCF-7 Cells in Combination with Radiation and Hyperthermia. Curr. Mol. Med. 2021, 21, 142–150. [Google Scholar] [CrossRef]
- D’Autréaux, B.; Toledano, M.B. ROS as signalling molecules: Mechanisms that generate specificity in ROS homeostasis. Nat. Rev. Mol. Cell Biol. 2007, 8, 813–824. [Google Scholar] [CrossRef] [PubMed]
- Mirzapur, P.; Khazaei, M.R.; Moradi, M.T.; Khazaei, M. Apoptosis induction in human breast cancer cell lines by synergic effect of raloxifene and resveratrol through increasing proapoptotic genes. Life Sci. 2018, 205, 45–53. [Google Scholar] [CrossRef]
- Nogueira, V.; Hay, N. Molecular pathways: Reactive oxygen species homeostasis in cancer cells and implications for cancer therapy. Clin. Cancer Res. 2013, 19, 4309–4314. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Van Loenhout, J.; Peeters, M.; Bogaerts, A.; Smits, E.; Deben, C. Oxidative Stress-Inducing Anticancer Therapies: Taking a Closer Look at Their Immunomodulating Effects. Antioxidants 2020, 9, 1188. [Google Scholar] [CrossRef]
- Galadari, S.; Rahman, A.; Pallichankandy, S.; Thayyullathil, F. Reactive oxygen species and cancer paradox: To promote or to suppress? Free Radic. Biol. Med. 2017, 104, 144–164. [Google Scholar] [CrossRef]
- Nuszkiewicz, J.; Woźniak, A.; Szewczyk-Golec, K. Ionizing Radiation as a Source of Oxidative Stress-The Protective Role of Melatonin and Vitamin D. Int. J. Mol. Sci. 2020, 21, 5804. [Google Scholar] [CrossRef]
- Mileo, A.M.; Miccadei, S. Polyphenols as modulator of oxidative stress in cancer disease: New therapeutic strategies. Oxid. Med. Cell. Longev. 2016, 2016, 6475624. [Google Scholar] [CrossRef] [Green Version]
- Kim, W.; Lee, S.; Seo, D.; Kim, D.; Kim, K.; Kim, E.; Kang, J.; Seong, K.M.; Youn, H.; Youn, B. Cellular stress responses in radiotherapy. Cells 2019, 8, 1105. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, H.L.; Gao, J.P.; Han, Y.L.; Xu, X.; Wu, R.; Gao, Y.; Cui, X.-H. Comparative studies of polydatin and resveratrol on mutual transformation and antioxidative effect in vivo. Phytomedicine 2015, 22, 553–559. [Google Scholar] [CrossRef] [PubMed]
- Xu, L.Q.; Xie, Y.L.; Gui, S.H.; Zhang, X.; Mo, Z.Z.; Sun, C.Y.; Li, C.L.; Luo, D.D.; Zhang, Z.B.; Su, Z.R.; et al. Polydatin attenuates d-galactose-induced liver and brain damage through its anti-oxidative, anti-inflammatory and anti-apoptotic effects in mice. Food Funct. 2016, 7, 4545–4555. [Google Scholar] [CrossRef]
- Ince, S.; Arslan Acaroz, D.; Neuwirth, O.; Demirel, H.H.; Denk, B.; Kucukkurt, I.; Turkmen, R. Protective effect of polydatin, a natural precursor of resveratrol, against cisplatin-induced toxicity in rats. Food Chem. Toxicol. 2014, 72, 147–153. [Google Scholar] [CrossRef] [PubMed]
- Robb, E.L.; Stuart, J.A. The stilbenes resveratrol, pterostilbene and piceid affect growth and stress resistance in mammalian cells via a mechanism requiring estro-gen receptor beta and the induction of Mn-superoxide dismutase. Phytochemistry 2014, 98, 164–173. [Google Scholar] [CrossRef]
- Arslan-Acaroz, D.; Zemheri, F.; Demirel, H.H.; Kucukkurt, I.; Ince, S.; Eryavuz, A. In vivo assessment of polydatin, a natural polyphenol compound, on arsenic-induced free radical overproduction, gene expression, and genotoxicity. Environ. Sci. Pollut. Res. 2018, 25, 2614–2622. [Google Scholar] [CrossRef]
- Su, D.; Cheng, Y.; Liu, M.; Liu, D.; Cui, H.; Zhang, B.; Zhou, S.; Yang, T.; Mei, Q. Comparision of piceid and resveratrol in antioxidation and antiproliferation activities in vitro. PLoS ONE 2013, 8, e54505. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gerszon, J.; Walczak, A.; Rodacka, A. Attenuation of H2O2-induced neuronal cell damage by piceatannol. J. Funct. Foods 2017, 35, 540–548. [Google Scholar] [CrossRef]
- Hardmeier, R.; Hoeger, H.; Fang-Kircher, S.; Khoschsorur, A.; Lubec, G. Transcription and activity of antioxidant enzymes after ionizing irradiation in radiation-resistant and radiation-sensitive mice. Proc. Natl. Acad. Sci. USA 1997, 94, 7572–7576. [Google Scholar] [CrossRef] [Green Version]
- Podlesek, Z.; Zgur Bertok, D. The DNA Damage Inducible SOS Response Is a Key Player in the Generation of Bacterial Persister Cells and Population Wide Tolerance. Front. Microbiol. 2020, 11, 1785. [Google Scholar] [CrossRef]
- Lee, H.; Kim, D.; Jung, K.; Park, I.; Park, M.; Kim, M.; Woo, S.; Rhee, C.; Yoo, H.; Lee, S.; et al. Increased expression of antioxidant enzymes in radioresistant variant from U251 human glioblastoma cell line. Int. J. Mol. Med. 2004, 13, 883–887. [Google Scholar] [CrossRef]
- Takada, Y.; Hachiya, M.; Park, S.H.; Osawa, Y.; Ozawa, T.; Akashi, M. Role of reactive oxygen species in cells overexpressing manganese superoxide dismutase: Mechanism for induction of radioresistance. Mol. Cancer Res. 2002, 1, 137–146. [Google Scholar]
- Ko, J.H.; Sethi, G.; Um, J.Y.; Shanmugam, M.K.; Arfuso, F.; Kumar, A.P.; Bishayee, A.; Ahn, K.S. The role of resveratrol in cancer therapy. Int. J. Mol. Sci. 2017, 18, 2589. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Aubrey, B.; Kelly, G.; Janic, A.; Herold, M.J.; Strasser, A. How does p53 induce apoptosis and how does this relate to p53-mediated tumour suppression? Cell Death Differ. 2018, 25, 104–113. [Google Scholar] [CrossRef] [Green Version]
- Beyfuss, K.; Hood, D.A. A systematic review of p53 regulation of oxidative stress in skeletal muscle. Redox. Rep. 2018, 23, 100–117. [Google Scholar] [CrossRef] [Green Version]
- Haupt, S.; Berger, M.; Goldberg, Z.; Haupt, Y. Apoptosis—The p53 network. J. Cell Sci. 2003, 116, 4077–4085. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, J.; Liu, X.; Bhalla, K.; Kim, C.N.; Ibrado, A.M.; Cai, J.; Peng, T.I.; Jones, D.P.; Wang, X. Prevention of apoptosis by Bcl-2:release of cytochrome c from mitochondria blocked. Science 1997, 275, 1129–1132. [Google Scholar] [CrossRef] [PubMed]
- Pozo-Guisado, E.; Merino, J.M.; Mulero-Navarro, S.; Lorenzo-Benayas, M.J.; Centeno, F.; Alvarez-Barrientos, A.; Fernandez-Salguero, P.M. Resveratrol-induced apoptosis in MCF-7 human breast cancer cells involves a caspase-independent mechanism with downregulation of Bcl-2 and NF-kappaB. Int. J. Cancer 2005, 115, 74–84. [Google Scholar] [CrossRef]
- Kumar, S.; Eroglu, E.; Stokes, J.A.; Scissum-Gunn, K.; Saldanha, S.N.; Singh, U.P.; Manne, U.; Ponnazhagan, S.; Mishra, M.K. Resveratrol induces mitochondria-mediated, caspase-independent apoptosis in murine prostate cancer cells. Oncotarget 2017, 8, 20895–20908. [Google Scholar] [CrossRef]
- Janicke, R.; Sprengart, M.L.; Wati, M.R.; Porter, A.G. Caspase-3 is required for DNA fragmentation and morphological changes associated with apoptosis. J. Biol. Chem. 1998, 273, 9357–9360. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liang, Y.; Yan, C.; Schor, N.F. Apoptosis in the absence of caspase 3. Oncogene 2001, 20, 6570–6578. [Google Scholar] [CrossRef] [Green Version]
- Kagawa, S.; Gu, J.; Honda, T.; McDonnell, T.J.; Swisher, S.G.; Roth, J.A.; Fang, B. Deficiency of caspase-3 in MCF7 cells blocks Bax-mediated nuclear fragmentation but not cell death. Clin. Cancer Res. 2001, 7, 1474–1480. [Google Scholar]
- Wang, S.; He, M.; Li, L.; Liang, Z.; Zou, Z.; Tao, A. Cell-in-Cell Death Is Not Restricted by Caspase-3 Deficiency in MCF-7 Cells. J. Breast Cancer 2016, 19, 231–241. [Google Scholar] [CrossRef] [PubMed]
- Czemplik, M.; Mierziak, J.; Szopa, J.; Kulma, A. Flavonoid C-glucosides Derived from Flax Straw Extracts Reduce Human Breast Cancer Cell Growth In vitro and Induce Apoptosis. Front. Pharmacol. 2016, 7, 282. [Google Scholar] [CrossRef] [Green Version]
- Mukherjee, A.K.; Saviola, A.J.; Burns, P.D.; Mackessy, S.P. Apoptosis induction in human breast cancer (MCF-7) cells by a novel venom L-amino acid oxidase (Rusvinoxidase) is independent of its enzymatic activity and is accompanied by caspase-7 activation and reactive oxygen species production. Apoptosis 2015, 20, 1358–1372. [Google Scholar] [CrossRef]
- Feltham, R.; Vince, J.E.; Lawlor, K.E. Caspase-8: Not so silently deadly. Clin. Transl. Immunol. 2017, 6, e124. [Google Scholar] [CrossRef] [PubMed]
- Tang, D.; Lahti, J.M.; Kidd, V.J. Caspase-8 activation and bid cleavage contribute to MCF7 cellular execution in a caspase-3-dependent manner during staurosporine-mediated apoptosis. J. Biol. Chem. 2000, 275, 9303–9307. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Giménez-Bastida, J.A.; Ávila-Gálvez, M.A.; Espín, J.C.; González-Sarrías, A. Conjugated Physiological Resveratrol Metabolites Induce Senescence in Breast Cancer Cells: Role of p53/p21 and p16/Rb Pathways, and ABC Transporters. Mol. Nutr. Food Res. 2019, 63, e1900629. [Google Scholar] [CrossRef]
- González-Sarrías, A.; Giménez-Bastida, J.A.; García-Conesa, M.T.; Gómez-Sánchez, M.B.; García-Talavera, N.V.; Gil-Izquierdo, A.; Sánchez-Alvarez, C.; Fontana-Compiano, L.O.; Morga-Egea, J.P.; Pastor-Quirante, F.A.; et al. Occurrence of urolithins, gut microbiota ellagic acid metabolites and proliferation markers expression response in the human prostate gland upon consumption of walnuts and pomegranate juice. Mol. Nutr. Food Res. 2010, 54, 311–322. [Google Scholar] [CrossRef]
- Ávila-Gálvez, M.Á.; González-Sarrías, A.; Martínez-Díaz, F.; Abellán, B.; Martínez-Torrano, A.J.; Fernández-López, A.J.; Giménez-Bastida, J.A.; Espín, J.C. Disposition of Dietary Polyphenols in Breast Cancer Patients’ Tumors, and Their Associated Anticancer Activity: The Particular Case of Curcumin. Mol. Nutr. Food Res. 2021, 65, e2100163. [Google Scholar] [CrossRef]
- Ávila-Gálvez, M.Á.; García-Villalba, R.; Martínez-Díaz, F.; Ocaña-Castillo, B.; Monedero-Saiz, T.; Torrecillas-Sánchez, A.; Abellán, B.; González-Sarrías, A.; Espín, J.C. Metabolic Profiling of Dietary Polyphenols and Methylxanthines in Normal and Malignant Mammary Tissues from Breast Cancer Patients. Mol. Nutr. Food Res. 2019, 63, e1801239. [Google Scholar] [CrossRef]
- Ávila-Gálvez, M.Á.; Romo-Vaquero, M.; González-Sarrías, A.; Espín, J.C. Kinetic disposition of dietary polyphenols and methylxanthines in the rat mammary tissue. J. Funct. Foods. 2019, 61, 103516. [Google Scholar] [CrossRef]
- Amri, A.; Chaumeil, J.C.; Sfar, S.; Charrueau, C. Administration of resveratrol: What formulation solutions to bioavailability limitations? J. Control. Release 2012, 158, 182–193. [Google Scholar] [CrossRef]
- Smoliga, J.M.; Blanchard, O. Enhancing the delivery of resveratrol in humans: If low bioavailability is the problem, what is the solution? Molecules 2014, 19, 17154–17172. [Google Scholar] [CrossRef] [PubMed]
- Aebi, H. Catalase in vitro. Methods Enzym. 1984, 105, 121–126. [Google Scholar] [CrossRef]
- Rice-Evans, C.A.; Diplock, A.T.; Symons, M.C. Techniques in Free Radical Research, 1st ed.; Elsevier Science: Amsterdam, The Netherlands, 1991. [Google Scholar]
- Misra, H.P.; Fridovich, I. The Role of Superoxide Anion in the Autoxidation of Epinephrine and a Simple Assay for Superoxide Dismutase. J. Biol. Chem. 1972, 247, 3170–3175. [Google Scholar] [CrossRef]
- Lowry, O.H.; Rosebrough, N.J.; Farr, A.L.; Randall, R.J. Protein measurement with the Folin phenol reagent. J. Biol. Chem. 1951, 193, 265–275. [Google Scholar] [CrossRef]
Control | 6 Gy | R | R + 6 Gy | ROH | ROH + 6 Gy | RG | RG + 6 Gy | |
---|---|---|---|---|---|---|---|---|
p53 | 1.00 ± 0.13 | 1.56 ± 0.11 * | 1.78 ± 0.28 * | 1.97 ± 0.20 *# | 1.64 ± 0.27 * | 1.74 ± 0.15 * | 1.27 ± 0.12 * | 1.50 ± 0.19 * |
Caspase 3 | 1.00 ± 0.05 | 1.24 ± 0.12 * | 1.19 ± 0.30 | 1.25 ± 0.16 | 1.04 ± 0.16 | 1.28 ± 0.03 * | 0.87 ± 0.10 | 1.26 ± 0.16 |
Caspase 8 | 1.00 ± 0.04 | 1.50 ± 0.31 * | 1.41 ± 0.42 * | 2.07 ± 0.11 *# | 1.13 ± 0.44 | 2.12 ± 0.12 *# | 1.73 ± 0.41 * | 1.94 ± 0.03 *# |
Bax | 1.00 ± 0.03 | 2.73 ± 0.26 * | 2.36 ± 0.27 * | 5.25 ± 0.46 *# | 2.17 ± 0.46 * | 4.05 ± 0.53 *# | 1.48 ± 0.11 * | 3.19 ± 0.42 *# |
Bcl-2 | 1.00 ± 0.05 | 1.63 ± 0.26 * | 1.53 ± 0.31 * | 2.18 ± 0.39 *# | 1.52 ± 0.31 * | 2.02 ± 0.36 *# | 1.25 ± 0.28 * | 1.65 ± 0.26 * |
Primer | Sense | Antisense |
---|---|---|
HPRT | ATGGACAGGACTGAACGTCTT | TCCAGCAGGTCAGCAAAGAA |
p53 | TAACAGTTCCTGCATGGGCGGC | AGGACAGGCACAAACACGCACC |
Bcl-2 | TTGTGGCCTTCTTTGAGTTCGGTG | GGTGCCGGTTCAGGTACTCAGTCA |
Bax | CCTGTGCACCAAGGTGCCGGAACT | CCACCCTGGTCTTGGATCCAGCCC |
Caspase 3 | TGGACTGTGGCATTGAGAC | CAAAGCGACTGGATGAACC |
Caspase 8 | CTGGATGATGACATGAACCTGCTG | GCTCTTGTTGATTTGGGCACAGAC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Komorowska, D.; Gajewska, A.; Hikisz, P.; Bartosz, G.; Rodacka, A. Comparison of the Effects of Resveratrol and Its Derivatives on the Radiation Response of MCF-7 Breast Cancer Cells. Int. J. Mol. Sci. 2021, 22, 9511. https://doi.org/10.3390/ijms22179511
Komorowska D, Gajewska A, Hikisz P, Bartosz G, Rodacka A. Comparison of the Effects of Resveratrol and Its Derivatives on the Radiation Response of MCF-7 Breast Cancer Cells. International Journal of Molecular Sciences. 2021; 22(17):9511. https://doi.org/10.3390/ijms22179511
Chicago/Turabian StyleKomorowska, Dominika, Agnieszka Gajewska, Paweł Hikisz, Grzegorz Bartosz, and Aleksandra Rodacka. 2021. "Comparison of the Effects of Resveratrol and Its Derivatives on the Radiation Response of MCF-7 Breast Cancer Cells" International Journal of Molecular Sciences 22, no. 17: 9511. https://doi.org/10.3390/ijms22179511