3,4-Dehydro-L-proline Induces Programmed Cell Death in the Roots of Brachypodium distachyon
Abstract
:1. Introduction
2. Results
2.1. Impact of 3,4-DHP on B. distachyon Root Development
2.2. The TUNEL Test Demonstrated That DNA Damage Was Induced by 3,4-DHP
2.3. Localisation of EXT Epitopes under Different 3,4-DHP Treatments
2.4. Changes in the Expression of EXTs and Genes Associated with PCD
3. Discussion
4. Materials and Methods
4.1. Plant Material and 3,4-DHP Treatment
4.2. Histological Procedures
4.3. RT-qPCR
4.4. TUNEL Assay
4.5. TEM
4.6. Immunohistochemistry
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
3,4-DHP | 3,4-dehydro-L-proline |
AGPs | Arabinogalactan proteins |
EXTs | Extensins |
HRGPs | Hydroxyproline-rich glycoproteins |
PBS | Phosphate-buffered saline |
PCD | Programmed cell death |
RT-qPCR | Quantitative reverse transcription PCR |
TEM | Transmission Electron Microscopy |
TUNEL | Terminal deoxynucleotidyl transferase dUTP nick end labelling |
Appendix A
Genes | Description of the Genes | Primer Sequence (5′-3′) |
---|---|---|
Bradi1g32860 | ubiquitin | pF—GAGGGTGGACTCCTTTTGGA |
pR—TCCACACTCCACTTGGTGCT | ||
Bradi2g05080 | leucine-rich EXT | pF—CTCCGGTTCAACGAGTTCGAG |
pR—CGATGTTATCCGGGAGGTTGAA | ||
Bradi3g10280 | EXT | pF—CTCGTCAGCCGGACATGATA |
pR—TCATGGGGATTTGGACCACG | ||
Bradi1g05570 | BAX inhibitor | pF—ACGCCATCGTCCTGATGTTGTTC |
pR—TGAGGAAGGCCGAGAAGATGAGC | ||
Bradi1g60762 | metacaspase 1 | pF—ACTGCATCCTCATCCTCACAGAG |
pR—AGCCAGCAGATTCTCCTTCGTC | ||
Bradi1g60756 | metacaspase 2 | pF—ACTGCATCCTCACCCTTACACC |
pR—AGAAGTGGAACACCAGGGAGTC | ||
Bradi5g09650 | thioredoxin peroxidase | pF—GAACCCTTCAGGCCCTGCAATATG |
pR—AACCTGCTGGGCAAACCTCATC |
References
- Novakovic, L.; Guo, T.; Bacic, A.; Sampathkumar, A.; Johnson, K.L. Hitting the wall-sensing and signaling pathways involved in plant cell wall remodeling in response to abiotic stress. Plants 2018, 7, 89. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Le Gall, H.; Philippe, F.; Domon, J.M.; Gillet, F.; Pelloux, J.; Rayon, C. Cell wall metabolism in response to abiotic stress. Plants 2015, 4, 112–166. [Google Scholar] [CrossRef]
- Kuczak, M.; Kurczynska, E. Cell wall composition as a marker of the reprogramming of the cell fate on the example of a Daucus carota (L.) hypocotyl in which somatic embryogenesis was induced. Int. J. Mol. Sci. 2020, 21, 8126. [Google Scholar] [CrossRef]
- Fu, Z.; Yang, P. Proteomics advances in the understanding of pollen-pistil interactions. Proteomes 2014, 2, 468–484. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pinski, A.; Betekhtin, A.; Hupert-Kocurek, K.; Mur, L.A.J.; Hasterok, R. Defining the genetic basis of plant–endophytic bacteria interactions. Int. J. Mol. Sci. 2019, 20, 1947. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, Y.; Fan, W.; Li, X.; Chen, H.; Takac, T.; Samajova, O.; Fabrice, M.R.; Xie, L.; Ma, J.; Samaj, J.; et al. Expression and distribution of extensins and AGPs in susceptible and resistant banana cultivars in response to wounding and Fusarium oxysporum. Sci. Rep. 2017, 7, 42400. [Google Scholar] [CrossRef]
- Betekhtin, A.; Rojek, M.; Nowak, K.; Pinski, A.; Milewska-Hendel, A.; Kurczynska, E.; Doonan, J.H.; Hasterok, R. Cell wall epitopes and endoploidy as reporters of embryogenic potential in Brachypodium distachyon callus culture. Int. J. Mol. Sci. 2018, 19, 3811. [Google Scholar] [CrossRef] [Green Version]
- Pinski, A.; Betekhtin, A.; Sala, K.; Godel-Jedrychowska, K.; Kurczynska, E.; Hasterok, R. Hydroxyproline-rich glycoproteins as markers of temperature stress in the leaves of Brachypodium distachyon. Int. J. Mol. Sci. 2019, 20, 2571. [Google Scholar] [CrossRef] [Green Version]
- Mareri, L.; Romi, M.; Cai, G. Arabinogalactan proteins: Actors or spectators during abiotic and biotic stress in plants? Plant Biosyst. 2018, 153, 173–185. [Google Scholar] [CrossRef]
- Wolny, E.; Skalska, A.; Braszewska, A.; Mur, L.A.J.; Hasterok, R. Defining the cell wall, cell cycle and chromatin landmarks in the responses of Brachypodium distachyon to salinity. Int. J. Mol. Sci. 2021, 22, 949. [Google Scholar] [CrossRef]
- Johnson, K.L.; Cassin, A.M.; Lonsdale, A.; Bacic, A.; Doblin, M.S.; Schultz, C.J. Pipeline to identify hydroxyproline-rich glycoproteins. Plant Physiol. 2017, 174, 886–903. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Showalter, A.M. Structure and function of plant cell wall proteins. Plant Cell 1993, 5, 9. [Google Scholar] [PubMed]
- Kieliszewski, M.J.; Lamport, D.T. Extensin: Repetitive motifs, functional sites, post-translational codes, and phylogeny. Plant J. 1994, 5, 157–172. [Google Scholar] [CrossRef] [PubMed]
- Wilson, L.; Fry, J. Extensin—A major cell wall glycoprotein. Plant Cell Environ. 1986, 9, 239–260. [Google Scholar]
- van Doorn, W.G.; Beers, E.P.; Dangl, J.L.; Franklin-Tong, V.E.; Gallois, P.; Hara-Nishimura, I.; Jones, A.M.; Kawai-Yamada, M.; Lam, E.; Mundy, J.; et al. Morphological classification of plant cell deaths. Cell Death Differ. 2011, 18, 1241–1246. [Google Scholar] [CrossRef] [Green Version]
- Ning, S.-B.; Wang, L.; Song, Y.-C. Identification of programmed cell death in situ in individual plant cells in vivo using a chromosome preparation technique. J. Exp. Bot. 2002, 53, 651–658. [Google Scholar] [CrossRef] [Green Version]
- Betekhtin, A.; Milewska-Hendel, A.; Chajec, L.; Rojek, M.; Nowak, K.; Kwasniewska, J.; Wolny, E.; Kurczynska, E.; Hasterok, R. 5-azacitidine induces cell death in a tissue culture of Brachypodium distachyon. Int. J. Mol. Sci. 2018, 19, 1806. [Google Scholar] [CrossRef] [Green Version]
- Sueldo, D.J.; van der Hoorn, R.A.L. Plant life needs cell death, but does plant cell death need Cys proteases? FEBS J. 2017, 284, 1577–1585. [Google Scholar] [CrossRef] [Green Version]
- Gao, M.; Showalter, A. Yariv reagent treatment induces programmed cell death in Arabidopsis cell cultures and implicates arabinogalactan protein involvement. Plant J. 1999, 19, 321–331. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Johnson, K.L.; Cassin, A.M.; Lonsdale, A.; Wong, G.K.; Soltis, D.E.; Miles, N.W.; Melkonian, M.; Melkonian, B.; Deyholos, M.K.; Leebens-Mack, J.; et al. Insights into the evolution of hydroxyproline-rich glycoproteins from 1000 plant transcriptomes. Plant Physiol. 2017, 174, 904–921. [Google Scholar] [CrossRef]
- Vogel, J. Unique aspects of the grass cell wall. Curr. Opin. Plant Biol. 2008, 11, 301–307. [Google Scholar] [CrossRef] [PubMed]
- International Brachypodium Initiative. Genome sequencing and analysis of the model grass Brachypodium distachyon. Nature 2010, 463, 763–768. [Google Scholar] [CrossRef] [PubMed]
- Coomey, J.H.; Sibout, R.; Hazen, S.P. Grass secondary cell walls, Brachypodium distachyon as a model for discovery. New Phytol. 2020, 227, 1649–1667. [Google Scholar] [CrossRef] [Green Version]
- Skalska, A.; Stritt, C.; Wyler, M.; Williams, H.W.; Vickers, M.; Han, J.; Tuna, M.; Savas Tuna, G.; Susek, K.; Swain, M.; et al. Genetic and methylome variation in turkish Brachypodium distachyon accessions differentiate two geographically distinct subpopulations. Int. J. Mol. Sci. 2020, 21, 6700. [Google Scholar] [CrossRef] [PubMed]
- Gordon, S.P.; Contreras-Moreira, B.; Woods, D.P.; Des Marais, D.L.; Burgess, D.; Shu, S.; Stritt, C.; Roulin, A.C.; Schackwitz, W.; Tyler, L.; et al. Extensive gene content variation in the Brachypodium distachyon pan-genome correlates with population structure. Nat. Commun. 2017, 8, 2184. [Google Scholar] [CrossRef] [PubMed]
- Hus, K.; Betekhtin, A.; Pinski, A.; Rojek-Jelonek, M.; Grzebelus, E.; Nibau, C.; Gao, M.; Jaeger, K.E.; Jenkins, G.; Doonan, J.H.; et al. A CRISPR/Cas9-Based mutagenesis protocol for Brachypodium distachyon and its allopolyploid relative, Brachypodium hybridum. Front. Plant Sci. 2020, 11, 614. [Google Scholar] [CrossRef]
- Showalter, A.M.; Keppler, B.; Lichtenberg, J.; Gu, D.; Welch, L.R. A bioinformatics approach to the identification, classification, and analysis of hydroxyproline-rich glycoproteins. Plant Physiol. 2010, 153, 485–513. [Google Scholar] [CrossRef] [Green Version]
- He, J.; Zhao, H.; Cheng, Z.; Ke, Y.; Liu, J.; Ma, H. Evolution analysis of the fasciclin-like arabinogalactan proteins in plants shows variable fasciclin-AGP domain constitutions. Int. J. Mol. Sci. 2019, 20, 1945. [Google Scholar] [CrossRef] [Green Version]
- Albenne, C.; Canut, H.; Boudart, G.; Zhang, Y.; San Clemente, H.; Pont-Lezica, R.; Jamet, E. Plant cell wall proteomics: Mass spectrometry data, a trove for research on protein structure/function relationships. Mol. Plant 2009, 2, 977–989. [Google Scholar] [CrossRef] [Green Version]
- Zhang, X.; Ren, Y.; Zhao, J. Roles of extensins in cotyledon primordium formation and shoot apical meristem activity in Nicotiana tabacum. J. Exp. Bot. 2008, 59, 4045–4058. [Google Scholar] [CrossRef] [Green Version]
- Cooper, J.B.; Varner, J.E. Selective inhibition of proline hydroxylation by 3, 4-dehydroproline. Plant Physiol. 1983, 73, 324–328. [Google Scholar] [CrossRef] [Green Version]
- Bucher, M.; Schroeer, B.; Willmitzer, L.; Riesmeier, J.W. Two genes encoding extensin-like proteins are predominantly expressed in tomato root hair cells. Plant Mol. Biol. 1997, 35, 497–508. [Google Scholar] [CrossRef]
- Xu, C.; Takáč, T.; Burbach, C.; Menzel, D.; Šamaj, J. Developmental localization and the role of hydroxyproline rich glycoproteins during somatic embryogenesis of banana (Musa spp. AAA). BMC Plant Biol. 2011, 11, 38. [Google Scholar] [CrossRef] [Green Version]
- Li, Y.-Y.; Chen, X.-M.; Zhang, Y.; Cho, Y.-H.; Wang, A.-R.; Yeung, E.C.; Zeng, X.; Guo, S.-X.; Lee, Y.-I. Immunolocalization and changes of hydroxyproline-rich glycoproteins during symbiotic germination of Dendrobium officinale. Front. Plant Sci. 2018, 9, 552. [Google Scholar] [CrossRef] [Green Version]
- Gawecki, R.; Sala, K.; Kurczynska, E.U.; Swiatek, P.; Plachno, B.J. Immunodetection of some pectic, arabinogalactan proteins and hemicellulose epitopes in the micropylar transmitting tissue of apomictic dandelions (Taraxacum, Asteraceae, Lactuceae). Protoplasma 2016, 254, 657–668. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, X.; Ma, H.; Qi, H.; Zhao, J. Roles of hydroxyproline-rich glycoproteins in the pollen tube and style cell growth of tobacco (Nicotiana tabacum L.). J. Plant Physiol. 2014, 171, 1036–1045. [Google Scholar] [CrossRef]
- Yates, E.A.; Knox, J.P. Investigations into the occurrence of plant cell surface epitopes in exudate gums. Carbohydr. Polym. 1994, 24, 281–286. [Google Scholar] [CrossRef]
- Marzol, E.; Borassi, C.; Bringas, M.; Sede, A.; Rodriguez Garcia, D.R.; Capece, L.; Estevez, J.M. Filling the gaps to solve the extensin puzzle. Mol. Plant 2018, 11, 645–658. [Google Scholar] [CrossRef] [Green Version]
- Asif, M.H.; Trivedi, P.K.; Misra, P.; Nath, P. Prolyl-4-hydroxylase (AtP4H1) mediates and mimics low oxygen response in Arabidopsis thaliana. Funct. Integr. Genom. 2009, 9, 525–535. [Google Scholar] [CrossRef]
- Perrakis, A.; Bita, C.E.; Arhondakis, S.; Krokida, A.; Mekkaoui, K.; Denic, D.; Blazakis, K.N.; Kaloudas, D.; Kalaitzis, P. Suppression of a prolyl 4 hydroxylase results in delayed abscission of overripe tomato fruits. Front. Plant Sci. 2019, 10, 348. [Google Scholar] [CrossRef] [PubMed]
- Velasquez, S.M.; Iusem, N.D.; Estevez, J.M. Root hair sweet growth. Plant Signal. Behav. 2011, 6, 1600–1602. [Google Scholar] [CrossRef] [Green Version]
- Velasquez, S.M.; Ricardi, M.M.; Dorosz, J.G.; Fernandez, P.V.; Nadra, A.D.; Pol-Fachin, L.; Egelund, J.; Gille, S.; Harholt, J.; Ciancia, M.; et al. O-glycosylated cell wall proteins are essential in root hair growth. Science 2011, 332, 1401–1403. [Google Scholar] [CrossRef]
- Baumberger, N.; Ringli, C.; Keller, B. The chimeric leucine-rich repeat/extensin cell wall protein LRX1 is required for root hair morphogenesis in Arabidopsis thaliana. Genes Dev. 2001, 15, 1128–1139. [Google Scholar] [CrossRef] [Green Version]
- Kwasniewski, M.; Janiak, A.; Mueller-Roeber, B.; Szarejko, I. Global analysis of the root hair morphogenesis transcriptome reveals new candidate genes involved in root hair formation in barley. J. Plant Physiol. 2010, 167, 1076–1083. [Google Scholar] [CrossRef] [PubMed]
- Velasquez, M.; Salter, J.S.; Dorosz, J.G.; Petersen, B.L.; Estevez, J.M. Recent advances on the posttranslational modifications of EXTs and their roles in plant cell walls. Front. Plant Sci. 2012, 3, 93. [Google Scholar] [CrossRef] [Green Version]
- Jacobowitz, J.R.; Doyle, W.C.; Weng, J.K. PRX9 and PRX40 are extensin peroxidases essential for maintaining tapetum and microspore cell wall integrity during Arabidopsis anther development. Plant Cell 2019, 31, 848–861. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, Y.; Dong, W.; Tan, L.; Held, M.A.; Kieliszewski, M.J. Arabinosylation plays a crucial role in extensin cross-linking in vitro. Biochem. Insights 2015, 8, 1–13. [Google Scholar] [CrossRef] [Green Version]
- Borassi, C.; Gloazzo Dorosz, J.; Ricardi, M.M.; Carignani Sardoy, M.; Pol Fachin, L.; Marzol, E.; Mangano, S.; Rodriguez Garcia, D.R.; Martinez Pacheco, J.; Rondon Guerrero, Y.D.C.; et al. A cell surface arabinogalactan-peptide influences root hair cell fate. New Phytol. 2020, 227, 732–743. [Google Scholar] [CrossRef]
- Buono, R.A.; Hudecek, R.; Nowack, M.K. Plant proteases during developmental programmed cell death. J. Exp. Bot 2019, 70, 2097–2112. [Google Scholar] [CrossRef] [PubMed]
- Stael, S.; Van Breusegem, F.; Gevaert, K.; Nowack, M.K. Plant proteases and programmed cell death. J. Exp. Bot. 2019, 70, 1991–1995. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kwasniewska, J.; Kus, A.; Swoboda, M.; Braszewska-Zalewska, A. DNA replication after mutagenic treatment in Hordeum vulgare. Mutat. Res./Genet. Toxicol. Environ. Mutagen. 2016, 812, 20–28. [Google Scholar] [CrossRef] [PubMed]
- Jaskowiak, J.; Kwasniewska, J.; Szurman-Zubrzycka, M.; Rojek-Jelonek, M.; Larsen, P.B.; Szarejko, I. Al-tolerant barley mutant hvatr.g shows the ATR-regulated DNA damage response to maleic acid hydrazide. Int. J. Mol. Sci. 2020, 21, 8500. [Google Scholar] [CrossRef] [PubMed]
- Vanyushin, B.F.; Ashapkin, V.V. DNA methylation in higher plants: Past, present and future. Biochim. Biophys. Acta 2011, 1809, 360–368. [Google Scholar] [CrossRef] [PubMed]
- Fu, Y.B.; Ahmed, Z.; Yang, H.; Horbach, C. TUNEL Assay and DAPI staining revealed few alterations of cellular morphology in naturally and artificially aged seeds of cultivated flax. Plants 2018, 7, 34. [Google Scholar] [CrossRef] [Green Version]
- Yao, S.; Luo, S.; Pan, C.; Xiong, W.; Xiao, D.; Wang, A.; Zhan, J.; He, L. Metacaspase MC1 enhances aluminum-induced programmed cell death of root tip cells in peanut. Plant Soil 2020, 448, 479–494. [Google Scholar] [CrossRef]
- Zhu, P.; Yu, X.H.; Wang, C.; Zhang, Q.; Liu, W.; McSweeney, S.; Shanklin, J.; Lam, E.; Liu, Q. Structural basis for Ca(2+)-dependent activation of a plant metacaspase. Nat. Commun. 2020, 11, 2249. [Google Scholar] [CrossRef] [PubMed]
- Balakireva, A.V.; Zamyatnin, A.A., Jr. Cutting out the gaps between proteases and programmed cell death. Front. Plant Sci. 2019, 10, 704. [Google Scholar] [CrossRef] [Green Version]
- Hoeberichts, F.A.; ten Have, A.; Woltering, E.J. A tomato metacaspase gene is upregulated during programmed cell death in Botrytis cinerea-infected leaves. Planta 2003, 217, 517–522. [Google Scholar] [CrossRef] [PubMed]
- Minina, E.A.; Filonova, L.H.; Fukada, K.; Savenkov, E.I.; Gogvadze, V.; Clapham, D.; Sanchez-Vera, V.; Suarez, M.F.; Zhivotovsky, B.; Daniel, G.; et al. Autophagy and metacaspase determine the mode of cell death in plants. J. Cell Biol. 2013, 203, 917–927. [Google Scholar] [CrossRef] [Green Version]
- Minina, E.A.; Smertenko, A.P.; Bozhkov, P.V. Vacuolar cell death in plants: Metacaspase releases the brakes on autophagy. Autophagy 2014, 10, 928–929. [Google Scholar] [CrossRef] [Green Version]
- Vieira Dos Santos, C.; Rey, P. Plant thioredoxins are key actors in the oxidative stress response. Trends Plant Sci. 2006, 11, 329–334. [Google Scholar] [CrossRef]
- Olmos, E.; Garcia De La Garma, J.; Gomez-Jimenez, M.C.; Fernandez-Garcia, N. Arabinogalactan proteins are involved in salt-adaptation and vesicle trafficking in tobacco by-2 cell cultures. Front. Plant Sci. 2017, 8, 1092. [Google Scholar] [CrossRef] [Green Version]
- Leszczuk, A.; Pieczywek, P.M.; Gryta, A.; Frac, M.; Zdunek, A. Immunocytochemical studies on the distribution of arabinogalactan proteins (AGPs) as a response to fungal infection in Malus x domestica fruit. Sci. Rep. 2019, 9, 17428. [Google Scholar] [CrossRef]
- Velasquez, S.M.; Ricardi, M.M.; Poulsen, C.P.; Oikawa, A.; Dilokpimol, A.; Halim, A.; Mangano, S.; Denita Juarez, S.P.; Marzol, E.; Salgado Salter, J.D.; et al. Complex regulation of prolyl-4-hydroxylases impacts root hair expansion. Mol. Plant 2015, 8, 734–746. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Konkina, A.; Klepadlo, M.; Lakehal, A.; Zein, Z.E.; Krokida, A.; Botros, M.; Iakovidis, M.; Chernobavskiy, P.; Elfatih Zerroumda, M.; Tsanakas, G.; et al. An Arabidopsis prolyl 4 hydroxylase is involved in the low oxygen response. Front. Plant Sci. 2021, 12, 637352. [Google Scholar] [CrossRef] [PubMed]
- Coimbra, S.; Almeida, J.; Junqueira, V.; Costa, M.L.; Pereira, L.G. Arabinogalactan proteins as molecular markers in Arabidopsis thaliana sexual reproduction. J. Exp. Bot. 2007, 58, 4027–4035. [Google Scholar] [CrossRef] [Green Version]
- Apostolakos, P.; Livanos, P.; Giannoutsou, E.; Panteris, E.; Galatis, B. The intracellular and intercellular cross-talk during subsidiary cell formation in Zea mays: Existing and novel components orchestrating cell polarization and asymmetric division. Ann. Bot. 2018, 122, 679–696. [Google Scholar] [CrossRef] [PubMed]
- Giannoutsou, E.; Apostolakos, P.; Galatis, B. Spatio-temporal diversification of the cell wall matrix materials in the developing stomatal complexes of Zea mays. Planta 2016, 244, 1125–1143. [Google Scholar] [CrossRef]
- Steedman, H. Polyester wax: A new ribboning embedding medium for histology. Nature 1957, 179, 1345. [Google Scholar] [CrossRef]
- Wolny, E.; Braszewska-Zalewska, A.; Hasterok, R. Spatial distribution of epigenetic modifications in Brachypodium distachyon embryos during seed maturation and germination. PLoS ONE 2014, 9, e101246. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Muoki, R.C.; Paul, A.; Kumari, A.; Singh, K.; Kumar, S. An improved protocol for the isolation of RNA from roots of tea (Camellia sinensis (L.) O. Kuntze). Mol. Biotechnol 2012, 52, 82–88. [Google Scholar] [CrossRef] [PubMed]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
- Betekhtin, A.; Rojek, M.; Milewska-Hendel, A.; Gawecki, R.; Karcz, J.; Kurczynska, E.; Hasterok, R. Spatial distribution of selected chemical cell wall components in the embryogenic callus of Brachypodium distachyon. PLoS ONE 2016, 11, e0167426. [Google Scholar] [CrossRef] [PubMed]
- Smallwood, M.; Beven, A.; Donovan, N.; Neill, S.J.; Peart, J.; Roberts, K.; Knox, J.P. Localization of cell wall proteins in relation to the developmental anatomy of the carrot root apex. Plant J. 1994, 5, 237–246. [Google Scholar] [CrossRef]
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pinski, A.; Betekhtin, A.; Kwasniewska, J.; Chajec, L.; Wolny, E.; Hasterok, R. 3,4-Dehydro-L-proline Induces Programmed Cell Death in the Roots of Brachypodium distachyon. Int. J. Mol. Sci. 2021, 22, 7548. https://doi.org/10.3390/ijms22147548
Pinski A, Betekhtin A, Kwasniewska J, Chajec L, Wolny E, Hasterok R. 3,4-Dehydro-L-proline Induces Programmed Cell Death in the Roots of Brachypodium distachyon. International Journal of Molecular Sciences. 2021; 22(14):7548. https://doi.org/10.3390/ijms22147548
Chicago/Turabian StylePinski, Artur, Alexander Betekhtin, Jolanta Kwasniewska, Lukasz Chajec, Elzbieta Wolny, and Robert Hasterok. 2021. "3,4-Dehydro-L-proline Induces Programmed Cell Death in the Roots of Brachypodium distachyon" International Journal of Molecular Sciences 22, no. 14: 7548. https://doi.org/10.3390/ijms22147548
APA StylePinski, A., Betekhtin, A., Kwasniewska, J., Chajec, L., Wolny, E., & Hasterok, R. (2021). 3,4-Dehydro-L-proline Induces Programmed Cell Death in the Roots of Brachypodium distachyon. International Journal of Molecular Sciences, 22(14), 7548. https://doi.org/10.3390/ijms22147548