Transcriptome Analysis and miRNA Target Profiling at Various Stages of Root-Knot Nematode Meloidogyne incognita Development for Identification of Potential Regulatory Networks
Abstract
:1. Introduction
2. Results
2.1. Stage-Wise Transcriptome Profiling of M. incognita
2.2. Functional Annotation and Comparison among Stages
2.3. Heatmap Expression and Functional Analysis
2.4. miRNA Target Prediction and Regulation of mRNA Expression
2.5. Stage-Wise Analysis of Highly Expressed mRNAs
2.6. Stage-Specific miRNA-Targeted mRNA Expression Analysis
3. Discussion
4. Materials and Methods
4.1. Biological Sample Preparation
4.2. Stage-Wise RNA Extraction and Sequencing
4.3. Assembly and Genome Mapping
4.4. Functional Annotation and Expression Analysis
4.5. miRNA Sequencing and Target Prediction
4.6. Comparison of miRNA and Complementary mRNA Expression
4.7. Stage-Wise Gene Expression Analysis
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Mitkowski, N.; Abawi, G. Root-knot nematodes. Plant Health Instr. 2003. [Google Scholar] [CrossRef]
- Abad, P.; Gouzy, J.; Aury, J.M.; Castagnone-Sereno, P.; Danchin, E.G.J.; Deleury, E.; Perfus-Barbeoch, L.; Anthouard, V.; Artiguenave, F.; Blok, V.C.; et al. Genome sequence of the metazoan plant-parasitic nematode Meloidogyne incognita. Nat. Biotechnol. 2008, 26, 909–915. [Google Scholar] [CrossRef] [Green Version]
- Subramanian, P.; Choi, I.C.; Mani, V.; Park, J.; Subramaniyam, S.; Choi, K.H.; Sim, J.S.; Lee, C.M.; Koo, J.C.; Hahn, B.S. Stage-wise identification and analysis of miRNA from root-knot nematode Meloidogyne incognita. Int. J. Mol. Sci. 2016, 17, 1758. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Mao, Z.; Yan, J.; Cheng, X.; Liu, F.; Xiao, L.; Dai, L.; Luo, F.; Xie, B. Identification of microRNAs in Meloidogyne incognita using deep sequencing. PLoS ONE 2015, 10, e0133491. [Google Scholar] [CrossRef]
- Ambros, V. The functions of animal microRNAs. Nature 2004, 431, 350–355. [Google Scholar] [CrossRef]
- Feinbaum, R.; Ambros, V.; Lee, R. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 2004, 116, 843–854. [Google Scholar]
- Zhang, B.; Wang, Q. MicroRNA-based biotechnology for plant improvement. J. Cell. Physiol. 2015, 230, 1–15. [Google Scholar] [CrossRef]
- Cotton, J.A.; Lilley, C.J.; Jones, L.M.; Kikuchi, T.; Reid, A.J.; Thorpe, P.; Tsai, I.J.; Beasley, H.; Blok, V.; Cock, P.J.A.; et al. The genome and life-stage specific transcriptomes of Globodera pallida elucidate key aspects of plant parasitism by a cyst nematode. Genome Biol. 2014, 15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Haegeman, A.; Joseph, S.; Gheysen, G. Analysis of the transcriptome of the root lesion nematode Pratylenchus coffeae generated by 454 sequencing technology. Mol. Biochem. Parasitol. 2011, 178, 7–14. [Google Scholar] [CrossRef]
- Schwarz, E.M.; Korhonen, P.K.; Campbell, B.E.; Young, N.D.; Jex, A.R.; Jabbar, A.; Hall, R.S.; Mondal, A.; Howe, A.C.; Pell, J.; et al. The genome and developmental transcriptome of the strongylid nematode Haemonchus contortus. Genome Biol. 2013, 14. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, Z.; Abubucker, S.; Martin, J.; Wilson, R.K.; Hawdon, J.; Mitreva, M. Characterizing Ancylostoma caninum transcriptome and exploring nematode parasitic adaptation. BMC Genomics 2010, 11. [Google Scholar] [CrossRef] [Green Version]
- Szakasits, D.; Heinen, P.; Wieczorek, K.; Hofmann, J.; Wagner, F.; Kreil, D.P.; Sykacek, P.; Grundler, F.M.W.; Bohlmann, H. The transcriptome of syncytia induced by the cyst nematode Heterodera schachtii in Arabidopsis roots. Plant J. 2009, 57, 771–784. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- McCarter, J.P.; Mitreva, M.D.; Martin, J.; Dante, M.; Wylie, T.; Rao, U.; Pape, D.; Bowers, Y.; Theising, B.; Murphy, C.V.; et al. Analysis and functional classification of transcripts from the nematode Meloidogyne incognita. Genome Biol. 2003, 4, 1–19. [Google Scholar] [CrossRef] [Green Version]
- Dubreuil, G.; Magliano, M.; Deleury, E.; Abad, P.; Rosso, M.N. Transcriptome analysis of root-knot nematode functions induced in the early stages of parasitism. New Phytol. 2007, 176, 426–436. [Google Scholar] [CrossRef]
- Neveu, C.; Jaubert, S.; Abad, P.; Castagnone-Sereno, P. A set of genes differentially expressed between avirulent and virulent Meloidogyne incognita near-isogenic lines encode secreted proteins. Mol. Plant-Microbe Interact. 2003, 16, 1077–1084. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schaff, J.E.; Nielsen, D.M.; Smith, C.P.; Scholl, E.H.; Bird, D.M.K. Comprehensive transcriptome profiling in tomato reveals a role for glycosyltransferase in Mi-mediated nematode resistance. Plant Physiol. 2007, 144, 1079–1092. [Google Scholar] [CrossRef] [Green Version]
- Tanaka, S.E.; Dayi, M.; Maeda, Y.; Tsai, I.J.; Tanaka, R.; Bligh, M.; Takeuchi-Kaneko, Y.; Fukuda, K.; Kanzaki, N.; Kikuchi, T. Stage-specific transcriptome of Bursaphelenchus xylophilus reveals temporal regulation of effector genes and roles of the dauer-like stages in the lifecycle. Sci. Rep. 2019, 9, 1–13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bagnaresi, P.; Sala, T.; Irdani, T.; Scotto, C.; Lamontanara, A.; Beretta, M.; Rotino, G.L.; Sestili, S.; Cattivelli, L.; Sabatini, E. Solanum torvum responses to the root-knot nematode Meloidogyne incognita. BMC Genomics 2013, 14, 540. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shukla, N.; Yadav, R.; Kaur, P.; Rasmussen, S.; Goel, S.; Agarwal, M.; Jagannath, A.; Gupta, R.; Kumar, A. Transcriptome analysis of root-knot nematode (Meloidogyne incognita)-infected tomato (Solanum lycopersicum) roots reveals complex gene expression profiles and metabolic networks of both host and nematode during susceptible and resistance responses. Mol. Plant Pathol. 2018, 19, 615–633. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Choi, I.; Subramanian, P.; Shim, D.; Oh, B.J.; Hahn, B.S. RNA-seq of plant-parasitic nematode Meloidogyne incognita at various stages of its development. Front. Genet. 2017, 8, 7–9. [Google Scholar] [CrossRef] [Green Version]
- Tarr, D.E.K.; Scott, A.L. MSP domain proteins. Trends Parasitol. 2005, 21, 224–231. [Google Scholar] [CrossRef] [PubMed]
- McK Bird, D.; Williamson, V.M.; Abad, P.; McCarter, J.; Danchin, E.G.J.; Castagnone-Sereno, P.; Opperman, C.H. The genomes of root-knot nematodes. Annu. Rev. Phytopathol. 2009, 47, 333–351. [Google Scholar] [CrossRef] [PubMed]
- Keeling, P.J. Reduction and compaction in the genome of the apicomplexan parasite Cryptosporidium parvum. Dev. Cell 2004, 6, 614–616. [Google Scholar] [CrossRef] [Green Version]
- Opperman, C.H.; Bird, D.M.; Williamson, V.M.; Rokhsar, D.S.; Burke, M.; Cohn, J.; Cromer, J.; Diener, S.; Gajan, J.; Graham, S.; et al. Sequence and genetic map of Meloidogyne hapla: A compact nematode genome for plant parasitism. Proc. Natl. Acad. Sci. USA 2008, 105, 14802–14807. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ghedin, E.; Wang, S.; Spiro, D.; Caler, E.; Zhao, Q.; Crabtree, J.; Allen, J.E.; Delcher, A.L.; Guiliano, D.B.; Miranda-Saavedra, D.; et al. Draft genome of the filarial nematode parasite Brugia malayi. Science 2007, 317, 1756–1760. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kikuchi, T.; Cotton, J.A.; Dalzell, J.J.; Hasegawa, K.; Kanzaki, N.; McVeigh, P.; Takanashi, T.; Tsai, I.J.; Assefa, S.A.; Cock, P.J.A.; et al. Genomic insights into the origin of parasitism in the emerging plant pathogen Bursaphelenchus xylophilus. PLoS Pathog. 2011, 7. [Google Scholar] [CrossRef] [Green Version]
- Rehman, S.; Butterbach, P.; Popeijus, H.; Overmars, H.; Davis, E.L.; Jones, J.T.; Goverse, A.; Bakker, J.; Smant, G. Identification and characterization of the most abundant cellulases in stylet secretions from Globodera rostochiensis. Phytopathology 2009, 99, 194–202. [Google Scholar] [CrossRef] [Green Version]
- Rehman, S.; Gupta, V.K.; Goyal, A.K. Identification and functional analysis of secreted effectors from phytoparasitic nematodes. BMC Microbiol. 2016, 16, 1–18. [Google Scholar] [CrossRef] [Green Version]
- Trapnell, C.; Hendrickson, D.G.; Sauvageau, M.; Goff, L.; Rinn, J.L.; Pachter, L. Differential analysis of gene regulation at transcript resolution with RNA-seq. Nat. Biotechnol. 2013, 31, 46–53. [Google Scholar] [CrossRef]
- Ramsköld, D.; Wang, E.T.; Burge, C.B.; Sandberg, R. An abundance of ubiquitously expressed genes revealed by tissue transcriptome sequence data. PLoS Comput. Biol. 2009, 5, 1–11. [Google Scholar] [CrossRef]
- Walter, M.C.; Rattei, T.; Arnold, R.; Güldener, U.; Münsterkötter, M.; Nenova, K.; Kastenmüller, G.; Tischler, P.; Wölling, A.; Volz, A.; et al. PEDANT covers all complete RefSeq genomes. Nucleic Acids Res. 2009, 37, 408–411. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Conesa, A.; Götz, S.; García-Gómez, J.M.; Terol, J.; Talón, M.; Robles, M. Blast2GO: A universal tool for annotation, visualization and analysis in functional genomics research. Bioinformatics 2005, 21, 3674–3676. [Google Scholar] [CrossRef] [Green Version]
- Jan, C.H.; Friedman, R.C.; Ruby, J.G.; Bartel, D.P. Formation, regulation and evolution of Caenorhabditis elegans 3′UTRs. Nature 2011, 469, 97–103. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Betel, D.; Koppal, A.; Agius, P.; Sander, C.; Leslie, C. Comprehensive modeling of microRNA targets predicts functional non-conserved and non-canonical sites. Genome Biol. 2010, 11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Enright, A.J.; John, B.; Gaul, U.; Tuschl, T.; Sander, C.; Marks, D.S. MicroRNA targets in Drosophila. Genome Biol. 2003, 5, R1. [Google Scholar] [CrossRef] [Green Version]
- Krüger, J.; Rehmsmeier, M. RNAhybrid: MicroRNA target prediction easy, fast and flexible. Nucleic Acids Res. 2006, 34, 451–454. [Google Scholar] [CrossRef]
- Peterson, S.M.; Thompson, J.A.; Ufkin, M.L.; Sathyanarayana, P.; Liaw, L.; Congdon, C.B. Common features of microRNA target prediction tools. Front. Genet. 2014, 5, 1–10. [Google Scholar] [CrossRef] [Green Version]
- Ajjappala, H.; Chung, H.Y.; Sim, J.S.; Choi, I.; Hahn, B.S. Disruption of prefoldin-2 protein synthesis in root-knot nematodes via host-mediated gene silencing efficiently reduces nematode numbers and thus protects plants. Planta 2015, 241, 773–787. [Google Scholar] [CrossRef]
- Mani, V.; Reddy, C.S.; Lee, S.K.; Park, S.; Ko, H.R.; Kim, D.G.; Hahn, B.S. Chitin biosynthesis inhibition of Meloidogyne incognita by RNAi-mediated gene silencing increases resistance to transgenic tobacco plants. Int. J. Mol. Sci. 2020, 21, 6626. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Stage | Raw Seq * | High-Quality Seq * | Mapped Reads | Paired Reads | Mapping Ratio |
---|---|---|---|---|---|
Egg | 70,310,943 | 56,902,920 | 35,233,964 | 23,525,190 | 61.92% |
J2 | 61,150,827 | 50,762,456 | 26,034,163 | 15,437,817 | 51.31% |
J3 | 51,342,127 | 40,968,532 | 23,321,460 | 15,504,737 | 56.98% |
J4 | 58,016,948 | 47,309,223 | 26,676,718 | 15,897,997 | 56.40% |
Female | 64,618,511 | 51,730,234 | 28,551,685 | 16,472,789 | 55.23% |
Stage | Egg | J2 | J3 | J4 | Female | Unique |
---|---|---|---|---|---|---|
Number of genes | 15,798 | 15,564 | 14,908 | 15,226 | 14,519 | 17,423 |
Transcript ID | Gene ID | Locus * | Hit Description | E-Value |
---|---|---|---|---|
Egg | ||||
Minc04648a | Minc04648 | MiV1ctg109:43326-44000 | Putative uncharacterized protein hmg-1.1 (High mobility group protein 1.1)-Caenorhabditis elegans | 4.5 × 10−15 |
Minc18499a | Minc18499 | MiV1ctg2009:3204-5374 | CBR-SQT-2 protein-Caenorhabditis briggsae | 1.4 × 10−38 |
Minc08976 | Minc08976 | MiV1ctg306:49411-50078 | Acidic ribosomal protein-Ceratitis capitata (Mediterranean fruit fly) | 1.1 × 10−18 |
Minc06773a | Minc06773 | MiV1ctg191:65479-67430 | Actin-Panagrellus redivivus | 0 |
Minc00328a | Minc00328 | MiV1ctg4:84197-88448 | NA | NA |
J2 | ||||
Minc06998a | Minc06998 | MiV1ctg201:70539-71397 | FMRF-amide-like peptide 14-Meloidogyne incognita | 1.2 × 10−52 |
Minc18702 | Minc18702 | MiV1ctg2199:2335-4036 | NA | NA |
Minc16402 | Minc16402 | MiV1ctg1163:4158-4357 | NA | NA |
Minc07370 | Minc07370 | MiV1ctg219:88182-88607 | NA | NA |
Minc03882 | Minc03882 | MiV1ctg84:123564-124307 | NA | NA |
J3 | ||||
Minc18145a | Minc18145 | MiV1ctg1750:2047-6839 | Nematode cuticle collagen N-terminal domain-containing protein-Brugia malayi (Filarial nematode worm) | 7.3 × 10−34 |
Minc04518a | Minc04518 | MiV1ctg105:26001-27747 | Cuticle collagen-Meloidogyne incognita | 4.5 × 10−62 |
Minc06773a | Minc06773 | MiV1ctg191:65479-67430 | Actin-Panagrellus redivivus | 0 |
Minc18882 | Minc18882 | MiV1ctg2407:4325-4977 | NA | NA |
Minc18693 | Minc18693 | MiV1ctg2190:124-789 | NA | NA |
J4 | ||||
Minc04518a | Minc04518 | MiV1ctg105:26001-27747 | Cuticle collagen-Meloidogyne incognita | 4.5 × 10−62 |
Minc01401a | Minc01401 | MiV1ctg21:214717-219350 | COL-1-Meloidogyne incognita | 5.9 × 10−51 |
Minc08754 | Minc08754 | MiV1ctg293:33744-34125 | NA | NA |
Minc00801 | Minc00801 | MiV1ctg11:126856-128485 | NA | NA |
Minc18693 | Minc18693 | MiV1ctg2190:124-789 | NA | NA |
Female | ||||
Minc16604 | Minc16604 | MiV1ctg1209:9257-9418 | NA | NA |
Minc19059 | Minc19059 | MiV1ctg2663:360-638 | NA | NA |
Minc17994 | Minc17994 | MiV1ctg1660:2568-3249 | NA | NA |
Minc19141 | Minc19141 | MiV1ctg2796:3302-3931 | NA | NA |
Minc18070 | Minc18070 | MiV1ctg1703:2398-2962 | NA | NA |
Transcript ID | Gene ID | Locus * | Hit Description | E-Value |
---|---|---|---|---|
Minc01401a | Minc01401 | MiV1ctg21:214717-219350 | COL-1-Meloidogyne incognita | 5.9 × 10−51 |
Minc04648a | Minc04648 | MiV1ctg109:43326-44000 | Putative uncharacterized protein hmg-1.1 (High mobility group protein 1.1)-Caenorhabditis elegans | 4.5 × 10−15 |
Minc01079 | Minc01079 | MiV1ctg16:17706-18709 | SEC-2 protein-Globodera pallida | 1.6 × 10−45 |
Minc08986 | Minc08986 | MiV1ctg307:10895-11969 | SEC-2 protein-Globodera pallida | 1.6 × 10−45 |
Minc18499a | Minc18499 | MiV1ctg2009:3204-5374 | CBR-SQT-2 protein-Caenorhabditis briggsae | 1.4 × 10−38 |
Minc08976 | Minc08976 | MiV1ctg306:49411-50078 | Acidic ribosomal protein-Ceratitis capitata (Mediterranean fruit fly) | 1.1 × 10−18 |
Minc16667a | Minc16667 | MiV1ctg1222:13554-14957 | Vasa-related protein CnVAS1-Hydra magnipapillata | 1.1 × 10−19 |
Minc06773a | Minc06773 | MiV1ctg191:65479-67430 | Actin-Panagrellus redivivus | 0 |
Minc00801 | Minc00801 | MiV1ctg11:126856-128485 | NA | NA |
Minc02143 | Minc02143 | MiV1ctg39:10470-10990 | NA | NA |
Minc02293 | Minc02293 | MiV1ctg42:40801-41759 | NA | NA |
Minc03882 | Minc03882 | MiV1ctg84:123564-124307 | NA | NA |
Minc11652 | Minc11652 | MiV1ctg495:37571-37982 | NA | NA |
Minc18693 | Minc18693 | MiV1ctg2190:124-789 | NA | NA |
Stage | miRNA | miRBase Reference | Sequence | mRNA Gene ID | mRNA Transcript ID | Number of mRNA Hits in Target Prediction | Hit Description |
---|---|---|---|---|---|---|---|
Egg-specific | MI00282, MI00853, MI02967, MIN00081 | ptr-miR-3138, hsa-miR-5196-5p, bmo-miR-3374-5p, Novel | AAGGAGGGAGAGGGAATG, AGGGAAGGGAGAGAGGGAGGGG, TGAAGAGCACGGATGTTGAAGGGC, AGGGGAAAGGGCGAGGAGGGG | Minc04914 | Minc04914a, Minc04914b, Minc04914c | 12 | Transcription factor unc-3 (Uncoordinated protein 3) (CEO/E)-Caenorhabditis elegans |
Egg-specific | MI00870, MI01912, MI02333, MI03713, MIN00025, MIN00050, MIN00126, MIN00199, MIN00335 | hsa-miR-5001-5p, hsa-miR-761, mmu-miR-6944-5p, aga-miR-210, Novel, Novel, Novel Novel Novel | AGGGCTGGACTCAACTGCGGATTGCGT, GCAGAGAGGGTGAAACTGAAC, GTGGAGGGGGGGGAGGGCAA, TTGTGGGGTGTCAACGGCATA, AAGGGAAGGGAAGGGAAGGG, ACTAGAGATCGAGCTGGGCCTG, CCGGACTGGATCCGGCCGGATTT, GGGGGATGACATTGTAATTGAACA, TGGTGTATCTTGTATTGTGGGTA | Minc08454, Minc00238 | Minc08454, Minc00238 | 9 | CBR-HSP-12.2 protein-Caenorhabditis briggsae |
Egg-specific | MI00353, MI00820, MI01640, MI02876, MI03247, MI03634, MIN00334 | cte-miR-2f, cbr-miR-73b, cgr-miR-671-5p, mmu-miR-6336, gga-miR-6645-5p, hsa-miR-3064-3p, Novel | AATCAAGTCGGATTTGGTTGAT, AGGCAAGATGTTGGCATTGTCGAT, GAAAGCCTGGAGCGGCTGGAGTG, TCTCGGATTTAGTAAGAACGGCC, TGGAGGATGTAGCAGTGGTGGCGGA, TTGCCCAACTGAACAATCCTTACA, TGGTCTGTCAGTCATAGGTTAT | Minc13215, Minc14656 | Minc13215, Minc14656 | 7 | CAP-Gly domain-containing protein-Brugia malayi (Filarial nematode worm) |
Egg-specific | MI00171, MI02031, MI02967 | ame-miR-6053, hsa-miR-1273f, bmo-miR-3374-5p | AACGAAGACCGCGGCGGAGCTGT, GGAGACGGATGGTTGCAG, TGAAGAGCACGGATGTTGAAGGGC | Minc05892, Minc03605 | Minc05892, Minc03605 | 6 | DNA excision repair protein ERCC-6, putative-Brugia malayi (Filarial nematode worm) |
Egg-specific | MI01244, MI01640, MI01891, MI02222, MI02986, MIN00058 | gga-miR-1583, cgr-miR-671-5p, mml-miR-7175-3p, dme-miR-4971-5p, ptr-miR-4660, Novel | CAAGGGACTGGGACGGCA, GAAAGCCTGGAGCGGCTGGAGTG, GCAACATATGGTTGAGAGGACTGG, GGTTGAGTTGTCGGAGGTGGCGGA, TGACAGATTGGTGGAAAGATTGGA, AGAGACCGGACTGGGAGTGTCG | Minc07882 | Minc07882 | 6 | Mothers against dpp protein-Aedes aegypti (Yellow fever mosquito) |
J2-specific | MI02742 | hsa-miR-8063 | TCAAAAAGAAGTCGGGGGTT | Minc15286 | Minc15286a, Minc15286b, Minc15286c | 3 | SAC3/GANP family protein-Brugia malayi (Filarial nematode worm) |
J2-specific | MI00606 | ggo-miR-320b | AGAAGTTGGATTGAGAGGGA | Minc02238, Minc14931 | Minc02238, Minc14931 | 2 | Ab1-108-Rattus norvegicus (Rat) |
J2-specific | MI02073, MI03005 | gga-miR-6627-3p, ppy-miR-4667 | GGATGAAGACGATGATGCTGAGGA, TGACTGGAGGAGGAGGAGGAA | Minc19110 | Minc19110 | 2 | CG32584-PB, putative-Brugia malayi (Filarial nematode worm) |
J2-specific | MI00699 | pma-miR-4546 | AGCAGAAGTCGTAGTGGAAG | Minc04635, Minc03649 | Minc04635, Minc03649 | 2 | CG6766-PA, putative-Brugia malayi |
J2-specific | MI02028 | bta-miR-2486-5p | GGAGAAGACGGGGGTGGTGGTGGG | Minc11989 | Minc11989a, Minc11989b | 2 | Dnaja2-prov protein-Xenopus laevis (African clawed frog) |
J3-specific | MI01281, MI03334 | gga-miR-6711-5p, ame-miR-3739 | CAGATTGGGATAGAAAGAAGCA, TGGGAGGGGGGAGAGAGAT | Minc11006 | Minc11006 | 2 | CBR-WWP-1 protein-Caenorhabditis briggsae |
J3-specific | MI02003 | dsi-miR-1003-5p | GCTGGGCTGTCTGGTGTGGTTGG | Minc06126, Minc02988 | Minc06126, Minc02988 | 2 | MBOAT family protein-Brugia malayi (Filarial nematode worm) |
J3-specific | MI03334, MI03358 | ame-miR-3739, hsa-miR-6887-5p | TGGGAGGGGGGAGAGAGAT, TGGGGAGGAAGAGGAGGAGGACA | Minc10383 | Minc10383 | 2 | MSP domain protein-Brugia malayi |
J3-specific | MI02164, MI02411 | hsa-miR-6752-5p, gga-miR-6607-5p | GGGGGTTGTGGAGGAGGGGG, GTTGGTGGAGGAAGTGGAGGTGG | Minc16144 | Minc16144 | 2 | Putative uncharacterized protein ptr-14-Caenorhabditis elegans |
J3-specific | MI02039, MI03235 | mmu-miR-6370, mmu-miR-1940 | GGAGGAACGAGCAAAGGAGGAACGC, TGGAGGACGAGGAGGTGGAGGGTT | Minc04418 | Minc04418 | 2 | Ras-related protein Rab-35, putative-Brugia malayi (Filarial nematode worm) |
J4-specific | MI03383 | dme-miR-1003-5p | TGGGGGTTGGTGTGGTTGG | Minc10127 | Minc10127a, Minc10127d, Minc10127e | 3 | Troponin t protein 2, isoform a-Caenorhabditis elegans |
J4-specific | MI01803 | sme-miR-13-5p | GAGGCTTTGGAGGCGGCTGTGATACT | Minc11517, Minc15705 | Minc11517, Minc15705 | 2 | RNA polymerase Rpb7, N-terminal domain-containing protein-Brugia malayi (Filarial nematode worm) |
J4-specific | MI00298 | mmu-miR-6978-5p | AAGGGATGAAGGGAGAAGCTGGT | Minc09642 | Minc09642 | 1 | 40S ribosomal protein S2, putative-Brugia malayi |
J4-specific | MI00936 | bmo-miR-750-5p | AGTGGACAGGGAGATGCTTGGAAA | Minc08802 | Minc08802 | 1 | Alpha amylase, catalytic domain-containing protein-Brugia malayi |
J4-specific | MI03777 | crm-miR-239b | TTTGTACTAGCCAAAATCTCTGCA | Minc14488 | Minc14488 | 1 | Carbonic anhydrase like protein 2, putative-Brugia malayi (Filarial nematode worm) |
Female-specific | MI03351 | hsa-miR-4467 | TGGGCGGCGGTAGGTTGGGCT | Minc06509 | Minc06509a, Minc06509d | 2 | Probable molybdopterin-binding domain-containing protein-Brugia malayi (Filarial nematode worm) |
Female-specific | MI02846, MIN00138 | hsa-miR-6749-5p, Novel | TCGGGTGGGGGTGGGGGAGGC, CGGGGAGCGTTGGAGGATGACT | Minc15474 | Minc15474 | 2 | SUMO-activating enzyme subunit 2 (EC 6.3.2.-) (Ubiquitin-like 1 activating enzyme E1B) (Anthracycline-associated resistance ARX)-Homo sapiens (Human) |
Female-specific | MIN00243, MIN00364 | Novel Novel | GTTGATTCTCGGTCTCGGTCTC, TTGGGTGCTGGTGGAGGAGGGG | Minc09957 | Minc09957 | 2 | Transient-receptor-potential-like protein (TRP homologous cation channel protein 1)-Caenorhabditis elegans |
Female-specific | MIN00243 | Novel | GTTGATTCTCGGTCTCGGTCTC | Minc09158 | Minc09158 | 1 | 1,4-alpha-glucan branching enzyme, putative (EC 2.4.1.18)-Brugia malayi (Filarial nematode worm) |
Female-specific | MIN00207 | Novel | GGTGTCGATGTAGCTAGTGGTGAC | Minc00048 | Minc00048 | 1 | Adenylyl cyclase protein 2-Caenorhabditis elegans |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mani, V.; Assefa, A.D.; Hahn, B.-S. Transcriptome Analysis and miRNA Target Profiling at Various Stages of Root-Knot Nematode Meloidogyne incognita Development for Identification of Potential Regulatory Networks. Int. J. Mol. Sci. 2021, 22, 7442. https://doi.org/10.3390/ijms22147442
Mani V, Assefa AD, Hahn B-S. Transcriptome Analysis and miRNA Target Profiling at Various Stages of Root-Knot Nematode Meloidogyne incognita Development for Identification of Potential Regulatory Networks. International Journal of Molecular Sciences. 2021; 22(14):7442. https://doi.org/10.3390/ijms22147442
Chicago/Turabian StyleMani, Vimalraj, Awraris Derbie Assefa, and Bum-Soo Hahn. 2021. "Transcriptome Analysis and miRNA Target Profiling at Various Stages of Root-Knot Nematode Meloidogyne incognita Development for Identification of Potential Regulatory Networks" International Journal of Molecular Sciences 22, no. 14: 7442. https://doi.org/10.3390/ijms22147442
APA StyleMani, V., Assefa, A. D., & Hahn, B.-S. (2021). Transcriptome Analysis and miRNA Target Profiling at Various Stages of Root-Knot Nematode Meloidogyne incognita Development for Identification of Potential Regulatory Networks. International Journal of Molecular Sciences, 22(14), 7442. https://doi.org/10.3390/ijms22147442