Next Article in Journal
Functional Comparison between VP64-dCas9-VP64 and dCas9-VP192 CRISPR Activators in Human Embryonic Kidney Cells
Next Article in Special Issue
Expression of Flavodiiron Proteins Flv2-Flv4 in Chloroplasts of Arabidopsis and Tobacco Plants Provides Multiple Stress Tolerance
Previous Article in Journal
The Paradox Effect of Calcification in Carotid Atherosclerosis: Microcalcification Is Correlated with Plaque Instability
Previous Article in Special Issue
Physiological, Biochemical, and Transcriptomic Responses of Neolamarckia cadamba to Aluminum Stress
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

First Report of CRISPR/Cas9 Mediated DNA-Free Editing of 4CL and RVE7 Genes in Chickpea Protoplasts

The Pangenomics Lab, School of Science, RMIT University, Melbourne 3000, Australia
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2021, 22(1), 396; https://doi.org/10.3390/ijms22010396
Submission received: 3 December 2020 / Revised: 28 December 2020 / Accepted: 29 December 2020 / Published: 1 January 2021
(This article belongs to the Special Issue Drought Stress Tolerance in Plants)

Abstract

The current genome editing system Clustered Regularly Interspaced Short Palindromic Repeats Cas9 (CRISPR/Cas9) has already confirmed its proficiency, adaptability, and simplicity in several plant-based applications. Together with the availability of a vast amount of genome data and transcriptome data, CRISPR/Cas9 presents a massive opportunity for plant breeders and researchers. The successful delivery of ribonucleoproteins (RNPs), which are composed of Cas9 enzyme and a synthetically designed single guide RNA (sgRNA) and are used in combination with various transformation methods or lately available novel nanoparticle-based delivery approaches, allows targeted mutagenesis in plants species. Even though this editing technique is limitless, it has still not been employed in many plant species to date. Chickpea is the second most crucial winter grain crop cultivated worldwide; there are currently no reports on CRISPR/Cas9 gene editing in chickpea. Here, we selected the 4-coumarate ligase (4CL) and Reveille 7 (RVE7) genes, both associated with drought tolerance for CRISPR/Cas9 editing in chickpea protoplast. The 4CL represents a key enzyme involved in phenylpropanoid metabolism in the lignin biosynthesis pathway. It regulates the accumulation of lignin under stress conditions in several plants. The RVE7 is a MYB transcription factor which is part of regulating circadian rhythm in plants. The knockout of these selected genes in the chickpea protoplast using DNA-free CRISPR/Cas9 editing represents a novel approach for achieving targeted mutagenesis in chickpea. Results showed high-efficiency editing was achieved for RVE7 gene in vivo compared to the 4CL gene. This study will help unravel the role of these genes under drought stress and understand the complex drought stress mechanism pathways. This is the first study in chickpea protoplast utilizing CRISPR/Cas9 DNA free gene editing of drought tolerance associated genes.

1. Introduction

CRISPR/Cas9 based gene editing has revolutionized targeted gene editing in plants in recent years [1,2,3,4,5,6,7,8,9,10]. The CRISPR/Cas9 method of gene editing is based on a natural immune system used by bacteria to prevent infection by viruses [11]. However, recently this mechanism was used for genetically editing DNA of interest. CRISPR/Cas9 genome editing has broad application in crop improvement and can be used to develop designer genetically edited non-GM crops. A key focus of agricultural scientists is the implementation of this approach to plant breeding for the development of new varieties of crops with higher tolerance to environmental constraints [11,12]. The most recent approach to genetic engineering is genome editing by programmable endonucleases. In CRISPR/Cas9 gene editing, Cas9 endonuclease enzyme is explicitly used for inducing double strand breaks in target genes of interest. However, to restore the damage by the double-strand break, the cellular DNA repair pathway then acts through non-homologous end joining (NHEJ) or homology-directed repair (HDR) systems. Insertions, deletions, base substitutions, and DNA recombination can occur in the repair mechanism process, leading to a frameshift of the sequence [13,14].
CRISPR/Cas9 gene-editing tools have been utilized for gene activation, repression, knockout, knockdown, repression, and for altering epigenetic modifications in several plants crops such as Arabidopsis [15], apple [8], citrus, carrot [16], grape [17], tomato [18], rice [19], sorghum [20], maize and soybean [21], and wheat [22]. However, gene free editing has effectively been achieved in only a few crop varieties such as Arabidopsis [23], bread wheat [4], grapevine, and apple [6]. For example, CRISPR/Cas9 genome editing was used to identify abiotic stress response in Arabidopsis plants; the results suggested that OST2 (proton pump), a mutant allele obtained from editing, altered stomatal closing under environmental stress [8]. Another recent study in maize used the CRISPR/Cas9 system to produce novel allelic variations which could be used for breeding drought-tolerant crops. ARGOS8, whose overexpression can lead to reduced ethylene sensitivity, was genetically modified by this system and field studies revealed that ARGOS8 variants had increased grain yield under drought stress; further, no loss in yield was recorded under well-watered conditions [24].
Global climate change and population increase have put pressure on the agriculture industry to improve productivity, leading to the development of new, improved technologies associated with enhancing the ability of crops to continue to be productive under sub-optimal conditions such as elevated temperature and reduced moisture availability. There remains an urgent need for DNA-free gene editing because there are always chances of foreign DNA integration using plasmid-mediated approaches to gene editing [25]. Current genetically modified organisms (GMO) regulations are stringent, making it challenging to produce commercial genetically modified food crops [10].
Due to its high nutritional value chickpea is the second largest internationally produced cool-season food legume. To date, a low degree of intraspecific genetic diversity has limited success in increasing the yield and quality of cultivated chickpeas. Croser et al. proposed that increased genetic diversity can be achieved from within the forty-three species of the Cicer genus by hybridizing the cultivated species with unimproved ‘wild’ relatives to integrate beneficial traits from the eight species that share an annual growth habit and chromosome number with cultivated chickpea. Furthermore, the morphological characteristics and tolerance to a variety of abiotic and biotic stresses of potential advantage to chickpea improvement programs have been identified in the screening process [26]. Consequently, for the development of transgenic chickpea plantlets derived from embryonic axis co-cultivation, Agrobacterium-mediated transformation and other standard protocols have been developed [27,28]. However, only a few reports on the use of genetic transformation/transgene(s) for the development of abiotic stress tolerance transgenic chickpea plants have been published [29,30,31]. Transgenic chickpeas have been developed based on the insertion of the abiotic stress-tolerant bacterial codA gene. Anwar et al. concluded that the application of genomic techniques for the analysis of the chickpea genome and improvement of chickpea would be significantly facilitated by the development of a robust and reproducible genetic transformation method [27]. Chickpea CarNac3 transgene showed increased drought tolerance in poplar plants [32]. Hajyzadeh et al. identified that the overexpression of miR408 leads to drought tolerance in chickpea [33]. One of the significant constraints in terms of chickpea production is drought stress. Many previous studies have focused on this issue using genetic engineering of chickpea cultivars [30,31,32,33,34,35]. However, recent innovations in in vitro culture and gene technology give unique opportunities to the full potential of the cultivation of chickpeas using these new technologies. Regrettably, no transgenic chickpea variety in the world has been approved for cultivation [36].
In this study, two potential drought tolerance genes were selected for transformation in a commercial Kabuli chickpea genotype. The 4-coumatrate: CoA ligase gene codes for coumarate ligase enzyme which is well known for its role in the biosynthesis of secondary plant metabolites during phenylpropanoid metabolism and in major branch pathways [37,38,39]. This phenylpropanoid enzyme is essential for the activation of the hydroxycinnamic acids during lignin biosynthesis. A study in Arabidopsis showed that a decrease in 4CL activity correlated with a reduction in thioglycolic acid extractable lignin [38]. Further, the increased expression of the lignin biosynthesis gene was observed in watermelon during water stress [40].
RVE7 is a gene that encodes the transcription factor involved in circadian rhythm and the opening of cotyledon mediated by phytochrome A. The regulation of the RVE7 gene is controlled by LHY and CCA1 central oscillator mediation. It is known to regulate its expression and belongs to part of the circadian feedback [41]. RVE7 is active in controlling the circadian clock’s downstream processes such as hypocotyl growth and flowering [42]. Transcription factors such as REVEILLE 2 (RVE2), RVE7, RVE8, and MYB HYPOCOTYL ELONGATION-RELATED (MYBH) act in ways like CCA1 and LHY1.1,3,4,6,9–14 on the circadian clock. RVE7/EARLY-PHYTOCHROME-RESPONSIVE1 (EPR1) was found to be phytochrome A and phytochrome B regulated and to work as a slave oscillator part [42,43]. Studies of other clock related MYB proteins demonstrated that these variables have a less prime role in regulating TOC1 expression. RVE7/EPR1 does not control the expression of CCA1, LHY, or TOC1, although these oscillator components are involved in the circadian regulation of RVE7/EPR1 [44].
Here, a pilot study was conducted to knockout the 4CL and RVE7 genes in the chickpea protoplast to help understand the drought response mechanism in chickpea. The main aim of this study was to conduct CRISPR/Cas9 for the polygenic adaptive trait (i.e., drought tolerance) and propose the method for the use of DNA free gene editing in recalcitrant species. Figure 1 provides an overview of CRISPR/Cas9 gene-editing process and how it was employed in this study.

2. Results

2.1. sgRNA Selection and Design

Two candidate genes (4CL and RVE7) which are potentially associated with drought tolerance in chickpea were selected for the knockout in chickpea protoplasts. The sgRNA for the target location were designed using CHOPCHOP and verified by other tools such as CCTop using the genome sequence for Kabuli chickpea. The preferred sgRNA based on the target selection algorithm were selected for further studies. The illustration of the location of sgRNA target sites in RVE7 and 4CL nucleotide sequences is shown in Figure 2.

2.2. sgRNA Selection and Design In Vitro Digestion Assay

The primary step for the CRISPR/Cas9 gene editing is the selection of sgRNA sequences for target knockout. Two sets of sgRNA were designed using CHOPCHOP and were tested in vitro for their efficacy. In order to determine the specificity of the target sgRNA sequences, a 5 kb region around the target regions were amplified. Primers were designed to amplify the target region for both target genes and in vitro cleavage assay was conducted using the respective purified PCR products and preassembled RNPs. The in vitro digestion shows that individual band sizes were achieved with both sgRNA sets in RVE7 and 4CL amplified fragments (Figure 3). The sequences used for the amplification of DNA and position of the sgRNA sequences are provided in Supplementary Material 1 and 2.

2.3. Protoplast Isolation and Transformation

Protoplasts were isolated using the BioWORLD kit with minor modifications. The protoplast was isolated from young chickpea leaves from 4 to 5-week-old plants (Figure 4). The viability and protoplast number were lower initially but optimized by changing the leaf maturity, amount of leaves used, centrifugation speed, and time for the enzymatic digestion.

2.4. Mutation Detection

Sanger sequencing was performed to detect mutations in the transfected protoplasts. The DNA was isolated from the transformed protoplast, and target regions were amplified using primer sets to conduct sequencing. The PCR program for sequencing samples is also provided in Table S2 and the PCR reaction to amplify the sequencing fragment is provided in Table S4. The results obtained from Sanger sequencing are classically given as nucleotide occurrence chromatograms for respective samples, represented as distinct colored peaks. Usually, the biggest drawback in protoplast mutation identification is that mutated protoplast DNA chromatograms do not provide any apparent indication of the mutation due to the difference in editing forms in each protoplast cells and the presence of unmutated protoplast cell DNA in each sample. To overcome these challenges, Inference of CRISPR Edits (ICE), a bioinformatics tool by Synthego, was used for mutation detection [45] The RVE7 sgRNA 1 results showed 76%, 77%, and 79% indel percentage for the treated protoplast samples compared to the 99% for control sample, with average of 77.3% and standard deviation of 0.81 for all treated samples (Figure 5 and Figure 6). Indel percentage is the editing efficiency (percentage of the pool with non-wild type sequence) as determined by comparing the edited trace to the control trace. The knockout score represents the proportion of cells that have either a frameshift or 21+ bp indel. The knockout score is used in an understanding of the number of the contributing indels expected to result in a functional knockout of the target gene.
The sequencing samples for 4CL sgRNA 1 were also analyzed using the ICE tool. However, in 4CL samples only one sample showed +1 indel with knockout score of 2%, shown in sequence and trace plot (Figure 7). Nevertheless, all other 4CL test samples showed no indel percentage. The sgRNA 2 sequencing results were low quality and did not fit the threshold values for ICE software.

3. Discussion

The simplicity of the CRISPR/Cas9 system offers agricultural scientists an opportunity to edit a gene of interest at almost any laboratory-based facility effectively and economically. Successful DNA-free editing with the CRISPR/Cas9 system is important for crops such as chickpea, due to the crop’s high demand and export value but low productivity because of challenging climatic conditions. The main drawback of plasmid-mediated delivery in genome editing is the possibility of random integration of plasmid sequence in the host genome. In addition, the current GMO regulations and the complication of commercialization of genetically edited varieties makes DNA-free gene editing more suitable compared to traditional gene editing techniques [6]. It will help to grow crops that are resistant to different biotic and abiotic stresses if the CRISPR/Cas9 technique can gain social acceptance and still comply with the strict regulations set by global and local authorities. Moreover, other techniques used for gene editing, due to the random nature of the gene integration such as random mutagenesis, are not able to control every gene in the process. With the aid of precise genes used by the CRISPR/Cas9 method, genes can be altered in crops without the introduction of a transgene [11].
However, while the CRISPR/Cas9 system appears to be extremely promising in many crop improvement areas and might even be omitted from the current GMO legislation, there are some factors that need to be noted. To acquire social acceptance of DNA-free genome editing, social impact understanding is very critical because society needs to understand how the method functions. It is a necessity to educate society that the final products from this technique are not considered GMOs [11,45]. An obstacle to this is the confusion about possible side effects on modified crops. Moreover, it is clear that the potential this system has for the world’s food supply scarcity will largely depend on the society’s perception of the crops that have been modified with CRISPR/Cas9 [46].
Due to limited CRIPSR editing studies conducted in legumes, although it is difficult to achieve high-quality results, it is a necessary journey of discovery. Due to technical complications in developing stable transgenic chickpeas and the absence of a steady transient system of expression for rapid analysis of gene expression and function, there is a requirement to conduct further studies in this area. To our knowledge, this is the first study to achieve the knockout of two drought tolerance associated genes in chickpea protoplast.
The viability of the isolated protoplast was lower when older leaves were used for protoplast isolation compared to young leaves. It is important to check the viability of the protoplast during the transfection experiment. Cheng and Nakata in a recent study suggested that viability of the isolated chickpea protoplasts should be monitored at different steps in the transfection process [47]. Here, in this study, the Sanger sequencing results showed higher editing efficiency for the RVE7 gene compared to the 4CL gene. It was observed that even if the sgRNA selected for the knockout works effectively during the in vitro digestion assay, it does not necessarily translate to reliable in vivo editing of the gene. Out of the two sgRNAs selected for the knockout, only one showed in vivo effectiveness. Recently, a study in N. benthamiana to evaluate sgRNA efficiency using different online tools found no significant correlation between the predicted rankings and the editing frequencies in vivo in the transformation of N. benthamiana compared to in vitro CRISPR digestion [48]. Further, a study in wheat showed that the PinB-D gene had 0% editing efficiency in wheat protoplasts; however, the sgRNA showed optimum results during in vitro digestion [49]. Here, the 4CL protoplast sample only showed a 2% knockout score which may be due to sequencing artefacts or the presence of a target site in the conserved domain of the gene which made access to the RNP complex difficult. Therefore, the most likely reason for unedited protoplast cells could be the inaccessibility of the target site by the RNP complex in the in vivo environment. Amongst the various limitations of the CRISPR/Cas9 gene editing in plants, the most significant is a recalcitrant sgRNA/target site due to chromatin conformation [48,50]. A study in cucumber reported the occurrence of chromatin structural rearrangements during the de-differentiation of protoplasts with no obvious change in the expression profile [51]. Studies have confirmed that certain sgRNAs may show low efficiencies or may even fail to work in many setups, which may occur due to the chromatin states of the target loci, unwanted hairpin structures of selected sgRNA, or additional unidentified factors [52]. In this study, the main objectives were to set up a CRISPR/Cas9 system for chickpea to knockout two potential drought tolerance candidates using protoplast cells in vivo. In mammalian cells, many studies have shown that conformation of the chromatin surrounding a sgRNA/Cas9 target site may significantly affect the site’s accessibility to the RNP complex [50,53].
Interestingly, in plants, the tools used to design the sgRNA does not take the chromatin conformation into account when predicting sgRNAs because of the lack of knowledge of the epigenetic profiling in many plant genomes [48]. In addition, the secondary structures of sgRNAs are proposed to have a critical consequence for Cas9/sgRNA effectiveness in many studies [54,55,56]. A study in rice reported relatively higher editing efficiencies in target sequences with greater GC content. It is therefore desirable to pick targets with a GC content between 50 and 70%, and those with less or no base pairing with the sgRNA sequence. The use of higher GC content target sequences may theoretically contribute to a greater risk of off targeting [57]. A study in rice reported reduced editing efficiency of the Os07g0261200 gene due to the low GC content (35%) of the target sequence [58].
Further, the inaccessibility of the RNP complex in the 4CL target site may also be due to the biological function of this gene. Generally, the 4CLs are known to play a vital role in generating Coenzyme A (CoA) esters within the phenylpropanoid pathway. This channels carbon flow into various secondary phenolic metabolism branching pathways, producing different groups of secondary natural phenolic products, including flavonoids, lignin, suberins, and coumarins, which play an essential role in the growth of plants and environmental interactions [59,60]. Hu et al. proposed that the lignin content in maize leaf can play an important role in drought tolerance and needs to be further explored as a molecular marker for drought tolerance traits [61]. A recent study in cotton by Sun and others suggested that Gh4CL7-silencing amplified sensitivity to drought stress. However, the overexpression enhanced drought tolerance, which indicates the function of 4CL genes and their potential role in drought tolerance [62]. Another recent study in chickpea identified metabolic pathways that are differentially regulated in different genotypes; for example, phenylpropanoid metabolism, and biological processes such as stomatal development with potential consequences for drought tolerance [63]. RVE7 and other family members are well known for their role in the circadian clock, which coordinates biological processes related to daily and seasonal environmental changes [42,64]. The information available so far suggests the importance of exploring the roles of these candidate genes to establish the basis of drought tolerance in chickpeas. The drought tolerance pathways play a significant role in the activation of signaling mechanisms and differentially expressed genes. The manipulation of the novel candidate genes identified may help to achieve the drought resilient chickpea varieties. Climate change has already affected many crops worldwide, but it is expected to go beyond the drought tolerance and will impact mineral nutrient availability and accumulation to the plants and soil. It is predicted that the microorganisms will be affected by global climate which will further affect the plant-soil interactions [65]. The protoplast transformation method presented here in chickpea can be utilized as a screening protocol for in vivo efficiency of the selected sgRNAs for a target site. This will save not only time but also resources, avoiding the selection of sgRNAs which may not be accessible for in vivo editing. Confirmation of the target editing in the protoplast can be set closer to the actual editing in plants. The RNP complex for RVE7 designed in this study can be used in future for producing CRISPR-edited chickpea plants and validating the physiological role of this gene in chickpea.

4. Conclusions

This study is the first proof of concept study which shows that CRISPR/Cas9 gene editing can be employed to achieve targeted genome editing in chickpea protoplasts. The results obtained from this study could help in developing new traits and understanding the drought mechanism in chickpea plants by knocking out the desired gene, followed by protoplast regeneration or using the plant tissue for transformation. In several plant species the transient expression systems have been demonstrated to be helpful in rapid high-throughput screening and systematic characterization of interesting genes and proteins. Such transient expression systems are particularly important in plants where stable transformation protocols are time-consuming and inefficient. The transient chickpea expression system using protoplasts presented in this study can be used as an effective method to help harness the cumulative amounts of existing genomic data resources and can also be used to speed up the discovery of genes that survive drought and improve crop characteristics in this essential legume crop. The functional validation of the genes studied in this study should be performed to understand their individual role in the drought tolerant genotypes. The particular effect of the successful knockout under drought stress imposition needs to be further studied. As fewer studies have been conducted on the role of these genes in the drought mechanism, establishing more stringent experiments using NGS and qPCR for expression profiles and microscopy to examine the structural changes will be of great importance for the development of new chickpea varieties.

5. Materials and Methods

5.1. Chickpea Plant Material and Cas9 Protein

Commercial Kabuli chickpea plants were grown in a glasshouse facility at RMIT Bundoora campus. The 1.5 g leaf tissue from young chickpea plants was collected for the protoplast isolation. The recombinant S. pyogenes Cas9 nuclease (Integrated DNA Technologies, IDT, Coralville, IA, USA), purified from an E. coli strain expressing the nuclease was used in this study. It consisted of a nuclear localization sequence (NLS) and C-terminal 6-His tag, which is provided in solution at 10 µg/µL. The components of the crRNA:tracrRNA duplex were Alt-R® CRISPR-Cas9; crRNA contained the target-specific sequence for guiding Cas9 protein to the genomic location of the selected target sequences, and Alt-R® CRISPR-Cas9 had tracrRNA which hybridizes to crRNA to activate the Cas9 enzyme. The required dilution was performed according to the manufacturer’s protocol under controlled conditions.

5.2. Target Site Selection and sgRNA Design

Two potential drought tolerance associated genes (4CL and RVE7) were selected for knockout based on their expression levels in ICC283 (drought sensitive genotype) and ICC8261 (drought tolerant genotype) under drought stress. The expression levels for the selected genes are shown in Table 1.
The sgRNA targets were designed using CHOPCHOP tool [66]. CHOPCHOP can predict the frameshift rate of each gRNA which are target sites for high-efficiency editing. All the recommended parameters were selected for the range of sgRNA sequences; for traditional Cas9 (20bp-NGG), preferred features for effective sgRNA include: gRNA has no off-targets; gRNA is expected to target all isoforms of the target gene and gRNA downstream of any in-frame ATG to avoid the expression of truncated proteins. Based on these selection criteria, the top sgRNA were selected for the knockout experiments. The sgRNA used in this study are shown in Table 2 below.

5.3. In Vitro Cleavage Assay

The 5 Kb DNA fragments for selected target genes containing the target site were amplified using PCR, purified, and eluted with RNase-free water. The RNP complex was prepared according to manufacturer’s instructions and 1 μM RNP was mixed with the purified target DNA (100–150  ng) in 10 X Cas9 reaction buffer (20 mM HEPES, pH 7.5, 150  mM KCl, 10  mM MgCl2, 0.5  mM DTT) in a total volume of 10 μL, followed by digestion at 37  °C for 60 min. Further, to release the DNA substrate from the complex, 1 μL proteinase K was added to reaction and incubated for 10 min at 56 °C (https://sg.idtdna.com/pages/support/guides-and-protocols). The digested DNA products for respective samples were separated on a 2% agarose gel immediately after the digestion process, and cleavage activity was measured by the number of digested products over the total amount of input target DNA. The obtained DNA bands were quantified using Gel quantification software (ChemiDoc imaging system, BIO-RAD, Hercules, CA, USA). The in vitro digestion assay was performed before every transformation to confirm that the RNP complex was functional and capable of editing the respective genes.

5.4. Protoplast Isolation

Leaf tissue from Kabuli chickpea was collected to produce protoplasts using a Plant Media Protoplast Isolation kit (PlantMedia™, a division of bioWORLD, Visalia, CA, USA, Catalog no. SKU# 30210002-1) using a slightly modified protocol. Briefly, 1.5 g fresh plant leaf tissue was surface sterilized by 2% bleach followed by three distilled water washes for 5 min each. The leaf tissue was sliced thinly and resuspended in distilled water in 50 mL tubes and centrifuged at 300× g in a swinging bucket rotor for 10 min at room temperature. Suspended cells were washed with 5 mL cell wall wash buffer. Pellets were resuspended in 5 mL of ice-cold protoplast enzyme solution and transferred to a 25 mL flask. The flasks were kept at room temperature for 5 h in the dark with gentle agitation at 100–150 rpm. The protoplast formation was checked in using 10 μL of suspension on a cell counter and microscope. The protoplast suspension was centrifuged in 50 mL tubes at 300× g for 5 min at 4 °C. The protoplasts were washed twice by resuspending the pellet in 5 mL of ice-cold protoplast wash solution and centrifuged at 300× g for 10 min at 4 °C. Finally, BSA (0.5 mg/mL) was added to the final protoplast preparation for transformation. The viability of the protoplast was calculated via a cell counter (Invitrogen™ Countess™ Automated Cell Counter) and 2 × 105 cells used for transformation.

5.5. Protoplast Transformation with RNP Complex

A polyethylene glycol (PEG4000)-mediated transformation was used to transform respective RNP complexes into chickpea protoplast cells. The PEG transformation protocol for the efficient targeted knockout in both genes was adapted from previous studies [6,10,49,67]. The 2 × 105 resuspended protoplasts were transformed with Cas9 protein and sgRNA in a ratio of 1:1. Protoplasts (200 μL, 2 × 10 cells) and RNPs for example, 1:1 is Cas9 30 μg (stock 10 μg/μL) and sgRNA 30 μg (stock 10 μg/μL) used for transformation. Before the transformation experiment, Cas9 and sgRNA were pre-mixed to form the RNP complex and incubated at room temperature for 10 min. Further, all the components, protoplast, Cas9, and sgRNA mix were combined, and an equal volume of freshly prepared PEG 4000 added (40% PEG [w/v] PEG 4000, 0.2 M mannitol, 0.1 M CaCl2), with immediate mixing to prevent aggregation. This mixture was incubated at room temperature for 20 min. An aliquot (400 µL) of W5 solution (2 mM MES pH 5.7, 154 mM NaCl, 125 mM CaCl2 and 5 mM KCl) was added, mixed, and incubated at room temperature for 10 min. An additional 800 μL of filter sterilized W5 solution was added to the tubes, mixed gradually, and incubated at room temperature for 10 min. The tubes were centrifuged at 50× g for 5 min; the supernatant was discarded, and another 1 mL of W5 solution was added to the tubes. Subsequently, the tubes were incubated overnight at room temperature in the dark. The lower sediments were collected for genomic DNA isolation from the protoplast cells. Three biological replicates of the protoplast transformation were performed for each set of genes. Genomic DNA was isolated from protoplast cells for Sanger sequencing. The sample treated only with the Cas9 enzyme was used as a negative control. The transformation experiments were repeated twice, and similar results were obtained both times.

5.6. DNA Extraction and PCR Amplification of Target Regions

Genomic and protoplast DNA were extracted using Isolate II Genomic DNA kits (Catalog number: BIO-52069, Bioline (Aust) Pty Ltd., Eveleigh, Australia). The DNA concentration was determined with a Nanodrop spectrophotometer (Thermo Scientific, Waltham, MA, USA); the concentration of the samples was around 25–30 ng/μL. The PCR reaction to amplify the 5 kb genomic region and program used is provided in Table S1 and the PCR reaction for sequencing samples and program are also provided in Table S3. The 5 kb fragment was amplified using GoTaq® Long PCR Master Mix (Catalog number: M4021, Promega, Alexandria, NSW, Australia). The samples for sequencing the target regions were amplified using MyTaq™ Red Mix, 2× (Catalog number: BIO-25043, Bioline (Aust) Pty Ltd.). The primer used for amplification of CRISPR target loci of 4CL and RVE7 are presented in Table 3 and the PCR reaction to amplify the sequencing fragment is provided in Table S4.

Supplementary Materials

The following are available online at https://www.mdpi.com/1422-0067/22/1/396/s1.

Author Contributions

Conceptualization, S.B. and N.M.; methodology, S.B. and N.M.; software, S.B.; formal analysis, S.B. and N.M.; investigation, S.B., N.M., and A.S.B.; resources, S.B. and N.M.; data curation, S.B.; writing—original draft preparation, S.B.; writing—review and editing, S.B., N.M., and A.S.B.; visualization, S.B. and N.M.; supervision, N.M and A.S.B. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Conflicts of Interest

The authors declare no conflict of interest.

Abbreviations

4CL4-coumarate ligase
Cas9CRISPR associated protein 9
CRISPRClustered regularly interspaced short palindromic repeats
GMOGenetically modified organisms
gRNAguide RNA
HDRHomology-directed repair
NHEJNon-homologous end joining
NLSNuclear localization sequence
PAMProtospacer adjacent motif
RNPRibonucleoprotein
sgRNASynthetic guide RNA
trcrRNAtracer RNA

References

  1. Baek, K.; Kim, D.H.; Jeong, J.; Sim, S.J.; Melis, A.; Kim, J.-S.; Jin, E.; Bae, S. DNA-free two-gene knockout in Chlamydomonas reinhardtii via CRISPR-Cas9 ribonucleoproteins. Sci. Rep. 2016, 6, 30620. [Google Scholar] [CrossRef]
  2. Johansen, I.E.; Liu, Y.; Jørgensen, B.; Bennett, E.P.; Andreasson, E.; Nielsen, K.L.; Blennow, A.; Petersen, B.L. High efficacy full allelic CRISPR/Cas9 gene editing in tetraploid potato. Sci. Rep. 2019, 9, 17715. [Google Scholar] [CrossRef]
  3. Kim, D.; Alptekin, B.; Budak, H. CRISPR/Cas9 genome editing in wheat. Funct. Integr. Genom. 2018, 18, 31–41. [Google Scholar] [CrossRef] [PubMed]
  4. Liang, Z.; Chen, K.; Li, T.; Zhang, Y.; Wang, Y.; Zhao, Q.; Liu, J.; Zhang, H.; Liu, C.; Ran, Y.; et al. Efficient DNA-free genome editing of bread wheat using CRISPR/Cas9 ribonucleoprotein complexes. Nat. Commun. 2017, 8, 14261. [Google Scholar] [CrossRef] [PubMed]
  5. Lin, C.-S.; Hsu, C.-T.; Yang, L.-H.; Lee, L.-Y.; Fu, J.-Y.; Cheng, Q.-W.; Wu, F.-H.; Hsiao, H.C.-W.; Zhang, Y.; Zhang, R.; et al. Application of protoplast technology to CRISPR/Cas9 mutagenesis: From single-cell mutation detection to mutant plant regeneration. Plant Biotechnol. J. 2018, 16, 1295–1310. [Google Scholar] [CrossRef] [PubMed]
  6. Malnoy, M.; Viola, R.; Jung, M.-H.; Koo, O.-J.; Kim, S.; Kim, J.-S.; Velasco, R.; Nagamangala Kanchiswamy, C. DNA-Free Genetically Edited Grapevine and Apple Protoplast Using CRISPR/Cas9 Ribonucleoproteins. Front. Plant Sci. 2016, 7, 1904. [Google Scholar] [CrossRef] [PubMed]
  7. Murovec, J.; Guček, K.; Bohanec, B.; Avbelj, M.; Jerala, R. DNA-Free Genome Editing of Brassica oleracea and B. rapa Protoplasts Using CRISPR-Cas9 Ribonucleoprotein Complexes. Front. Plant Sci. 2018, 9, 1594. [Google Scholar] [CrossRef] [PubMed]
  8. Osakabe, Y.; Liang, Z.; Ren, C.; Nishitani, C.; Osakabe, K.; Wada, M.; Komori, S.; Malnoy, M.; Velasco, R.; Poli, M.; et al. CRISPR–Cas9-mediated genome editing in apple and grapevine. Nat. Protoc. 2018, 13, 2844–2863. [Google Scholar] [CrossRef]
  9. Petersen, B.L.; Möller, S.R.; Mravec, J.; Jørgensen, B.; Christensen, M.; Liu, Y.; Wandall, H.H.; Bennett, E.P.; Yang, Z. Improved CRISPR/Cas9 gene editing by fluorescence activated cell sorting of green fluorescence protein tagged protoplasts. BMC Biotechnol. 2019, 19, 36. [Google Scholar] [CrossRef]
  10. Woo, J.W.; Kim, J.; Kwon, S.I.; Corvalán, C.; Cho, S.W.; Kim, H.; Kim, S.-G.; Kim, S.-T.; Choe, S.; Kim, J.-S. DNA-free genome editing in plants with preassembled CRISPR-Cas9 ribonucleoproteins. Nat. Biotechnol. 2015, 33, 1162–1164. [Google Scholar] [CrossRef]
  11. Khatodia, S.; Bhatotia, K.; Passricha, N.; Khurana, S.M.P.; Tuteja, N. The CRISPR/Cas Genome-Editing Tool: Application in Improvement of Crops. Front. Plant Sci. 2016, 7, 506. [Google Scholar] [CrossRef] [PubMed]
  12. Noman, A.; Aqeel, M.; He, S. CRISPR-Cas9: Tool for Qualitative and Quantitative Plant Genome Editing. Front. Plant Sci. 2016, 7. [Google Scholar] [CrossRef] [PubMed]
  13. Puchta, H. The repair of double-strand breaks in plants: Mechanisms and consequences for genome evolution. J. Exp. Bot. 2005, 56, 1–14. [Google Scholar] [CrossRef] [PubMed]
  14. Puchta, H.; Dujon, B.; Hohn, B. Two different but related mechanisms are used in plants for the repair of genomic double-strand breaks by homologous recombination. Proc. Natl. Acad. Sci. USA 1996, 93, 5055. [Google Scholar] [CrossRef] [PubMed]
  15. Feng, Z.; Mao, Y.; Xu, N.; Zhang, B.; Wei, P.; Yang, D.-L.; Wang, Z.; Zhang, Z.; Zheng, R.; Yang, L.; et al. Multigeneration analysis reveals the inheritance, specificity, and patterns of CRISPR/Cas-induced gene modifications in Arabidopsis. Proc. Natl. Acad. Sci. USA 2014, 111, 4632. [Google Scholar] [CrossRef] [PubMed]
  16. Klimek-Chodacka, M.; Oleszkiewicz, T.; Lowder, L.G.; Qi, Y.; Baranski, R. Efficient CRISPR/Cas9-based genome editing in carrot cells. Plant Cell Rep. 2018, 37, 575–586. [Google Scholar] [CrossRef] [PubMed]
  17. Nakajima, I.; Ban, Y.; Azuma, A.; Onoue, N.; Moriguchi, T.; Yamamoto, T.; Toki, S.; Endo, M. CRISPR/Cas9-mediated targeted mutagenesis in grape. PLoS ONE 2017, 12, e0177966. [Google Scholar] [CrossRef]
  18. Wang, T.; Zhang, H.; Zhu, H. CRISPR technology is revolutionizing the improvement of tomato and other fruit crops. Hortic. Res. 2019, 6, 77. [Google Scholar] [CrossRef]
  19. Zhang, H.; Zhang, J.; Wei, P.; Zhang, B.; Gou, F.; Feng, Z.; Mao, Y.; Yang, L.; Zhang, H.; Xu, N.; et al. The CRISPR/Cas9 system produces specific and homozygous targeted gene editing in rice in one generation. Plant Biotechnol. J. 2014, 12, 797–807. [Google Scholar] [CrossRef]
  20. Liu, G.; Li, J.; Godwin, I.D. Genome Editing by CRISPR/Cas9 in Sorghum Through Biolistic Bombardment. In Sorghum: Methods and Protocols; Zhao, Z.-Y., Dahlberg, J., Eds.; Springer: New York, NY, USA, 2019; pp. 169–183. [Google Scholar] [CrossRef]
  21. Chilcoat, D.; Liu, Z.-B.; Sander, J. Chapter Two—Use of CRISPR/Cas9 for Crop Improvement in Maize and Soybean. In Progress in Molecular Biology and Translational Science; Weeks, D.P., Yang, B., Eds.; Academic Press: Cambridge, MA, USA, 2017; Volume 149, pp. 27–46. [Google Scholar]
  22. Zhang, Y.; Liang, Z.; Zong, Y.; Wang, Y.; Liu, J.; Chen, K.; Qiu, J.-L.; Gao, C. Efficient and transgene-free genome editing in wheat through transient expression of CRISPR/Cas9 DNA or RNA. Nat. Commun. 2016, 7, 12617. [Google Scholar] [CrossRef]
  23. Gao, X.; Chen, J.; Dai, X.; Zhang, D.; Zhao, Y. An Effective Strategy for Reliably Isolating Heritable and Cas9-Free Arabidopsis Mutants Generated by CRISPR/Cas9-Mediated Genome Editing. Plant Physiol. 2016, 171, 1794. [Google Scholar] [CrossRef] [PubMed]
  24. Shi, J.; Gao, H.; Wang, H.; Lafitte, H.R.; Archibald, R.L.; Yang, M.; Hakimi, S.M.; Mo, H.; Habben, J.E. ARGOS8 variants generated by CRISPR-Cas9 improve maize grain yield under field drought stress conditions. Plant Biotechnol. J. 2017, 15, 207–216. [Google Scholar] [CrossRef] [PubMed]
  25. Cho, S.W.; Lee, J.; Carroll, D.; Kim, J.-S.; Lee, J. Heritable gene knockout in Caenorhabditis elegans by direct injection of Cas9–sgRNA ribonucleoproteins. Genetics 2013, 195, 1177. [Google Scholar] [CrossRef] [PubMed]
  26. Croser, J.S.; Ahmad, F.; Clarke, H.J.; Siddique, K.H.M. Utilisation of wild Cicer in chickpea improvement—Progress, constraints, and prospects. Aust. J. Agric. Res. 2003, 54, 429–444. [Google Scholar] [CrossRef]
  27. Anwar, F.; Sharmila, P.; Saradhi, P.P. No more recalcitrant: Chickpea regeneration and genetic transformation. Afr. J. Biotechnol. 2010, 9, 782–797. [Google Scholar]
  28. Krishnamurthy, K.V.; Suhasini, K.; Sagare, A.P.; Meixner, M.; de Kathen, A.; Pickardt, T.; Schieder, O. Agrobacterium mediated transformation of chickpea (Cicer arietinum L.) embryo axes. Plant Cell Rep. 2000, 19, 235–240. [Google Scholar] [CrossRef]
  29. Acharjee, S.; Sarmah, B.K. Biotechnologically generating ’super chickpea’ for food and nutritional security. Plant Sci. Int. J. Exp. Plant Biol. 2013, 207, 108–116. [Google Scholar] [CrossRef]
  30. Bhatnagar-Mathur, P.; Vadez, V.; Devi, M.J.; Lavanya, M.; Vani, G.; Sharma, K.K. Genetic engineering of chickpea (Cicer arietinum L.) with the P5CSF129A gene for osmoregulation with implications on drought tolerance. Mol. Breed. 2009, 23, 591–606. [Google Scholar] [CrossRef]
  31. Rani, A.; Devi, P.; Jha, U.C.; Sharma, K.D.; Siddique, K.H.M.; Nayyar, H. Developing Climate-Resilient Chickpea Involving Physiological and Molecular Approaches With a Focus on Temperature and Drought Stresses. Front. Plant Sci. 2020, 10. [Google Scholar] [CrossRef]
  32. Movahedi, A.; Zhang, J.; Gao, P.; Yang, Y.; Wang, L.; Yin, T.; Kadkhodaei, S.; Ebrahimi, M.; Zhuge, Q. Expression of the chickpea CarNAC3 gene enhances salinity and drought tolerance in transgenic poplars. Plant Cell Tissue Organ Cult. (PCTOC) 2015, 120, 141–154. [Google Scholar] [CrossRef]
  33. Hajyzadeh, M.; Turktas, M.; Khawar, K.M.; Unver, T. miR408 overexpression causes increased drought tolerance in chickpea. Gene 2015, 555, 186–193. [Google Scholar] [CrossRef] [PubMed]
  34. Anbazhagan, K.; Bhatnagar-Mathur, P.; Vadez, V.; Dumbala, S.R.; Kishor, P.B.K.; Sharma, K.K. DREB1A overexpression in transgenic chickpea alters key traits influencing plant water budget across water regimes. Plant Cell Rep. 2015, 34, 199–210. [Google Scholar] [CrossRef] [PubMed]
  35. Sanyal, I.; Singh, A.K.; Kaushik, M.; Amla, D.V. Agrobacterium-mediated transformation of chickpea (Cicer arietinum L.) with Bacillus thuringiensis cry1Ac gene for resistance against pod borer insect Helicoverpa armigera. Plant Sci. 2005, 168, 1135–1146. [Google Scholar] [CrossRef]
  36. Kumar, M.; Yusuf, M.A.; Nigam, M.; Kumar, M. An Update on Genetic Modification of Chickpea for Increased Yield and Stress Tolerance. Mol. Biotechnol. 2018, 60, 651–663. [Google Scholar] [CrossRef]
  37. Ehlting, J.; Büttner, D.; Wang, Q.; Douglas, C.J.; Somssich, I.E.; Kombrink, E. Three 4-coumarate:coenzyme A ligases in Arabidopsis thaliana represent two evolutionarily divergent classes in angiosperms. Plant J. 1999, 19, 9–20. [Google Scholar] [CrossRef]
  38. Lee, D.; Meyer, K.; Chapple, C.; Douglas, C.J. Antisense suppression of 4-coumarate:coenzyme A ligase activity in Arabidopsis leads to altered lignin subunit composition. Plant Cell 1997, 9, 1985. [Google Scholar] [CrossRef]
  39. Liu, H.; Guo, Z.; Gu, F.; Ke, S.; Sun, D.; Dong, S.; Liu, W.; Huang, M.; Xiao, W.; Yang, G.; et al. 4-Coumarate-CoA Ligase-Like Gene OsAAE3 Negatively Mediates the Rice Blast Resistance, Floret Development and Lignin Biosynthesis. Front. Plant Sci. 2016, 7, 2041. [Google Scholar] [CrossRef]
  40. Yoshimura, K.; Masuda, A.; Kuwano, M.; Yokota, A.; Akashi, K. Programmed Proteome Response for Drought Avoidance/Tolerance in the Root of a C3 Xerophyte (Wild Watermelon) Under Water Deficits. Plant Cell Physiol. 2008, 49, 226–241. [Google Scholar] [CrossRef]
  41. Rawat, R.; Schwartz, J.; Jones, M.A.; Sairanen, I.; Cheng, Y.; Andersson, C.R.; Zhao, Y.; Ljung, K.; Harmer, S.L. REVEILLE1, a Myb-like transcription factor, integrates the circadian clock and auxin pathways. Proc. Natl. Acad. Sci. USA 2009, 106, 16883–16888. [Google Scholar] [CrossRef]
  42. Kuno, N.; Moller, S.G.; Shinomura, T.; Xu, X.; Chua, N.H.; Furuya, M. The novel MYB protein EARLY-PHYTOCHROME-RESPONSIVE1 is a component of a slave circadian oscillator in Arabidopsis. Plant Cell 2003, 15, 2476–2488. [Google Scholar] [CrossRef]
  43. Nguyen, N.H.; Lee, H. MYB-related transcription factors function as regulators of the circadian clock and anthocyanin biosynthesis in Arabidopsis. Plant Signal. Behav. 2016, 11, e1139278. [Google Scholar] [CrossRef] [PubMed]
  44. Farinas, B.; Mas, P. Functional implication of the MYB transcription factor RVE8/LCL5 in the circadian control of histone acetylation. Plant J. 2011, 66, 318–329. [Google Scholar] [CrossRef] [PubMed]
  45. Hilbeck, A.; Meier, M.; Römbke, J.; Jänsch, S.; Teichmann, H.; Tappeser, B. Environmental risk assessment of genetically modified plants—Concepts and controversies. Environ. Sci. Eur. 2011, 23, 13. [Google Scholar] [CrossRef]
  46. Carroll, D.; Charo, R.A. The societal opportunities and challenges of genome editing. Genome Biol. 2015, 16, 242. [Google Scholar] [CrossRef] [PubMed]
  47. Cheng, N.; Nakata, P.A. Development of a rapid and efficient protoplast isolation and transfection method for chickpea (Cicer arietinum). MethodsX 2020, 7, 101025. [Google Scholar] [CrossRef]
  48. Naim, F.; Shand, K.; Hayashi, S.; O’Brien, M.; McGree, J.; Johnson, A.A.T.; Dugdale, B.; Waterhouse, P.M. Are the current gRNA ranking prediction algorithms useful for genome editing in plants? PLoS ONE 2020, 15, e0227994. [Google Scholar] [CrossRef]
  49. Brandt, K.M.; Gunn, H.; Moretti, N.; Zemetra, R.S. A Streamlined Protocol for Wheat (Triticum aestivum) Protoplast Isolation and Transformation With CRISPR-Cas Ribonucleoprotein Complexes. Front. Plant Sci. 2020, 11. [Google Scholar] [CrossRef]
  50. Wu, X.; Kriz, A.J.; Sharp, P.A. Target specificity of the CRISPR-Cas9 system. Quant Biol. 2014, 2, 59–70. [Google Scholar] [CrossRef]
  51. Ondřej, V.; Kitner, M.; Doležalová, I.; Nádvorník, P.; Navrátilová, B.; Lebeda, A. Chromatin structural rearrangement during dedifferentiation of protoplasts of Cucumis sativus L. Mol. Cells 2009, 27, 443–447. [Google Scholar] [CrossRef]
  52. Shan, Q.; Wang, Y.; Li, J.; Gao, C. Genome editing in rice and wheat using the CRISPR/Cas system. Nat. Protoc. 2014, 9, 2395–2410. [Google Scholar] [CrossRef]
  53. Li, H.; Yang, Y.; Hong, W.; Huang, M.; Wu, M.; Zhao, X. Applications of genome editing technology in the targeted therapy of human diseases: Mechanisms, advances and prospects. Signal Transduct. Target. Ther. 2020, 5, 1. [Google Scholar] [CrossRef] [PubMed]
  54. Jensen, K.T.; Fløe, L.; Petersen, T.S.; Huang, J.; Xu, F.; Bolund, L.; Luo, Y.; Lin, L. Chromatin accessibility and guide sequence secondary structure affect CRISPR-Cas9 gene editing efficiency. FEBS Lett. 2017, 591, 1892–1901. [Google Scholar] [CrossRef] [PubMed]
  55. Kocak, D.D.; Josephs, E.A.; Bhandarkar, V.; Adkar, S.S.; Kwon, J.B.; Gersbach, C.A. Increasing the specificity of CRISPR systems with engineered RNA secondary structures. Nat. Biotechnol. 2019, 37, 657–666. [Google Scholar] [CrossRef] [PubMed]
  56. Makarova, K.S.; Haft, D.H.; Barrangou, R.; Brouns, S.J.J.; Charpentier, E.; Horvath, P.; Moineau, S.; Mojica, F.J.M.; Wolf, Y.I.; Yakunin, A.F.; et al. Evolution and classification of the CRISPR–Cas systems. Nat. Rev. Microbiol. 2011, 9, 467–477. [Google Scholar] [CrossRef] [PubMed]
  57. Tsai, S.Q.; Zheng, Z.; Nguyen, N.T.; Liebers, M.; Topkar, V.V.; Thapar, V.; Wyvekens, N.; Khayter, C.; Iafrate, A.J.; Le, L.P.; et al. GUIDE-seq enables genome-wide profiling of off-target cleavage by CRISPR-Cas nucleases. Nat. Biotechnol. 2015, 33, 187–197. [Google Scholar] [CrossRef] [PubMed]
  58. Ma, X.; Zhang, Q.; Zhu, Q.; Liu, W.; Chen, Y.; Qiu, R.; Wang, B.; Yang, Z.; Li, H.; Lin, Y.; et al. A Robust CRISPR/Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Mol. Plant 2015, 8, 1274–1284. [Google Scholar] [CrossRef]
  59. Cao, Y.; Han, Y.; Li, D.; Lin, Y.; Cai, Y. Systematic Analysis of the 4-Coumarate:Coenzyme A Ligase (4CL) Related Genes and Expression Profiling during Fruit Development in the Chinese Pear. Genes (Basel) 2016, 7, 89. [Google Scholar] [CrossRef]
  60. Dixon, R.A.; Paiva, N.L. Stress-Induced Phenylpropanoid Metabolism. Plant Cell 1995, 7, 1085–1097. [Google Scholar] [CrossRef]
  61. Hu, Y.; Li, W.C.; Xu, Y.; Li, G.; Liao, Y.; Fu, F.-L. Differential expression of candidate genes for lignin biosynthesis under drought stress in maize leaves. J. Appl. Genet. 2009, 50, 213–223. [Google Scholar] [CrossRef]
  62. Sun, S.-C.; Xiong, X.-P.; Zhang, X.-L.; Feng, H.-J.; Zhu, Q.-H.; Sun, J.; Li, Y.-J. Characterization of the Gh4CL gene family reveals a role of Gh4CL7 in drought tolerance. BMC Plant Biol. 2020, 20, 125. [Google Scholar] [CrossRef]
  63. Moenga, S.M.; Gai, Y.; Carrasquilla-Garcia, N.; Perilla-Henao, L.M.; Cook, D.R. Gene co-expression analysis reveals transcriptome divergence between wild and cultivated chickpea under drought stress. Plant J. 2020. [Google Scholar] [CrossRef] [PubMed]
  64. Lu, S.X.; Knowles, S.M.; Andronis, C.; Ong, M.S.; Tobin, E.M. Circadian clock associated1 and late elongated hypocotyl function synergistically in the circadian clock of Arabidopsis. Plant Physiol. 2009, 150, 834–843. [Google Scholar] [CrossRef] [PubMed]
  65. Cavicchioli, R.; Ripple, W.J.; Timmis, K.N.; Azam, F.; Bakken, L.R.; Baylis, M.; Behrenfeld, M.J.; Boetius, A.; Boyd, P.W.; Classen, A.T.; et al. Scientists’ warning to humanity: Microorganisms and climate change. Nat. Rev. Microbiol. 2019, 17, 569–586. [Google Scholar] [CrossRef] [PubMed]
  66. Labun, K.; Montague, T.G.; Krause, M.; Torres Cleuren, Y.N.; Tjeldnes, H.; Valen, E. CHOPCHOP v3: Expanding the CRISPR web toolbox beyond genome editing. Nucleic Acids Res. 2019, 47, W171–W174. [Google Scholar] [CrossRef] [PubMed]
  67. Subburaj, S.; Chung, S.J.; Lee, C.; Ryu, S.-M.; Kim, D.H.; Kim, J.-S.; Bae, S.; Lee, G.-J. Site-directed mutagenesis in Petunia × hybrida protoplast system using direct delivery of purified recombinant Cas9 ribonucleoproteins. Plant Cell Rep. 2016, 35, 1535–1544. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Graphical abstract: An overview of the CRISPR/Cas9 DNA free gene editing in the chickpea protoplast. The protoplasts of young leaves were isolated and transformed with CRISPR RNP complex under optimum conditions. The DNA was extracted from the protoplast control and test samples and sent for Sanger sequencing to detect the mutations. The transformation efficiency and knockout score were identified using ICE bioinformatics tool (Synthego).
Figure 1. Graphical abstract: An overview of the CRISPR/Cas9 DNA free gene editing in the chickpea protoplast. The protoplasts of young leaves were isolated and transformed with CRISPR RNP complex under optimum conditions. The DNA was extracted from the protoplast control and test samples and sent for Sanger sequencing to detect the mutations. The transformation efficiency and knockout score were identified using ICE bioinformatics tool (Synthego).
Ijms 22 00396 g001
Figure 2. Systematic design to show the location of sgRNA target sites in RVE7 and 4CL nucleotide sequences. (a) Systematic illustration of the nucleotide sequence of RVE7 gene locus. (b) Systematic diagram of the nucleotide sequence of 4CL gene locus. The blue boxes represent exons and orange connecting lines represent introns.
Figure 2. Systematic design to show the location of sgRNA target sites in RVE7 and 4CL nucleotide sequences. (a) Systematic illustration of the nucleotide sequence of RVE7 gene locus. (b) Systematic diagram of the nucleotide sequence of 4CL gene locus. The blue boxes represent exons and orange connecting lines represent introns.
Ijms 22 00396 g002
Figure 3. Results of in vitro digestion cleavage assay of both sgRNA sets for 4CL and RVE7 gene. (a) sgRNA 1 for 4CL and RVE7. The DNA of 5 kb PCR-amplified fragments for gene 4CL and RVE7 were treated with preassembled RNPs (sgRNAs (crRNA/tracrRNA) + Cas9) and in vitro cleavage assay was performed. For in vitro cleavage assay non-treated samples were used as negative controls in gel electrophoresis. (b) sgRNA 2 for 4CL and RVE7. The digested samples for 4CL left side and RVE7 at right side. Above lane 2,3,4 correspond to 4Cl and lane 6,7,8 for RVE7 samples. The expected band size for sgRNA 1 RVE7 were approximately 2298 and 3543; sgRNA 2 4469 and 1363. For 4CL the expected band sizes after digestion for sgRNA1 were 4931 and 1170; sgRNA 2 approximately 4477 and 1428.
Figure 3. Results of in vitro digestion cleavage assay of both sgRNA sets for 4CL and RVE7 gene. (a) sgRNA 1 for 4CL and RVE7. The DNA of 5 kb PCR-amplified fragments for gene 4CL and RVE7 were treated with preassembled RNPs (sgRNAs (crRNA/tracrRNA) + Cas9) and in vitro cleavage assay was performed. For in vitro cleavage assay non-treated samples were used as negative controls in gel electrophoresis. (b) sgRNA 2 for 4CL and RVE7. The digested samples for 4CL left side and RVE7 at right side. Above lane 2,3,4 correspond to 4Cl and lane 6,7,8 for RVE7 samples. The expected band size for sgRNA 1 RVE7 were approximately 2298 and 3543; sgRNA 2 4469 and 1363. For 4CL the expected band sizes after digestion for sgRNA1 were 4931 and 1170; sgRNA 2 approximately 4477 and 1428.
Ijms 22 00396 g003
Figure 4. Flow chart of the steps performed during the protoplast isolation from leaf tissue of chickpea plants. The leaves from the 4 to 5 weeks old plants were collected and surface sterilized. The leaves were cut into small pieces. The enzyme solution was prepared and cut leaf sections were kept in the dark for 4 to 5 h digestion resulting in protoplast formation. After 2 h, samples for protoplast formation were collected to check the protoplast formation stage, and once the protoplast were isolated, they were used for the PEG mediated transfections.
Figure 4. Flow chart of the steps performed during the protoplast isolation from leaf tissue of chickpea plants. The leaves from the 4 to 5 weeks old plants were collected and surface sterilized. The leaves were cut into small pieces. The enzyme solution was prepared and cut leaf sections were kept in the dark for 4 to 5 h digestion resulting in protoplast formation. After 2 h, samples for protoplast formation were collected to check the protoplast formation stage, and once the protoplast were isolated, they were used for the PEG mediated transfections.
Ijms 22 00396 g004
Figure 5. Illustration of ICE Analysis of RVE7 sgRNA1 (GTGGAGGATTGAATGTAAGACGG) RNP complex edited protoplast cells in chickpea. The respective protoplast samples were edited and sequenced with Sanger sequencing (Macrogen, Seoul, Korea) and further analyzed with the ICE (Synthego, Redwood City, CA, USA) online tool to deconvolute the pooled protoplast DNA. The contributions show the sequences inferred in the edited protoplast population and their relative proportions. The “+” sign is for the wild type sample. The target cut sites are denoted by black vertical dotted lines. The trace plots for the edited samples below show the cut site and protospacer adjacent motif (PAM) sequence labelled in the edited sample and control sample. The sgRNA 2 sequencing samples had low quality before the cut site and could not be analyzed using the ICE tool.
Figure 5. Illustration of ICE Analysis of RVE7 sgRNA1 (GTGGAGGATTGAATGTAAGACGG) RNP complex edited protoplast cells in chickpea. The respective protoplast samples were edited and sequenced with Sanger sequencing (Macrogen, Seoul, Korea) and further analyzed with the ICE (Synthego, Redwood City, CA, USA) online tool to deconvolute the pooled protoplast DNA. The contributions show the sequences inferred in the edited protoplast population and their relative proportions. The “+” sign is for the wild type sample. The target cut sites are denoted by black vertical dotted lines. The trace plots for the edited samples below show the cut site and protospacer adjacent motif (PAM) sequence labelled in the edited sample and control sample. The sgRNA 2 sequencing samples had low quality before the cut site and could not be analyzed using the ICE tool.
Ijms 22 00396 g005
Figure 6. Traces of the edited and control population of the protoplast as shown by the Sanger Scheme 1. files control and the experimental study, which contain mixed base call. The region underlined in horizontal black represents the guide sequence. The PAM site is represented as the horizontal red focus. The vertical dotted black line represents the site of the actual break. Cutting and fixing which is sensitive to errors usually results in mixed sequencing bases after cutting.
Figure 6. Traces of the edited and control population of the protoplast as shown by the Sanger Scheme 1. files control and the experimental study, which contain mixed base call. The region underlined in horizontal black represents the guide sequence. The PAM site is represented as the horizontal red focus. The vertical dotted black line represents the site of the actual break. Cutting and fixing which is sensitive to errors usually results in mixed sequencing bases after cutting.
Ijms 22 00396 g006
Figure 7. ICE results for 4CL. (a) The sequence plot represents the ICE Analysis of 4CL sgRNA1 Target 1 (sgRNA:CCAATGAACTAGACGGTGACATA) RNP edited protoplast cells in the chickpea. The contributions show the sequences inferred in the edited protoplast population and their relative proportions. The cut sites are represented by black vertical dotted lines and “+” far left side denotes the control sample. (b) The trace plot of the 4CL sample 4 edited and control population of the protoplast showing the PAM sequence and cut site.
Figure 7. ICE results for 4CL. (a) The sequence plot represents the ICE Analysis of 4CL sgRNA1 Target 1 (sgRNA:CCAATGAACTAGACGGTGACATA) RNP edited protoplast cells in the chickpea. The contributions show the sequences inferred in the edited protoplast population and their relative proportions. The cut sites are represented by black vertical dotted lines and “+” far left side denotes the control sample. (b) The trace plot of the 4CL sample 4 edited and control population of the protoplast showing the PAM sequence and cut site.
Ijms 22 00396 g007
Table 1. The gene expression values of the RVE7 and 4CL in both genotypes. Shoot apical meristem (SAM), flowering bud (FB), fully opened flower (FOF), young pod (YP), partially open flower (POF).
Table 1. The gene expression values of the RVE7 and 4CL in both genotypes. Shoot apical meristem (SAM), flowering bud (FB), fully opened flower (FOF), young pod (YP), partially open flower (POF).
Gene NameICC8261
(Drought Tolerant Genotype)
Expression Levels
ICC283
(Sensitive Tolerant Genotype)
Expression Levels
e 3
RVE7SAM 2.69, FB-3.4, POF0, FOF-1.29, YP1.9SAM 3.4, FB-3.02, POF0, FOF-5.9, YP 0
4CLFB 10.39Not Differentially expressed data
Table 2. List of sgRNAs designed to target 4CL and RVE7 genes in chickpea. A 20 bp sequence of crRNA/tracrRNA with PAM in red.
Table 2. List of sgRNAs designed to target 4CL and RVE7 genes in chickpea. A 20 bp sequence of crRNA/tracrRNA with PAM in red.
Gene NamesgRNA NamesgRNA Sequence
4-coumarate-CoA ligase-like 1
NW_004516753.1_162798-165892
Length 3094
4CLsgRNA1
4CLsgRNA2
TATGTCACCGTCTAGTTCATTGG
GTTTAGGTTACCGAACGAAGAGG
REVEILLE 7-like
NW_004516329.1_420654-4253847
RVE7sgRNA1GTGGAGGATTGAATGTAAGACGG
RVE7sgRNA2AGTGTGCAGCTGATGTATCGAGG
Table 3. The sequences of primer used for amplification of CRISPR target loci of 4CL and RVE7.
Table 3. The sequences of primer used for amplification of CRISPR target loci of 4CL and RVE7.
Primer SetsSequenceExpected Product Size
4CL Primer Set1Forward: ACAATACCAATGAACTAGACGGTGA
Reverse: TCCCTAACAAAATCCAACACATCT
592
4CL Primer Set2Forward: ACAATACCAATGAACTAGACGGTG
Reverse: TCCCTAACAAAATCCAACACATC
590
RVE7 Primer Set1Forward: AACATGCTGCTGCTTGGTTG
Reverse: GACGAAGAGAGGGACTAATTTCA
398
RVE7 Primer Set2Forward: GGAAGCAGGTTTCATCCGTC
Reverse: TGATGAAAGAAATTGATGCTCACTA
420
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Badhan, S.; Ball, A.S.; Mantri, N. First Report of CRISPR/Cas9 Mediated DNA-Free Editing of 4CL and RVE7 Genes in Chickpea Protoplasts. Int. J. Mol. Sci. 2021, 22, 396. https://doi.org/10.3390/ijms22010396

AMA Style

Badhan S, Ball AS, Mantri N. First Report of CRISPR/Cas9 Mediated DNA-Free Editing of 4CL and RVE7 Genes in Chickpea Protoplasts. International Journal of Molecular Sciences. 2021; 22(1):396. https://doi.org/10.3390/ijms22010396

Chicago/Turabian Style

Badhan, Sapna, Andrew S. Ball, and Nitin Mantri. 2021. "First Report of CRISPR/Cas9 Mediated DNA-Free Editing of 4CL and RVE7 Genes in Chickpea Protoplasts" International Journal of Molecular Sciences 22, no. 1: 396. https://doi.org/10.3390/ijms22010396

APA Style

Badhan, S., Ball, A. S., & Mantri, N. (2021). First Report of CRISPR/Cas9 Mediated DNA-Free Editing of 4CL and RVE7 Genes in Chickpea Protoplasts. International Journal of Molecular Sciences, 22(1), 396. https://doi.org/10.3390/ijms22010396

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop