Lipopolysaccharide Enhances Tanshinone Biosynthesis via a Ca2+-Dependent Manner in Salvia miltiorrhiza Hairy Roots
Abstract
1. Introduction
2. Results
2.1. LPS Enhances Tanshinone Accumulation in the Wild Type Hairy Roots of S. miltiorrhiza
2.2. LPS Upregulates Key Gene’s Expression in Tanshinone Biosynthesis Pathways
2.3. Ca2+ Inhibitors Affect Tanshinone Accumulation
2.4. Ca2+ Channel Blocker Inhibits LPS-Induced Tanshinone Accumulation
2.5. CaM Antagonist Inhibits LPS-Induced Tanshinone Accumulation
2.6. LPS Induces the Expression of Key Tanshinone Biosynthesis Genes in a Ca2+-Dependent Manner
3. Discussion
4. Materials and Methods
4.1. Reagents
4.2. Hairy Roots Culture and Treatment
4.3. Reverse Transcription and Quantitative Real-Time PCR Analysis
4.4. HPLC Analysis
4.5. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
| LPS | lipopolysaccharide |
| TI | tanshinone I |
| TIIA | tanshinone IIA |
| TIIB | tanshinone IIB |
| CT | cryptotanshinone |
| DTI | dihydrotanshinone I |
Appendix A
| Primer | Sequence (5′–3′) |
|---|---|
| SmACT-F | GGTGCCCTGAGGTCCTGTT |
| SmACT-R | AGGAACCACCGATCCAGACA |
| SmAACT1-F | TGAAGGACGGACTCTGGGATGT |
| SmAACT1-R | CCTTGTCAACAATGGTGGATGG |
| SmCPS1-F | CCACATCGCCTTCAGGGAAGAAAT |
| SmCPS1-R | TTTATGCTCGATTTCGCTGCGATCT |
| SmCYP76AH1-F | ACGCATCACTTCACCCATCTCA |
| SmCYP76AH1-R | ATTGCCGACTCATCCACGAT |
| SmDXS2-F | CTCACGGTCGCATTGCATCAT |
| SmDXS2-R | CGCTTTCGTCTCGTTTAGGGA |
| SmHDR1-F | GGATTTGACCCGGACAAGGAT |
| SmHDR1-R | CCGCCAATGACTAGGATGAGA |
| SmHMGS1-F | TTAGGGCGAATCACATGGCTCA |
| SmHMGS1-R | TCGGCATCCAAGATCGAGAAC |
| SmKSL1-F | TGGAAACAGTGTGACCCTTCTGCT |
| SmKSL1-R | GCTTGCATACAAATAACACCCAATCCT |
| SmWRKY1-F | ACCTACAACGGCCAACACACT |
| SmWRKY1-R | TCGTCCGGTGTTTTCATTTG |
| SmWRKY2-F | ACTCATCCAAGCTGTCCGGT |
| SmWRKY2-R | ATTCATTGTTCCGTTTGAGCC |
References
- Ren, J.; Fu, L.; Nile, S.H.; Zhang, J.; Kai, G. Salvia miltiorrhiza in Treating Cardiovascular Diseases: A Review on Its Pharmacological and Clinical Applications. Front. Pharmacol. 2019, 10, 753. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, Z.; Gao, W.; Huang, L. Tanshinones, Critical Pharmacological Components in Salvia miltiorrhiza. Front. Pharmacol. 2019, 10, 202. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gao, W.; Sun, H.X.; Xiao, H.; Cui, G.; Hillwig, M.L.; Jackson, A.; Wang, X.; Shen, Y.; Zhao, N.; Zhang, L.; et al. Combining metabolomics and transcriptomics to characterize tanshinone biosynthesis in Salvia miltiorrhiza. BMC Genom. 2014, 15, 73. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, Z.; Peters, R.J.; Weirather, J.; Luo, H.; Liao, B.; Zhang, X.; Zhu, Y.; Ji, A.; Zhang, B.; Hu, S.; et al. Full-length transcriptome sequences and splice variants obtained by a combination of sequencing platforms applied to different root tissues of Salvia miltiorrhiza and tanshinone biosynthesis. Plant J. 2015, 82, 951–961. [Google Scholar] [CrossRef] [Scilit]
- Deng, C.; Hao, X.; Shi, M.; Fu, R.; Wang, Y.; Zhang, Y.; Zhou, W.; Feng, Y.; Makunga, N.P.; Kai, G. Tanshinone production could be increased by the expression of SmWRKY2 in Salvia miltiorrhiza hairy roots. Plant Sci. 2019, 284, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Zhang, C.; Xing, B.; Yang, D.; Ren, M.; Guo, H.; Yang, S.; Liang, Z. SmbHLH3 acts as a transcription repressor for both phenolic acids and tanshinone biosynthesis in Salvia miltiorrhiza hairy roots. Phytochemistry 2020, 169, 112183. [Google Scholar] [CrossRef] [Scilit]
- Bredow, M.; Monaghan, J. Regulation of Plant Immune Signaling by Calcium-Dependent Protein Kinases. Mol. Plant Microbe Interact. 2019, 32, 6–19. [Google Scholar] [CrossRef] [Scilit]
- Aldon, D.; Mbengue, M.; Mazars, C.; Galaud, J.P. Calcium Signalling in Plant Biotic Interactions. Int. J. Mol. Sci. 2018, 19, 665. [Google Scholar] [CrossRef] [Scilit]
- Nie, H.; Zhao, C.; Wu, G.; Wu, Y.; Chen, Y.; Tang, D. SR1, a calmodulin-binding transcription factor, modulates plant defense and ethylene-induced senescence by directly regulating NDR1 and EIN3. Plant Physiol. 2012, 158, 1847–1859. [Google Scholar] [CrossRef] [Scilit]
- Qiu, Y.; Xi, J.; Du, L.; Suttle, J.C.; Poovaiah, B.W. Coupling calcium/calmodulin-mediated signaling and herbivore-induced plant response through calmodulin-binding transcription factor AtSR1/CAMTA3. Plant Mol. Biol. 2012, 79, 89–99. [Google Scholar] [CrossRef] [Scilit]
- Du, L.; Ali, G.S.; Simons, K.A.; Hou, J.; Yang, T.; Reddy, A.S.; Poovaiah, B.W. Ca2+/calmodulin regulates salicylic-acid-mediated plant immunity. Nature 2009, 457, 1154–1158. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, L.; Tsuda, K.; Truman, W.; Sato, M.; Nguyen le, V.; Katagiri, F.; Glazebrook, J. CBP60g and SARD1 play partially redundant critical roles in salicylic acid signaling. Plant J. 2011, 67, 1029–1041. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, H.; Zhu, N.; Deyholos, M.K.; Liu, J.; Zhang, X.; Dong, J. Calcium mobilization in salicylic acid-induced Salvia miltiorrhiza cell cultures and its effect on the accumulation of rosmarinic acid. Appl. Biochem. Biotechnol. 2015, 175, 2689–2702. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kutschera, A.; Ranf, S. The multifaceted functions of lipopolysaccharide in plant-bacteria interactions. Biochimie 2019, 159, 93–98. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ali, R.; Ma, W.; Lemtiri-Chlieh, F.; Tsaltas, D.; Leng, Q.; von Bodman, S.; Berkowitz, G.A. Death don’t have no mercy and neither does calcium: Arabidopsis CYCLIC NUCLEOTIDE GATED CHANNEL2 and innate immunity. Plant Cell 2007, 19, 1081–1095. [Google Scholar] [CrossRef] [Scilit]
- Newman, M.A.; Dow, J.M.; Molinaro, A.; Parrilli, M. Priming, induction and modulation of plant defence responses by bacterial lipopolysaccharides. J. Endotoxin Res. 2007, 13, 69–84. [Google Scholar] [CrossRef] [Scilit]
- Cao, W.; Wang, Y.; Shi, M.; Hao, X.; Zhao, W.; Wang, Y.; Ren, J.; Kai, G. Transcription Factor SmWRKY1 Positively Promotes the Biosynthesis of Tanshinones in Salvia miltiorrhiza. Front. Plant Sci. 2018, 9, 554. [Google Scholar] [CrossRef] [Scilit]
- Yu, H.; Guo, W.; Yang, D.; Hou, Z.; Liang, Z. Transcriptional Profiles of SmWRKY Family Genes and Their Putative Roles in the Biosynthesis of Tanshinone and Phenolic Acids in Salvia miltiorrhiza. Int. J. Mol. Sci. 2018, 19, 1593. [Google Scholar] [CrossRef] [Scilit]
- Liao, C.; Zheng, Y.; Guo, Y. MYB30 transcription factor regulates oxidative and heat stress responses through ANNEXIN-mediated cytosolic calcium signaling in Arabidopsis. New Phytol. 2017, 216, 163–177. [Google Scholar] [CrossRef] [Scilit]
- Yip Delormel, T.; Boudsocq, M. Properties and functions of calcium-dependent protein kinases and their relatives in Arabidopsis thaliana. New Phytol. 2019, 224, 585–604. [Google Scholar] [CrossRef] [Scilit]
- Shi, M.; Liao, P.; Nile, S.H.; Georgiev, M.I.; Kai, G. Biotechnological Exploration of Transformed Root Culture for Value-Added Products. Trends Biotechnol. 2020. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, X.H.; Ma, Y.; Tang, J.F.; He, Y.L.; Liu, Y.C.; Ma, X.J.; Shen, Y.; Cui, G.H.; Lin, H.X.; Rong, Q.X.; et al. The Biosynthetic Pathways of Tanshinones and Phenolic Acids in Salvia miltiorrhiza. Molecules 2015, 20, 16235–16254. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shi, M.; Luo, X.; Ju, G.; Yu, X.; Hao, X.; Huang, Q.; Xiao, J.; Cui, L.; Kai, G. Increased accumulation of the cardio-cerebrovascular disease treatment drug tanshinone in Salvia miltiorrhiza hairy roots by the enzymes 3-hydroxy-3-methylglutaryl CoA reductase and 1-deoxy-D-xylulose 5-phosphate reductoisomerase. Funct. Integr. Genom. 2014, 14, 603–615. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shi, M.; Luo, X.; Ju, G.; Li, L.; Huang, S.; Zhang, T.; Wang, H.; Kai, G. HMGR-GGPPS Enhanced Diterpene Tanshinone Accumulation and Bioactivity of Transgenic Salvia miltiorrhiza Hairy Roots by Pathway Engineering. J. Agric. Food Chem. 2016, 64, 2523–2530. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hao, X.; Pu, Z.; Cao, G.; You, D.; Zhou, Y.; Deng, C.; Shi, M.; Nile, S.H.; Wang, Y.; Zhou, W.; et al. Tanshinone and salvianolic acid biosynthesis are regulated by SmMYB98 in Salvia miltiorrhiza hairy roots. J. Adv. Res. 2020, 23, 1–12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ding, K.; Pei, T.; Bai, Z.; Jia, Y.; Ma, P.; Liang, Z. SmMYB36, a Novel R2R3-MYB Transcription Factor, Enhances Tanshinone Accumulation and Decreases Phenolic Acid Content in Salvia miltiorrhiza Hairy Roots. Sci. Rep. 2017, 7, 5104. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Amorim, L.L.B.; da Fonseca Dos Santos, R.; Neto, J.P.B.; Guida-Santos, M.; Crovella, S.; Benko-Iseppon, A.M. Transcription Factors Involved in Plant Resistance to Pathogens. Curr. Protein Pept. Sci. 2017, 18, 335–351. [Google Scholar] [CrossRef] [Scilit]
- Bai, Y.; Sunarti, S.; Kissoudis, C.; Visser, R.G.F.; van der Linden, C.G. The Role of Tomato WRKY Genes in Plant Responses to Combined Abiotic and Biotic Stresses. Front Plant Sci. 2018, 9, 801. [Google Scholar] [CrossRef] [Scilit]
- Ma, Y.; Guo, H.; Hu, L.; Martinez, P.P.; Moschou, P.N.; Cevik, V.; Ding, P.; Duxbury, Z.; Sarris, P.F.; Jones, J.D.G. Distinct modes of derepression of an Arabidopsis immune receptor complex by two different bacterial effectors. Proc. Natl. Acad. Sci. USA 2018, 115, 10218–10227. [Google Scholar] [CrossRef] [Scilit]
- Wei, W.; Liang, D.W.; Bian, X.H.; Shen, M.; Xiao, J.H.; Zhang, W.K.; Ma, B.; Lin, Q.; Lv, J.; Chen, X.; et al. GmWRKY54 improves drought tolerance through activating genes in abscisic acid and Ca2+ signaling pathways in transgenic soybean. Plant J. 2019, 100, 384–398. [Google Scholar] [CrossRef] [Scilit]
- Yan, C.; Fan, M.; Yang, M.; Zhao, J.; Zhang, W.; Su, Y.; Xiao, L.; Deng, H.; Xie, D. Injury Activates Ca2+/Calmodulin-Dependent Phosphorylation of JAV1-JAZ8-WRKY51 Complex for Jasmonate Biosynthesis. Mol. Cell 2018, 70, 136–149. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cui, X.; Zhao, P.; Liang, W.; Cheng, Q.; Mu, B.; Niu, F.; Yan, J.; Liu, C.; Xie, H.; Kav, N.N.V.; et al. A Rapeseed WRKY Transcription Factor Phosphorylated by CPK Modulates Cell Death and Leaf Senescence by Regulating the Expression of ROS and SA-Synthesis-Related Genes. J. Agric. Food Chem. 2020, 68, 7348–7359. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Park, C.Y.; Lee, J.H.; Yoo, J.H.; Moon, B.C.; Choi, M.S.; Kang, Y.H.; Lee, S.M.; Kim, H.S.; Kang, K.Y.; Chung, W.S.; et al. WRKY group IId transcription factors interact with calmodulin. FEBS Lett. 2005, 579, 1545–1550. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Braun, S.G.; Meyer, A.; Holst, O.; Pühler, A.; Niehaus, K. Characterization of the Xanthomonas campestris pv. campestris lipopolysaccharide substructures essential for elicitation of an oxidative burst in tobacco cells. Mol. Plant Microbe Interact. 2005, 18, 674–681. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lamport, D.T.; Várnai, P. Periplasmic arabinogalactan glycoproteins act as a calcium capacitor that regulates plant growth and development. New Phytol. 2013, 197, 58–64. [Google Scholar] [CrossRef] [Scilit]
- Lopez-Hernandez, F.; Tryfona, T.; Rizza, A.; Yu, X.L.; Harris, M.O.B.; Webb, A.A.R.; Kotake, T.; Dupree, P. Calcium Binding by Arabinogalactan Polysaccharides Is Important for Normal Plant Development. Plant Cell 2020, 32, 3346–3369. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Held, M.A.; Showalter, A.M. Elucidating the roles of three beta-glucuronosyltransferases (GLCATs) acting on arabinogalactan-proteins using a CRISPR-Cas9 multiplexing approach in Arabidopsis. BMC Plant Biol. 2020, 20, 221. [Google Scholar]
- Falhof, J.; Pedersen, J.T.; Fuglsang, A.T.; Palmgren, M. Plasma Membrane H+-ATPase Regulation in the Center of Plant Physiology. Mol. Plant. 2016, 9, 323–337. [Google Scholar] [CrossRef] [Scilit]
- Camoni, L.; Visconti, S.; Aducci, P.; Marra, M. From plant physiology to pharmacology: Fusicoccin leaves the leaves. Planta 2019, 249, 49–57. [Google Scholar] [CrossRef] [Scilit]
- Rivas, P.M.S.; Vechiato, F.M.V.; Borges, B.C.; Rorato, R.; Antunes-Rodrigues, J.; Elias, L.L.K. Increase in hypothalamic AMPK phosphorylation induced by prolonged exposure to LPS involves ghrelin and CB1R signaling. Horm. Behav. 2017, 93, 166–174. [Google Scholar] [CrossRef] [Scilit]
- Barabutis, N.; Uddin, M.A.; Catravas, J.D. Hsp90 inhibitors suppress P53 phosphorylation in LPS-induced endothelial inflammation. Cytokine 2019, 113, 427–432. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wei, H.K.; Deng, Z.; Jiang, S.Z.; Song, T.X.; Zhou, Y.F.; Peng, J.; Tao, Y.X. Eicosapentaenoic acid abolishes inhibition of insulin-induced mTOR phosphorylation by LPS via PTP1B downregulation in skeletal muscle. Mol. Cell Endocrinol. 2017, 439, 116–125. [Google Scholar] [CrossRef] [Scilit]
- Desaki, Y.; Kouzai, Y.; Ninomiya, Y.; Iwase, R.; Shimizu, Y.; Seko, K.; Molinaro, A.; Minami, E.; Shibuya, N.; Kaku, H.; et al. OsCERK1 plays a crucial role in the lipopolysaccharide-induced immune response of rice. New Phytol. 2018, 217, 1042–1049. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Iizasa, S.; Iizasa, E.; Matsuzaki, S.; Tanaka, H.; Kodama, Y.; Watanabe, K.; Nagano, Y. Arabidopsis LBP/BPI related-1 and -2 bind to LPS directly and regulate PR1 expression. Sci. Rep. 2016, 6, 27527. [Google Scholar] [CrossRef] [Scilit]
- Hu, Z.B.; Alfermann, A.W. Diterpenoid production in hairy root cultures of Salvia miltiorrhiza. Phytochemistry 1993, 32, 699–703. [Google Scholar]
- Veliky, I.A.; Martin, S.M. A fermenter for plant cell suspension cultures. Can. J. Microbiol. 1970, 16, 223–226. [Google Scholar] [CrossRef] [Scilit]








Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, B.; Li, X.; Li, X.; Lu, Z.; Cai, X.; Ou Yang, Q.; Ma, P.; Dong, J. Lipopolysaccharide Enhances Tanshinone Biosynthesis via a Ca2+-Dependent Manner in Salvia miltiorrhiza Hairy Roots. Int. J. Mol. Sci. 2020, 21, 9576. https://doi.org/10.3390/ijms21249576
Zhang B, Li X, Li X, Lu Z, Cai X, Ou Yang Q, Ma P, Dong J. Lipopolysaccharide Enhances Tanshinone Biosynthesis via a Ca2+-Dependent Manner in Salvia miltiorrhiza Hairy Roots. International Journal of Molecular Sciences. 2020; 21(24):9576. https://doi.org/10.3390/ijms21249576
Chicago/Turabian StyleZhang, Bin, Xueying Li, Xiuhong Li, Zhigang Lu, Xiaona Cai, Qing Ou Yang, Pengda Ma, and Juane Dong. 2020. "Lipopolysaccharide Enhances Tanshinone Biosynthesis via a Ca2+-Dependent Manner in Salvia miltiorrhiza Hairy Roots" International Journal of Molecular Sciences 21, no. 24: 9576. https://doi.org/10.3390/ijms21249576
APA StyleZhang, B., Li, X., Li, X., Lu, Z., Cai, X., Ou Yang, Q., Ma, P., & Dong, J. (2020). Lipopolysaccharide Enhances Tanshinone Biosynthesis via a Ca2+-Dependent Manner in Salvia miltiorrhiza Hairy Roots. International Journal of Molecular Sciences, 21(24), 9576. https://doi.org/10.3390/ijms21249576
