Toll-Like Receptor 7 Is Required for Lacrimal Gland Autoimmunity and Type 1 Diabetes Development in Male Nonobese Diabetic Mice
Abstract
:1. Introduction
2. Results
2.1. Development of Tlr7 Knockout NOD Mice
2.2. TLR7-Deficient NOD Mice Are Protected from Autoimmunity in a Sex-Specific Manner
2.3. RNA Sequencing of Whole Lacrimal Gland Tissue Implicates Key Immune Genes and Pathways
2.4. TLR7 Drives Up-regulation of Type I IFN-Dependent and -Independent Genes in Lacrimal Glands
3. Discussion
4. Materials and Methods
4.1. Mice
4.2. Flow Cytometry
4.3. Histology and Quantitation of Exocrine Gland Inflammation
4.4. RNA Sequencing of Lacrimal Gland RNA and Bioinformatics Analyses
4.5. Quantitative PCR
4.6. Statistical Analyses
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
DE | Differentially expressed |
FC | Fold-change |
H&E | Hematoxylin and eosin |
IL-21 | Interleukin-21 |
IFN | Interferon |
KO | Knockout |
MFI | Mean fluorescence intensity |
NOD | Nonobese diabetic |
PBMC | Peripheral blood mononuclear cell |
SS | Sjögren syndrome |
TLR | Toll-like receptor |
T1D | Type 1 diabetes |
WT | Wild-type |
References
- Vivino, F.B.; Bunya, V.Y.; Massaro-Giordano, G.; Johr, C.R.; Giattino, S.L.; Schorpion, A.; Shafer, B.; Peck, A.; Sivils, K.; Rasmussen, A.; et al. Sjogren’s syndrome: An update on disease pathogenesis, clinical manifestations and treatment. Clin. Immunol. 2019, 203, 81–121. [Google Scholar] [CrossRef] [PubMed]
- O’neill, L.A.; Golenbock, D.; Bowie, A.G. The history of Toll-like receptors—redefining innate immunity. Nat. Rev. Immunol. 2013, 13, 453–460. [Google Scholar] [CrossRef] [PubMed]
- Marshak-Rothstein, A. Toll-like receptors in systemic autoimmune disease. Nat. Rev. Immunol. 2006, 6, 823–835. [Google Scholar] [CrossRef] [PubMed]
- McWhirter, S.M.; Jefferies, C.A. Nucleic Acid Sensors as Therapeutic Targets for Human Disease. Immunity 2020, 53, 78–97. [Google Scholar] [CrossRef]
- Kiripolsky, J.; Kramer, J.M. Current and Emerging Evidence for Toll-Like Receptor Activation in Sjogren’s Syndrome. J. Immunol. Res. 2018, 2018, 1246818. [Google Scholar] [CrossRef]
- Redfern, R.L.; McDermott, A.M. Toll-like receptors in ocular surface disease. Exp. Eye Res. 2010, 90, 679–687. [Google Scholar] [CrossRef] [Green Version]
- Zhou, J.; Jin, J.O.; Du, J.; Yu, Q. Innate Immune Signaling Induces IL-7 Production, Early Inflammatory Responses, and Sjogren’s-Like Dacryoadenitis in C57BL/6 Mice. Investig. Ophthalmol. Vis. Sci. 2015, 56, 7831–7838. [Google Scholar] [CrossRef] [Green Version]
- Kiripolsky, J.; McCabe, L.G.; Kramer, J.M. Innate immunity in Sjogren’s syndrome. Clin. Immunol. 2017, 182, 4–13. [Google Scholar] [CrossRef]
- Kosenda, K.; Ichii, O.; Otsuka, S.; Hashimoto, Y.; Kon, Y. BXSB/MpJ-Yaa mice develop autoimmune dacryoadenitis with the appearance of inflammatory cell marker messenger RNAs in the lacrimal fluid. Clin. Exp. Ophthalmol. 2013, 41, 788–797. [Google Scholar] [CrossRef]
- Chen, J.Q.; Szodoray, P.; Zeher, M. Toll-Like Receptor Pathways in Autoimmune Diseases. Clin. Rev. Allergy Immunol. 2016, 50, 1–17. [Google Scholar] [CrossRef] [Green Version]
- Cooper, J.D.; Walker, N.M.; Smyth, D.J.; Downes, K.; Healy, B.C.; Todd, J.A.; Type, I.D.G.C. Follow-up of 1715 SNPs from the Wellcome Trust Case Control Consortium genome-wide association study in type I diabetes families. Genes Immun. 2009, 10 (Suppl. 1), S85–S94. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, A.S.; Ghoreishi, M.; Cheng, W.K.; Chang, T.Y.; Zhang, Y.Q.; Dutz, J.P. Toll-like receptor 7 stimulation promotes autoimmune diabetes in the NOD mouse. Diabetologia 2011, 54, 1407–1416. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tai, N.; Wong, F.S.; Wen, L. The role of the innate immune system in destruction of pancreatic beta cells in NOD mice and humans with type I diabetes. J. Autoimmun. 2016, 71, 26–34. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Z.; Ohto, U.; Shibata, T.; Krayukhina, E.; Taoka, M.; Yamauchi, Y.; Tanji, H.; Isobe, T.; Uchiyama, S.; Miyake, K.; et al. Structural Analysis Reveals that Toll-like Receptor 7 Is a Dual Receptor for Guanosine and Single-Stranded RNA. Immunity 2016, 45, 737–748. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zheng, L.; Zhang, Z.; Yu, C.; Yang, C. Expression of Toll-like receptors 7, 8, and 9 in primary Sjogren’s syndrome. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endodontol. 2010, 109, 844–850. [Google Scholar] [CrossRef] [PubMed]
- Maria, N.I.; Steenwijk, E.C.; AS, I.J.; van Helden-Meeuwsen, C.G.; Vogelsang, P.; Beumer, W.; Brkic, Z.; van Daele, P.L.; van Hagen, P.M.; van der Spek, P.J.; et al. Contrasting expression pattern of RNA-sensing receptors TLR7, RIG-I and MDA5 in interferon-positive and interferon-negative patients with primary Sjogren’s syndrome. Ann. Rheum. Dis. 2017, 76, 721–730. [Google Scholar] [CrossRef] [PubMed]
- Shimizu, T.; Nakamura, H.; Takatani, A.; Umeda, M.; Horai, Y.; Kurushima, S.; Michitsuji, T.; Nakashima, Y.; Kawakami, A. Activation of Toll-like receptor 7 signaling in labial salivary glands of primary Sjogren’s syndrome patients. Clin. Exp. Immunol 2019, 196, 39–51. [Google Scholar] [CrossRef] [Green Version]
- Park, Y.S.; Gauna, A.E.; Cha, S. Mouse Models of Primary Sjogren’s Syndrome. Curr. Pharm. Des. 2015, 21, 2350–2364. [Google Scholar] [CrossRef]
- Lieberman, S.M.; Kreiger, P.A.; Koretzky, G.A. Reversible lacrimal gland-protective regulatory T-cell dysfunction underlies male-specific autoimmune dacryoadenitis in the non-obese diabetic mouse model of Sjogren syndrome. Immunology 2015, 145, 232–241. [Google Scholar] [CrossRef] [Green Version]
- Barr, J.Y.; Wang, X.; Kreiger, P.A.; Lieberman, S.M. Salivary-gland-protective regulatory T-cell dysfunction underlies female-specific sialadenitis in the non-obese diabetic mouse model of Sjogren syndrome. Immunology 2018, 155, 225–237. [Google Scholar] [CrossRef]
- Ciecko, A.E.; Foda, B.; Barr, J.Y.; Ramanathan, S.; Atkinson, M.A.; Serreze, D.V.; Geurts, A.M.; Lieberman, S.M.; Chen, Y.G. Interleukin-27 Is Essential for Type 1 Diabetes Development and Sjogren Syndrome-like Inflammation. Cell Rep. 2019, 29, 3073–3086. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Carrero, J.A.; Benshoff, N.D.; Nalley, K.; Unanue, E.R. Type I and II Interferon Receptors Differentially Regulate Type 1 Diabetes Susceptibility in Male Versus Female NOD Mice. Diabetes 2018, 67, 1830–1835. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chaly, Y.; Barr, J.Y.; Sullivan, D.A.; Thomas, H.E.; Brodnicki, T.C.; Lieberman, S.M. Type I Interferon Signaling Is Required for Dacryoadenitis in the Nonobese Diabetic Mouse Model of Sjogren Syndrome. Int. J. Mol. Sci. 2018, 19, 3259. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Souyris, M.; Cenac, C.; Azar, P.; Daviaud, D.; Canivet, A.; Grunenwald, S.; Pienkowski, C.; Chaumeil, J.; Mejia, J.E.; Guery, J.C. TLR7 escapes X chromosome inactivation in immune cells. Sci. Immunol. 2018, 3, eaap8855. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Draghici, S.; Khatri, P.; Tarca, A.L.; Amin, K.; Done, A.; Voichita, C.; Georgescu, C.; Romero, R. A systems biology approach for pathway level analysis. Genome Res. 2007, 17, 1537–1545. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Allred, M.; Chimenti, M.S.; Ciecko, A.E.; Chen, Y.; Lieberman, S.M. Characterization of type I interferon-associated chemokines and cytokines in lacrimal glands of nonobese diabetic mice. 2020; in preparation. [Google Scholar]
- Harris, V.M.; Sharma, R.; Cavett, J.; Kurien, B.T.; Liu, K.; Koelsch, K.A.; Rasmussen, A.; Radfar, L.; Lewis, D.; Stone, D.U.; et al. Klinefelter’s syndrome (47,XXY) is in excess among men with Sjogren’s syndrome. Clin. Immunol. 2016, 168, 25–29. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, K.; Kurien, B.T.; Zimmerman, S.L.; Kaufman, K.M.; Taft, D.H.; Kottyan, L.C.; Lazaro, S.; Weaver, C.A.; Ice, J.A.; Adler, A.J.; et al. X Chromosome Dose and Sex Bias in Autoimmune Diseases: Increased Prevalence of 47,XXX in Systemic Lupus Erythematosus and Sjogren’s Syndrome. Arthritis Rheumatol. 2016, 68, 1290–1300. [Google Scholar] [CrossRef]
- Cha, S.; Brayer, J.; Gao, J.; Brown, V.; Killedar, S.; Yasunari, U.; Peck, A.B. A dual role for interferon-gamma in the pathogenesis of Sjogren’s syndrome-like autoimmune exocrinopathy in the nonobese diabetic mouse. Scand. J. Immunol. 2004, 60, 552–565. [Google Scholar] [CrossRef]
- Hall, J.C.; Baer, A.N.; Shah, A.A.; Criswell, L.A.; Shiboski, C.H.; Rosen, A.; Casciola-Rosen, L. Molecular Subsetting of Interferon Pathways in Sjogren’s Syndrome. Arthritis Rheumatol. 2015, 67, 2437–2446. [Google Scholar] [CrossRef] [Green Version]
- Haskett, S.; Ding, J.; Zhang, W.; Thai, A.; Cullen, P.; Xu, S.; Petersen, B.; Kuznetsov, G.; Jandreski, L.; Hamann, S.; et al. Identification of Novel CD4+ T Cell Subsets in the Target Tissue of Sjogren’s Syndrome and Their Differential Regulation by the Lymphotoxin/LIGHT Signaling Axis. J. Immunol. 2016, 197, 3806–3819. [Google Scholar] [CrossRef] [Green Version]
- Reed, J.H.; Verstappen, G.M.; Rischmueller, M.; Bryant, V.L. When B cells break bad: Development of pathogenic B cells in Sjogren’s syndrome. Clin. Exp. Rheumatol. 2020, 38 (Suppl 126), 271–282. [Google Scholar] [PubMed]
- Robinson, C.P.; Brayer, J.; Yamachika, S.; Esch, T.R.; Peck, A.B.; Stewart, C.A.; Peen, E.; Jonsson, R.; Humphreys-Beher, M.G. Transfer of human serum IgG to nonobese diabetic Igmu null mice reveals a role for autoantibodies in the loss of secretory function of exocrine tissues in Sjogren’s syndrome. Proc. Natl. Acad. Sci. USA 1998, 95, 7538–7543. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hunger, R.E.; Carnaud, C.; Vogt, I.; Mueller, C. Male gonadal environment paradoxically promotes dacryoadenitis in nonobese diabetic mice. J. Clin. Investig. 1998, 101, 1300–1309. [Google Scholar] [CrossRef] [Green Version]
- Subramanian, S.; Tus, K.; Li, Q.Z.; Wang, A.; Tian, X.H.; Zhou, J.; Liang, C.; Bartov, G.; McDaniel, L.D.; Zhou, X.J.; et al. A Tlr7 translocation accelerates systemic autoimmunity in murine lupus. Proc. Natl. Acad. Sci. USA 2006, 103, 9970–9975. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Imgenberg-Kreuz, J.; Sandling, J.K.; Bjork, A.; Nordlund, J.; Kvarnstrom, M.; Eloranta, M.L.; Ronnblom, L.; Wahren-Herlenius, M.; Syvanen, A.C.; Nordmark, G. Transcription profiling of peripheral B cells in antibody-positive primary Sjogren’s syndrome reveals upregulated expression of CX3CR1 and a type I and type II interferon signature. Scand. J. Immunol. 2018, 87, e12662. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Quah, H.S.; Miranda-Hernandez, S.; Khoo, A.; Harding, A.; Fynch, S.; Elkerbout, L.; Brodnicki, T.C.; Baxter, A.G.; Kay, T.W.; Thomas, H.E.; et al. Deficiency in type I interferon signaling prevents the early interferon-induced gene signature in pancreatic islets but not type 1 diabetes in NOD mice. Diabetes 2014, 63, 1032–1040. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Serreze, D.V.; Post, C.M.; Chapman, H.D.; Johnson, E.A.; Lu, B.; Rothman, P.B. Interferon-gamma receptor signaling is dispensable in the development of autoimmune type 1 diabetes in NOD mice. Diabetes 2000, 49, 2007–2011. [Google Scholar] [CrossRef] [Green Version]
- Markle, J.G.; Frank, D.N.; Mortin-Toth, S.; Robertson, C.E.; Feazel, L.M.; Rolle-Kampczyk, U.; von Bergen, M.; McCoy, K.D.; Macpherson, A.J.; Danska, J.S. Sex differences in the gut microbiome drive hormone-dependent regulation of autoimmunity. Science 2013, 339, 1084–1088. [Google Scholar] [CrossRef] [Green Version]
- Yurkovetskiy, L.; Burrows, M.; Khan, A.A.; Graham, L.; Volchkov, P.; Becker, L.; Antonopoulos, D.; Umesaki, Y.; Chervonsky, A.V. Gender bias in autoimmunity is influenced by microbiota. Immunity 2013, 39, 400–412. [Google Scholar] [CrossRef] [Green Version]
- Wen, L.; Ley, R.E.; Volchkov, P.Y.; Stranges, P.B.; Avanesyan, L.; Stonebraker, A.C.; Hu, C.; Wong, F.S.; Szot, G.L.; Bluestone, J.A.; et al. Innate immunity and intestinal microbiota in the development of Type 1 diabetes. Nature 2008, 455, 1109–1113. [Google Scholar] [CrossRef]
- Burrows, M.P.; Volchkov, P.; Kobayashi, K.S.; Chervonsky, A.V. Microbiota regulates type 1 diabetes through Toll-like receptors. Proc. Natl. Acad. Sci. USA 2015, 112, 9973–9977. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tai, N.; Wong, F.S.; Wen, L. TLR9 deficiency promotes CD73 expression in T cells and diabetes protection in nonobese diabetic mice. J. Immunol. 2013, 191, 2926–2937. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lintner, K.E.; Wu, Y.L.; Yang, Y.; Spencer, C.H.; Hauptmann, G.; Hebert, L.A.; Atkinson, J.P.; Yu, C.Y. Early Components of the Complement Classical Activation Pathway in Human Systemic Autoimmune Diseases. Front. Immunol. 2016, 7, 36. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kamitaki, N.; Sekar, A.; Handsaker, R.E.; de Rivera, H.; Tooley, K.; Morris, D.L.; Taylor, K.E.; Whelan, C.W.; Tombleson, P.; Loohuis, L.M.O.; et al. Complement genes contribute sex-biased vulnerability in diverse disorders. Nature 2020, 582, 577–581. [Google Scholar] [CrossRef]
- Baxter, A.G.; Cooke, A. Complement lytic activity has no role in the pathogenesis of autoimmune diabetes in NOD mice. Diabetes 1993, 42, 1574–1578. [Google Scholar] [CrossRef]
- Tandon, M.; Perez, P.; Burbelo, P.D.; Calkins, C.; Alevizos, I. Laser microdissection coupled with RNA-seq reveal cell-type and disease-specific markers in the salivary gland of Sjogren’s syndrome patients. Clin. Exp. Rheumatol. 2017, 35, 777–785. [Google Scholar]
- Kwok, S.K.; Lee, J.; Yu, D.; Kang, K.Y.; Cho, M.L.; Kim, H.R.; Ju, J.H.; Lee, S.H.; Park, S.H.; Kim, H.Y. A pathogenetic role for IL-21 in primary Sjogren syndrome. Nat. Rev. Rheumatol. 2015, 11, 368–374. [Google Scholar] [CrossRef]
- Valensi, M.; Goldman, G.; Marchant, D.; Van Den Berghe, L.; Jonet, L.; Daruich, A.; Robert, M.P.; Krejci, E.; Klein, C.; Mascarelli, F.; et al. Sostdc1 is expressed in all major compartments of developing and adult mammalian eyes. Graefes Arch. Clin. Exp. Ophthalmol. 2019, 257, 2401–2427. [Google Scholar] [CrossRef]
- Wu, X.; Wang, Y.; Huang, R.; Gai, Q.; Liu, H.; Shi, M.; Zhang, X.; Zuo, Y.; Chen, L.; Zhao, Q.; et al. SOSTDC1-producing follicular helper T cells promote regulatory follicular T cell differentiation. Science 2020, 369, 984–988. [Google Scholar] [CrossRef]
- Tellefsen, S.; Morthen, M.K.; Richards, S.M.; Lieberman, S.M.; Rahimi Darabad, R.; Kam, W.R.; Sullivan, D.A. Sex Effects on Gene Expression in Lacrimal Glands of Mouse Models of Sjogren Syndrome. Investig. Ophthalmol. Vis. Sci. 2018, 59, 5599–5614. [Google Scholar] [CrossRef] [Green Version]
- Negishi, H.; Endo, N.; Nakajima, Y.; Nishiyama, T.; Tabunoki, Y.; Nishio, J.; Koshiba, R.; Matsuda, A.; Matsuki, K.; Okamura, T.; et al. Identification of U11snRNA as an endogenous agonist of TLR7-mediated immune pathogenesis. Proc. Natl. Acad. Sci. USA 2019, 116, 23653–23661. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Barr, J.Y.; Wang, X.; Meyerholz, D.K.; Lieberman, S.M. CD8 T cells contribute to lacrimal gland pathology in the nonobese diabetic mouse model of Sjogren syndrome. Immunol. Cell Biol. 2017, 95, 684–694. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 2012, 9, 671–675. [Google Scholar] [CrossRef] [PubMed]
- Patro, R.; Duggal, G.; Love, M.I.; Irizarry, R.A.; Kingsford, C. Salmon provides fast and bias-aware quantification of transcript expression. Nat. Methods 2017, 14, 417–419. [Google Scholar] [CrossRef] [Green Version]
- Soneson, C.; Love, M.I.; Robinson, M.D. Differential analyses for RNA-seq: Transcript-level estimates improve gene-level inferences. F1000Res 2015, 4, 1521. [Google Scholar] [CrossRef]
- Okonechnikov, K.; Conesa, A.; Garcia-Alcalde, F. Qualimap 2: Advanced multi-sample quality control for high-throughput sequencing data. Bioinformatics 2016, 32, 292–294. [Google Scholar] [CrossRef]
- Garcia-Alcalde, F.; Okonechnikov, K.; Carbonell, J.; Cruz, L.M.; Gotz, S.; Tarazona, S.; Dopazo, J.; Meyer, T.F.; Conesa, A. Qualimap: Evaluating next-generation sequencing alignment data. Bioinformatics 2012, 28, 2678–2679. [Google Scholar] [CrossRef]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R.; Genome Project Data Processing, S. The Sequence Alignment/Map format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef] [Green Version]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [Green Version]
- Edgar, R.; Domrachev, M.; Lash, A.E. Gene Expression Omnibus: NCBI gene expression and hybridization array data repository. Nucleic Acids Res. 2002, 30, 207–210. [Google Scholar] [CrossRef] [Green Version]
- Hashimoto-Kataoka, T.; Hosen, N.; Sonobe, T.; Arita, Y.; Yasui, T.; Masaki, T.; Minami, M.; Inagaki, T.; Miyagawa, S.; Sawa, Y.; et al. Interleukin-6/interleukin-21 signaling axis is critical in the pathogenesis of pulmonary arterial hypertension. Proc. Natl. Acad. Sci. USA 2015, 112, E2677–E2686. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jiang, B.C.; Cao, D.L.; Zhang, X.; Zhang, Z.J.; He, L.N.; Li, C.H.; Zhang, W.W.; Wu, X.B.; Berta, T.; Ji, R.R.; et al. CXCL13 drives spinal astrocyte activation and neuropathic pain via CXCR5. J. Clin. Investig. 2016, 126, 745–761. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Millan, A.J.; Elizaldi, S.R.; Lee, E.M.; Aceves, J.O.; Murugesh, D.; Loots, G.G.; Manilay, J.O. Sostdc1 Regulates NK Cell Maturation and Cytotoxicity. J. Immunol. 2019, 202, 2296–2306. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhou, Y.; Zhou, B.; Pache, L.; Chang, M.; Khodabakhshi, A.H.; Tanaseichuk, O.; Benner, C.; Chanda, S.K. Metascape provides a biologist-oriented resource for the analysis of systems-level datasets. Nat. Commun. 2019, 10, 1523. [Google Scholar] [CrossRef] [PubMed]
- Steidl, U.; Rosenbauer, F.; Verhaak, R.G.; Gu, X.; Ebralidze, A.; Otu, H.H.; Klippel, S.; Steidl, C.; Bruns, I.; Costa, D.B.; et al. Essential role of Jun family transcription factors in PU.1 knockdown-induced leukemic stem cells. Nat. Genet. 2006, 38, 1269–1277. [Google Scholar] [CrossRef]
- van de Pavert, S.A.; Olivier, B.J.; Goverse, G.; Vondenhoff, M.F.; Greuter, M.; Beke, P.; Kusser, K.; Hopken, U.E.; Lipp, M.; Niederreither, K.; et al. Chemokine CXCL13 is essential for lymph node initiation and is induced by retinoic acid and neuronal stimulation. Nat. Immunol. 2009, 10, 1193–1199. [Google Scholar] [CrossRef] [Green Version]
- Allen, T.A.; Von Kaenel, S.; Goodrich, J.A.; Kugel, J.F. The SINE-encoded mouse B2 RNA represses mRNA transcription in response to heat shock. Nat. Struct. Mol. Biol. 2004, 11, 816–821. [Google Scholar] [CrossRef]
Protein Name | Gene Symbol | Ensembl ID | LogFC | p-Value 2 |
---|---|---|---|---|
Immunoglobulin heavy constant gamma 2C | Ighg2c | ENSMUSG00000076612 | −7.82263 | 9.82 × 10−16 |
Complement 4a | C4a | ENSMUSG00000015451 | −5.34572 | 8.51 × 10−7 |
Immunoglobulin heavy variable 9-1 | Ighv9-1 | ENSMUSG00000096805 | −5.33515 | 8.83 × 10−9 |
Immunoglobulin heavy constant gamma 2B | Ighg2b | ENSMUSG00000076613 | −5.07854 | 4.75 × 10−38 |
Interleukin-21 | Il21 | ENSMUSG00000027718 | −4.57119 | 0.002267 |
Glutamate decarboxylase 1 | Gad1 | ENSMUSG00000070880 | −4.54398 | 5.80 × 10−5 |
RIKEN cDNA G530011O06 gene | G530011O06Rik | ENSMUSG00000072844 | −3.95434 | 8.40 × 10−8 |
histocompatibility 2, O region beta locus | H2-Ob | ENSMUSG00000041538 | −3.94349 | 0.000705 |
Asialoglycoprotein receptor 1 | Asgr1 | ENSMUSG00000020884 | −3.90959 | 1.26 × 10−17 |
Junctional cadherin complex regulator | Jhy | ENSMUSG00000032023 | −3.86272 | 0.003172 |
Receptor-type tyrosine-protein phosphatase V | Ptprv | ENSMUSG00000097993 | −3.81638 | 0.006741 |
Sclerostin domain containing 1 | Sostdc1 | ENSMUSG00000036169 | −3.81371 | 0.000239 |
Mitogen-activated protein kinase kinase kinase 19 | Map3k19 | ENSMUSG00000051590 | −3.78867 | 0.001609 |
B cell activating factor receptor (BAFF-R) | Tnfrsf13c | ENSMUSG00000068105 | −3.77041 | 0.00071 |
Alpha-1-antitrypsin 1-1 | Serpina1a | ENSMUSG00000066366 | −3.76237 | 0.032582 |
Hepatitis A virus cellular receptor 1 | Havcr1 | ENSMUSG00000040405 | −3.72396 | 0.003191 |
C-X-C motif chemokine receptor 5 | Cxcr5 | ENSMUSG00000047880 | −3.63713 | 0.001409 |
carbohydrate sulfotransferase 3 | Chst3 | ENSMUSG00000057337 | −3.53362 | 0.000264 |
Fc receptor-like 1 | Fcrl1 | ENSMUSG00000059994 | −3.52988 | 0.000323 |
Polyunsaturated fatty acid (12S)/(13S)-lipoxygenase, epidermal-type | Alox12e | ENSMUSG00000018907 | −3.51249 | 1.13 × 10−12 |
Pathway | DE Genes/Total | p-Value 2 |
---|---|---|
Cell adhesion molecules | 66/101 | 4.34 × 10−10 |
Cytokine-cytokine receptor interaction | 76/139 | 3.63 × 10−6 |
Antigen processing and presentation | 39/63 | 3.63 × 10−6 |
Phagosome | 71/131 | 1.04 × 10−5 |
Human T cell leukemia virus 1 infection | 93/200 | 7.06 × 10−5 |
Natural killer cell mediated cytotoxicity | 41/77 | 0.000132 |
Complement and coagulation cascades | 27/45 | 0.000173 |
Leukocyte transendothelial migration | 46/88 | 0.000248 |
Hematopoietic cell lineage | 41/69 | 0.000349 |
Viral myocarditis | 40/56 | 0.000494 |
Gene | Ensembl ID | LogFC | p-Value 2 |
---|---|---|---|
H2-Ob | ENSMUSG00000041538 | −3.94349 | 0.000705275 |
Cd22 | ENSMUSG00000030577 | −3.31601 | 0.000119483 |
Glycam1 | ENSMUSG00000022491 | −3.13053 | 0.01223442 |
Pdcd1 | ENSMUSG00000026285 | −3.08293 | 2.57387 × 10−6 |
H2-Oa | ENSMUSG00000024334 | −3.06688 | 0.000401944 |
Sell | ENSMUSG00000026581 | −2.80719 | 0.008678722 |
Cd2 | ENSMUSG00000027863 | −2.76434 | 0.010163565 |
H2-DMb2 | ENSMUSG00000037548 | −2.76392 | 0.001751811 |
H2-Q7 | ENSMUSG00000060550 | −2.59737 | 0.018849387 |
Ctla4 | ENSMUSG00000026011 | −2.56514 | 0.010040012 |
Gene | Ensembl ID | LogFC | p-Value 2 |
---|---|---|---|
Il21 | ENSMUSG00000027718 | −4.57119 | 0.002267 |
Tnfrsf13c | ENSMUSG00000068105 | −3.77041 | 0.00071 |
Cxcr5 | ENSMUSG00000047880 | −3.63713 | 0.001409 |
Ccl20 | ENSMUSG00000026166 | −3.39023 | 0.000001 |
Cxcr4 | ENSMUSG00000045382 | −3.24664 | 0.000001 |
Cxcl13 | ENSMUSG00000023078 | −3.00501 | 0.000001 |
Ccr6 | ENSMUSG00000040899 | −2.91986 | 7.71 × 10−5 |
Tnfsf8 | ENSMUSG00000028362 | −2.73458 | 0.00033 |
Ccl19 | ENSMUSG00000071005 | −2.70432 | 0.02331 |
Ltb | ENSMUSG00000024399 | −2.64806 | 0.002418 |
Target | Sequence | References |
---|---|---|
Tnfrsf13c Fwd | AGATGGGCATGGTGGTACACA | [66] |
Tnfrsf13c Rev | TGGAACTTGCTATGTAGACCAGGAT | |
Il21 Fwd | GGACAGTGGCCCATAAATCA | [62] |
Il21 Rev | CAGGGTTTGATGGCTTGAGT | |
Cxcr5 Fwd | TGGCCTTCTACAGTAACAGCA | [63] |
Cxcr5 Rev | GCATGAATACCGCCTTAAAGGAC | |
Sostdc1 Fwd | CACCCTGAATCAAGCCAGGA | [64] |
Sostdc1 Rev | TAGCCTCCTCCGATCCAGTT | |
C4a Fwd | AAACTCAGAATCTTCAGCACAA | |
C4a Rev | GGAAGAAAGATGGCTCTTTTG | |
Cxcl13 Fwd | CATAGATCGGATTCAAGTTACGCC | [67] |
Cxcl13 Rev | TCTTGGTCCAGATCACAACTTCA | |
Hk2 Fwd | CCCTGTGAAGATGTTGCCCAC | [68] |
Hk2 Rev | TGCCCATGTACTCAAGGAAGT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Debreceni, I.L.; Chimenti, M.S.; Serreze, D.V.; Geurts, A.M.; Chen, Y.-G.; Lieberman, S.M. Toll-Like Receptor 7 Is Required for Lacrimal Gland Autoimmunity and Type 1 Diabetes Development in Male Nonobese Diabetic Mice. Int. J. Mol. Sci. 2020, 21, 9478. https://doi.org/10.3390/ijms21249478
Debreceni IL, Chimenti MS, Serreze DV, Geurts AM, Chen Y-G, Lieberman SM. Toll-Like Receptor 7 Is Required for Lacrimal Gland Autoimmunity and Type 1 Diabetes Development in Male Nonobese Diabetic Mice. International Journal of Molecular Sciences. 2020; 21(24):9478. https://doi.org/10.3390/ijms21249478
Chicago/Turabian StyleDebreceni, Ivy L., Michael S. Chimenti, David V. Serreze, Aron M. Geurts, Yi-Guang Chen, and Scott M. Lieberman. 2020. "Toll-Like Receptor 7 Is Required for Lacrimal Gland Autoimmunity and Type 1 Diabetes Development in Male Nonobese Diabetic Mice" International Journal of Molecular Sciences 21, no. 24: 9478. https://doi.org/10.3390/ijms21249478
APA StyleDebreceni, I. L., Chimenti, M. S., Serreze, D. V., Geurts, A. M., Chen, Y.-G., & Lieberman, S. M. (2020). Toll-Like Receptor 7 Is Required for Lacrimal Gland Autoimmunity and Type 1 Diabetes Development in Male Nonobese Diabetic Mice. International Journal of Molecular Sciences, 21(24), 9478. https://doi.org/10.3390/ijms21249478