Transferrin-Bound Doxorubicin Enhances Apoptosis and DNA Damage through the Generation of Pro-Inflammatory Responses in Human Leukemia Cells
Abstract
:1. Introduction
2. Results
2.1. Various Forms of Doxorubicin Exert Differential Cytotoxicity in Human Leukemia Cells
2.2. DOX–Tf Conjugate Generates the Accumulation of ɣH2AX Phosphorylation
2.3. Conjugate-Dependent DNA Damage/Lesions Are Connected to Apoptotic Cell Death
2.4. The Extrinsic TRAIL-Dependent Apoptotic Pathway Is Triggered by DOX–Tf Conjugate in Human Leukemia Cells
2.5. The Growth of TNF-α Expression Is Initiated by Tf-Bound DOX and Free Drug in Human Leukemia Cells
2.6. The Involvement of IL-6 and IL-4 Cytokines in DOX–Tf Cytotoxicity
3. Discussion
4. Materials and Methods
4.1. Reagents
4.2. Cell Culture
4.3. Cell Cytotoxicity Assay
4.4. H2AX Assay
4.5. TUNEL Assay
4.6. ELISA
4.7. Quantitative Real-Time RT-PCR
4.8. Statistical Analysis
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
ALL | acute lymphoblastic leukemia |
CML | chronic myelogenous leukemia |
DOX | Doxorubicin |
DOX–Tf | Doxorubicin–transferrin conjugate |
FBS | Fetal bovine serum |
HMBS | Hydroxymethylbilane synthase (HMBS) |
HPRT1 | Hypoxanthine phosphoribosyltransferase 1 |
IL-1 | interleukin-1 |
TfR | Transferrin receptors |
TNF-α | tumor necrosis factor-α |
NF-κB | nuclear factor-κB |
TRAIL | TNF-related apoptosis-inducing ligand |
FADD | Fas-associated death domain-containing protein |
DISC | death-inducing signaling complex |
References
- Dong, Y.; Shi, O.; Zeng, Q.; Lu, X.; Wang, W.; Li, Y.; Wang, Q. Leukemia incidence trends at the global, regional, and national level between 1990 and 2017. Exp. Hematol. Oncol. 2020, 9, 14. [Google Scholar] [CrossRef]
- Muselli, F.; Peyron, J.-F.; Mary, D. Druggable Biochemical Pathways and Potential Therapeutic Alternatives to Target Leukemic Stem Cells and Eliminate the Residual Disease in Chronic Myeloid Leukemia. Int. J. Mol. Sci. 2019, 20, 5616. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Green, S.D.; Konig, H. Treatment of Acute Myeloid Leukemia in the Era of Genomics—Achievements and Persisting Challenges. Front. Genet. 2020, 11, 480. [Google Scholar] [CrossRef] [PubMed]
- Loscocco, F.; Visani, G.; Galimberti, S.; Curti, A.; Isidori, A. BCR-ABL Independent Mechanisms of Resistance in Chronic Myeloid Leukemia. Front. Oncol. 2019, 9. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Phelan, K.W.; Advani, A.S. Novel Therapies in Acute Lymphoblastic Leukemia. Curr. Hematol. Malign Rep. 2018, 13, 289–299. [Google Scholar] [CrossRef]
- Imai, K. Acute lymphoblastic leukemia: Pathophysiology and current therapy. [Rinsho ketsueki] Jpn. J. Clin. Hematol. 2017, 58, 460–470. [Google Scholar]
- Sauter, K.A.D.; Wood, L.J.; Wong, J.; Iordanov, M.; Magun, B.E. Doxorubicin and daunorubicin induce processing and release of interleukin-1β through activation of the NLRP3 inflammasome. Cancer Biol. Ther. 2011, 11, 1008–1016. [Google Scholar] [CrossRef] [Green Version]
- Pai, V.B.; Nahata, M.C. Cardiotoxicity of chemotherapeutic agents: Incidence, treatment and prevention. Drug Saf. 2000, 22, 263–302. [Google Scholar] [CrossRef]
- Tien, C.-C.; Peng, Y.-C.; Yang, F.-L.; Subeq, Y.-M.; Lee, R.-P. Slow infusion rate of doxorubicin induces higher pro-inflammatory cytokine production. Regul. Toxicol. Pharmacol. 2016, 81, 69–76. [Google Scholar] [CrossRef]
- Kabel, A.M.; Alzahrani, A.A.; Bawazir, N.M.; Khawtani, R.O.; Arab, H.H. Targeting the proinflammatory cytokines, oxidative stress, apoptosis and TGF-β1/STAT-3 signaling by irbesartan to ameliorate doxorubicin-induced hepatotoxicity. J. Infect. Chemother. 2018, 24, 623–631. [Google Scholar] [CrossRef]
- Sala, V.; Della Sala, A.; Hirsch, E.; Ghigo, A. Signaling Pathways Underlying Anthracycline Cardiotoxicity. Antioxid. Redox Signal. 2020, 32, 1098–1114. [Google Scholar] [CrossRef]
- Singla, D.K.; Johnson, T.A.; Dargani, Z.T. Exosome Treatment Enhances Anti-Inflammatory M2 Macrophages and Reduces Inflammation-Induced Pyroptosis in Doxorubicin-Induced Cardiomyopathy. Cells 2019, 8, 1224. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dargani, Z.T.; Singla, D.K. Embryonic stem cell-derived exosomes inhibit doxorubicin-induced TLR4-NLRP3-mediated cell death-pyroptosis. Am. J. Physiol. Circ. Physiol. 2019, 317, H460–H471. [Google Scholar] [CrossRef] [PubMed]
- Xu, L.; Hu, X.; Qu, X.; Hou, K.; Zheng, H.; Liu, Y. Cetuximab enhances TRAIL-induced gastric cancer cell apoptosis by promoting DISC formation in lipid rafts. Biochem. Biophys. Res. Commun. 2013, 439, 285–290. [Google Scholar] [CrossRef]
- Walker, L.; Perkins, E.; Kratz, F.; Raucher, D. Cell penetrating peptides fused to a thermally targeted biopolymer drug carrier improve the delivery and antitumor efficacy of an acid-sensitive doxorubicin derivative. Int. J. Pharm. 2012, 436, 825–832. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kratz, F.; Warnecke, A.; Schmid, B.; Chung, D.-E.; Gitzel, M. Prodrugs of Anthracyclines in Cancer Chemotherapy. Curr. Med. Chem. 2006, 13, 477–523. [Google Scholar] [CrossRef] [PubMed]
- Florent, J.C.; Monneret, C. Doxorubicin conjugates for selective delivery to tumors. Top. Curr. Chem. 2008, 283, 99–140. [Google Scholar] [PubMed]
- Kawabata, H. Transferrin and transferrin receptors update. Free Radic. Biol. Med. 2019, 133, 46–54. [Google Scholar] [CrossRef] [PubMed]
- Hedley, D.; Rugg, C.; Musgrove, E.; Taylor, I. Modulation of transferrin receptor expression by inhibitors of nucleic acid synthesis. J. Cell. Physiol. 1985, 124, 61–66. [Google Scholar] [CrossRef]
- Bridges, K.R.; Smith, B.R. Discordance between transferrin receptor expression and susceptibility to lysis by natural killer cells. J. Clin. Investig. 1985, 76, 913–918. [Google Scholar] [CrossRef] [Green Version]
- Szwed, M.; Laroche-Clary, A.; Robert, J.; Jozwiak, Z. Induction of apoptosis by doxorubicin–transferrin conjugate compared to free doxorubicin in the human leukemia cell lines. Chem. Interact. 2014, 220, 140–148. [Google Scholar] [CrossRef] [PubMed]
- Szwed, M.; Kania, K.D.; Jozwiak, Z. Assessment of pro-apoptotic activity of doxorubicin-transferrin conjugate in cells derived from human solid tumors. Int. J. Biochem. Cell Biol. 2016, 70, 57–67. [Google Scholar] [CrossRef] [PubMed]
- Szwed, M.; Laroche-Clary, A.; Robert, J.; Jozwiak, Z. Efficacy of doxorubicin-transferrin conjugate in apoptosis induction in human leukemia cells through reactive oxygen species generation. Cell. Oncol. 2016, 39, 107–118. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Szwed, M.; Jozwiak, Z. Genotoxic effect of doxorubicin–transferrin conjugate on human leukemia cells. Mutat. Res. Toxicol. Environ. Mutagen. 2014, 771, 53–63. [Google Scholar] [CrossRef]
- Twomey, J.D.; Kim, S.-R.; Zhao, L.; Bozza, W.P.; Zhang, B. Spatial dynamics of TRAIL death receptors in cancer cells. Drug Resist. Updates 2015, 19, 13–21. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Foghsgaard, L.; Wissing, D.; Mauch, D.; Lademann, U.; Bastholm, L.; Boes, M.; Elling, F.; Leist, M.; Jäättelä, M. Cathepsin B Acts as a Dominant Execution Protease in Tumor Cell Apoptosis Induced by Tumor Necrosis Factor. J. Cell Biol. 2001, 153, 999–1010. [Google Scholar] [CrossRef] [Green Version]
- Falvo, J.V.; Tsytsykova, A.V.; Goldfeld, A.E. Transcriptional Control of the TNF Gene. Curr. Dir. Autoimmun. 2010, 11, 27–60. [Google Scholar] [CrossRef] [Green Version]
- Wojdasiewicz, P.; Poniatowski, Ł.A.; Szukiewicz, D. The Role of Inflammatory and Anti-Inflammatory Cytokines in the Pathogenesis of Osteoarthritis. Mediat. Inflamm. 2014, 2014. [Google Scholar] [CrossRef] [Green Version]
- Jones, V.S.; Huang, R.-Y.; Chen, L.-P.; Chen, Z.-S.; Fu, L.; Huang, R.-P. Cytokines in cancer drug resistance: Cues to new therapeutic strategies. Biochim. Biophys. Acta (BBA) Rev. Cancer 2016, 1865, 255–265. [Google Scholar] [CrossRef] [Green Version]
- Peña-Martínez, P.; Eriksson, M.; Ramakrishnan, R.; Chapellier, M.; Högberg, C.; Orsmark-Pietras, C.; Richter, J.; Hagström-Andersson, A.K.; Fioretos, T.; Järås, M. Interleukin 4 induces apoptosis of acute myeloid leukemia cells in a Stat6-dependent manner. Leukemia 2018, 32, 588–596. [Google Scholar] [CrossRef] [Green Version]
- Rogalska, A.; Szwed, M.; Jozwiak, Z. Aclarubicin-induced apoptosis and necrosis in cells derived from human solid tumours. Mutat. Res. Toxicol. Environ. Mutagen. 2010, 700, 1–10. [Google Scholar] [CrossRef]
- Lubgan, D.; Jóźwiak, Z.; Grabenbauer, G.G.; Distel, L.V.R. Doxorubicin-transferrin conjugate selectively overcomes multidrug resistance in leukaemia cells. Cell. Mol. Biol. Lett. 2009, 14, 113–127. [Google Scholar] [CrossRef] [PubMed]
- Szwed, M.; Wrona, D.; Kania, K.D.; Koceva-Chyla, A.; Marczak, A. Doxorubicin–transferrin conjugate triggers pro-oxidative disorders in solid tumor cells. Toxicol. Vitr. 2016, 31, 60–71. [Google Scholar] [CrossRef] [PubMed]
- Szwed, M.; Kania, K.D.; Jóźwiak, Z. Changes in the activity of antioxidant barrier after treatment of K562 and CCRF-CEM cell lines with doxorubicin–transferrin conjugate. Biochimie 2014, 107, 358–366. [Google Scholar] [CrossRef] [PubMed]
- Szwed, M.; Kania, K.D.; Jóźwiak, Z. Toxicity of doxorubicin-transferrin conjugate is connected to the modulation of Wnt/β-catenin pathway in human leukemia cells. Leuk. Res. 2015, 39, 1096–1102. [Google Scholar] [CrossRef] [PubMed]
- Pelosi, E.; Testa, U.; Louache, F.; Thomopoulos, P.; Salvo, G.; Samoggia, P.; Peschle, C. Expression of transferrin receptors in phytohemagglutinin-stimulated human T-lymphocytes. Evidence for a three-step model. J. Biol. Chem. 1986, 261, 3036–3042. [Google Scholar]
- Jiang, G.; Tan, Y.; Wang, H.; Peng, L.; Chen, H.-T.; Meng, X.-J.; Li, L.-L.; Liu, Y.; Li, W.-F.; Shan, H. The relationship between autophagy and the immune system and its applications for tumor immunotherapy. Mol. Cancer 2019, 18, 1–22. [Google Scholar] [CrossRef] [Green Version]
- Sarosiek, K.A.; Nechushtan, H.; Lu, X.; Rosenblatt, J.D.; Lossos, I.S. Interleukin-4 distinctively modifies responses of germinal centre-like and activated B-cell-like diffuse large B-cell lymphomas to immuno-chemotherapy. Br. J. Haematol. 2009, 147, 308–318. [Google Scholar] [CrossRef] [Green Version]
- Wei, L.-H.; Kuo, M.-L.; Chen, C.-A.; Chou, C.-H.; Cheng, W.-F.; Chang, M.-C.; Hung, M.-C.; Hsieh, C.-Y. The anti-apoptotic role of interleukin-6 in human cervical cancer is mediated by up-regulation of Mcl-1 through a PI 3-K/Akt pathway. Oncogene 2001, 20, 5799–5809. [Google Scholar] [CrossRef] [Green Version]
- Wang, H.; Jia, L.; Li, Y.; Farren, T.; Agrawal, S.G.; Liu, F. Increased autocrine interleukin-6 production is significantly associated with worse clinical outcome in patients with chronic lymphocytic leukemia. J. Cell. Physiol. 2019, 234, 13994–14006. [Google Scholar] [CrossRef] [Green Version]
- Zhang, W.; Yu, J.; Dong, Q.; Zhao, H.; Li, F.; Li, H. A mutually beneficial relationship between hepatocytes and cardiomyocytes mitigates doxorubicin-induced toxicity. Toxicol. Lett. 2014, 227, 157–163. [Google Scholar] [CrossRef] [PubMed]
- Ramírez-Expósito, M.J.; Martínez-Martos, J.M. Anti-Inflammatory and Antitumor Effects of Hydroxytyrosol but Not Oleuropein on Experimental Glioma In Vivo. A Putative Role for the Renin-Angiotensin System. Biomedicines 2018, 6, 11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dai, X.; Zhang, J.; Arfuso, F.; Chinnathambi, A.; Zayed, M.E.; Alharbi, S.A.; Kumar, A.P.; Ahn, K.S.; Sethi, G. Targeting TNF-related apoptosis-inducing ligand (TRAIL) receptor by natural products as a potential therapeutic approach for cancer therapy. Exp. Biol. Med. 2015, 240, 760–773. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Itoh, N.; Yonehara, S.; Ishii, A.; Yonehara, M.; Mizushima, S.-I.; Sameshima, M.; Hase, A.; Seto, Y.; Nagata, S. The polypeptide encoded by the cDNA for human cell surface antigen Fas can mediate apoptosis. Cell 1991, 66, 233–243. [Google Scholar] [CrossRef]
- Wiley, S.R.; Schooley, K.; Smolak, P.J.; Din, W.S.; Huang, C.-P.; Nicholl, J.K.; Sutherland, G.R.; Smith, T.D.; Rauch, C.; Smith, C.A.; et al. Identification and characterization of a new member of the TNF family that induces apoptosis. Immunity 1995, 3, 673–682. [Google Scholar] [CrossRef] [Green Version]
- Walczak, H.; Miller, R.E.; Ariail, K.; Gliniak, B.; Griffith, T.S.; Kubin, M.; Chin, W.; Jones, J.; Woodward, A.; Le, T.; et al. Tumoricidal activity of tumor necrosis factor–related apoptosis–inducing ligand in vivo. Nat. Med. 1999, 5, 157–163. [Google Scholar] [CrossRef]
- Komdeur, R.; Meijer, C.; Van Zweeden, M.; De Jong, S.; Wesseling, J.; Hoekstra, H.; Van Der Graaf, W. Doxorubicin potentiates TRAIL cytotoxicity and apoptosis and can overcome TRAIL-resistance in rhabdomyosarcoma cells. Int. J. Oncol. 2004, 25, 677–684. [Google Scholar] [CrossRef]
- Shiraki, K.; Yamanaka, T.; Inoue, H.; Kawakita, T.; Enokimura, N.; Okano, H.; Sugimoto, K.; Murata, K.; Nakano, T. Expression of TNF-related apoptosis-inducing ligand in human hepatocellular carcinoma. Int. J. Oncol. 2005, 26, 1273–1281. [Google Scholar] [CrossRef]
- Rogalska, A.; Gajek, A.; Marczak, A. Epothilone B induces extrinsic pathway of apoptosis in human SKOV-3 ovarian cancer cells. Toxicol. Vitr. 2014, 28, 675–683. [Google Scholar] [CrossRef]
- Bérczi, A.; Ruthner, M.; Szüts, V.; Fritzer, M.; Schweinzer, E.; Goldenberg, H. Influence of conjugation of doxorubicin to transferrin on the iron uptake by K562 cells via receptor-mediated endocytosis. JBIC J. Biol. Inorg. Chem. 1993, 213, 427–436. [Google Scholar] [CrossRef]
- Szwed, M.; Matusiak, A.; Laroche-Clary, A.; Robert, J.; Marszalek, I.; Jozwiak, Z. Transferrin as a drug carrier: Cytotoxicity, cellular uptake and transport kinetics of doxorubicin transferrin conjugate in the human leukemia cells. Toxicol. Vitr. 2014, 28, 187–197. [Google Scholar] [CrossRef] [PubMed]
Gene | Strand | Sequence 5′to 3′ |
---|---|---|
Hypoxanthine-guanine Phosphoribosyltransferase (HPRT1) | Forward Reverse | TGACACTGGCAAAACAATGCA GGTCCTTTTCACCAGCAAGCT |
Hydroxymethylbilane synthase (HMBS) | Forward Reverse | CAAGGACCAGGACATCTTGGAT CCAGACTCCTCCAGTCAGGTACA |
H2AX | Forward Reverse | GGCCTCCAGTTCCCAGTG TCAGCGGTGAGGTACTCCAG |
TRAIL-L | Forward Reverse | ACCAACGAGCTGAAGCAGAT CAAGTGCAAGTTGCTCAGGA |
TNF-α | Forward Reverse | CCCAGGGACCTCTCTCTAATCA GCTACAGGCTTGTCACTCGG |
IL-4 | Forward Reverse | TTGAACAGCCTCACAGAGCAGA GTTGTGTTCTTGGAGGCAGCA |
IL-6 | Forward Reverse | TCTCCACAAGCGCCTTCG CTCAGGGCTGAGATGCCG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jedrzejczyk, M.; Wisniewska, K.; Kania, K.D.; Marczak, A.; Szwed, M. Transferrin-Bound Doxorubicin Enhances Apoptosis and DNA Damage through the Generation of Pro-Inflammatory Responses in Human Leukemia Cells. Int. J. Mol. Sci. 2020, 21, 9390. https://doi.org/10.3390/ijms21249390
Jedrzejczyk M, Wisniewska K, Kania KD, Marczak A, Szwed M. Transferrin-Bound Doxorubicin Enhances Apoptosis and DNA Damage through the Generation of Pro-Inflammatory Responses in Human Leukemia Cells. International Journal of Molecular Sciences. 2020; 21(24):9390. https://doi.org/10.3390/ijms21249390
Chicago/Turabian StyleJedrzejczyk, Monika, Katarzyna Wisniewska, Katarzyna Dominika Kania, Agnieszka Marczak, and Marzena Szwed. 2020. "Transferrin-Bound Doxorubicin Enhances Apoptosis and DNA Damage through the Generation of Pro-Inflammatory Responses in Human Leukemia Cells" International Journal of Molecular Sciences 21, no. 24: 9390. https://doi.org/10.3390/ijms21249390
APA StyleJedrzejczyk, M., Wisniewska, K., Kania, K. D., Marczak, A., & Szwed, M. (2020). Transferrin-Bound Doxorubicin Enhances Apoptosis and DNA Damage through the Generation of Pro-Inflammatory Responses in Human Leukemia Cells. International Journal of Molecular Sciences, 21(24), 9390. https://doi.org/10.3390/ijms21249390