The Inhibitory Role of Rab11b in Osteoclastogenesis through Triggering Lysosome-Induced Degradation of c-Fms and RANK Surface Receptors
Abstract
:1. Introduction
2. Results
2.1. Rab11b Is Up-Regulated at a Late Stage of Osteoclast Differentiation
2.2. Rab11b Silencing Markedly Enhances Osteoclastogenesis
2.3. Rab11b Overexpression Significantly Abolishes Osteoclastogenesis
2.4. Rab11b Overexpression Triggers Ca2+-Dependent NFATc-1 Stabilization
2.5. Rab11b Modulates NFATc-1 Signaling Cascades in the RAW-D Cells and BMMs upon Stimulation with RANKL and M-CSF, Respectively
2.6. GFP-Rab11b Localized in Early and Late Endosomes, Golgi Complex, and Endoplasmic Reticulum Causes the Enlargement of Early and Late Endosomes in RAW-D Cells and Osteoclasts
2.7. Rab11b-Mediated Augmentation of Lysosomal Function Regulates Endogenous Turnovers of c-Fms and RANK in Osteoclasts
2.8. Rab11b Overexpression Promoted Lysosome-Mediated Degradation of c-Fms and RANK Receptors in Osteoclasts
3. Discussion
4. Materials and Methods
4.1. Antibodies and Reagents
4.2. Cell Culture
4.3. Quantitative Real-Time Polymerase Chain Reaction (RT-PCR) Analysis
4.4. Immunoblot Analysis
4.5. RNA Interference
4.6. TRAP Staining
4.7. Immunocytochemistry
4.8. Bone Resorption Assay
4.9. Retrovirus Construction and Expression of Mouse Rab11b in RAW-D Cells
4.10. CellTiter-Glo Viability Assay (CTG)
4.11. Nuclear/Cytoplasmic Fractionation
4.12. In Vitro Ubiquitination Assay
4.13. Surface Biotinylation Assay
4.14. Intracellular Ca2+ Measurement in Cell Populations
4.15. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
Abbreviations
BMMs | Bone marrow-derived macrophages |
MNC | Multinucleated cell |
RANKL | Nuclear factor κ-B ligand |
M-CSF | Macrophage colony-stimulating factor |
MEM | Minimum essential medium |
NF-κB | Nuclear factor kappa B |
MAPK | Mitogen-activated protein kinase |
JNK | Jun N-terminal kinase |
CTSK | Cathepsin K |
LAMP1 | Lysosomal associated membrane protein 1 |
PI3K/Akt | Phosphatidylinositol 3-kinase |
ERK | Extracellular signal-regulated kinase |
DAPI | 4′,6-diamidino-2-phenylindole |
SDS-PAGE | Sodium dodecyl sulphate-polyacrylamide gel electrophoresis |
References
- Boyle, W.J.; Simonet, W.S.; Lacey, D.L. Osteoclast differentiation and activation. Nature 2003, 423, 337–342. [Google Scholar] [CrossRef]
- Väänänen, H.K.; Zhao, H.; Mulari, M.; Halleen, J.M. The cell biology of osteoclast function. J. Cell Sci. 2000, 113 (Pt 3), 377–381. [Google Scholar] [PubMed]
- Kim, J.H.; Kim, N. Signaling Pathways in Osteoclast Differentiation. Chonnam Med. J. 2016, 52, 12–17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ballanti, P.; Minisola, S.; Pacitti, M.T.; Scarnecchia, L.; Rosso, R.; Mazzuoli, G.F.; Bonucci, E. Tartrate-resistant acid phosphate activity as osteoclastic marker: Sensitivity of cytochemical assessment and serum assay in comparison with standardized osteoclast histomorphometry. Osteoporos. Int. 1997, 7, 39–43. [Google Scholar] [CrossRef] [PubMed]
- Everts, V.; Korper, W.; Hoeben, K.A.; Jansen, I.D.; Bromme, D.; Cleutjens, K.B.; Heeneman, S.; Peters, C.; Reinheckel, T.; Saftig, P.; et al. Osteoclastic Bone Degradation and the Role of Different Cysteine Proteinases and Matrix Metalloproteinases: Differences Between Calvaria and Long Bone. J. Bone Miner. Res. 2006, 21, 1399–1408. [Google Scholar] [CrossRef] [PubMed]
- Feng, X.; Teitelbaum, S.L. Osteoclasts: New Insights. Bone Res. 2013, 1, 11–26. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, G.; Marlin, M.C. Rab Family of GTPases. Methods Mol. Biol. 2015, 1298, 1–15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stenmark, H. Rab GTPases as coordinators of vesicle traffic. Nat. Rev. Mol. Cell Biol. 2009, 10, 513–525. [Google Scholar] [CrossRef] [PubMed]
- Cherfils, J.; Zeghouf, M. Regulation of Small GTPases by GEFs, GAPs, and GDIs. Physiol. Rev. 2013, 93, 269–309. [Google Scholar] [CrossRef] [Green Version]
- Kotting, C.; Gerwert, K. The dynamics of the catalytic site in small GTPases, variations on a common motif. FEBS Lett. 2013, 587, 2025–2027. [Google Scholar] [CrossRef] [Green Version]
- Wandinger-Ness, A.; Zerial, M. Rab Proteins and the Compartmentalization of the Endosomal System. Cold Spring Harb. Perspect. Biol. 2014, 6, a022616. [Google Scholar] [CrossRef] [PubMed]
- Wu, X.; Bradley, M.J.; Cai, Y.; Kummel, D.; De La Cruz, E.M.; Barr, F.A.; Reinisch, K.M. Insights regarding guanine nucleotide exchange from the structure of a DENN-domain protein complexed with its Rab GTPase substrate. Proc. Natl. Acad. Sci. USA 2011, 108, 18672–18677. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bhartur, S.G.; Calhoun, B.C.; Woodrum, J.; Kurkjian, J.; Iyer, S.; Lai, F.; Goldenring, J.R. Genomic Structure of Murine Rab11 Family Members. Biochem. Biophys. Res. Commun. 2000, 269, 611–617. [Google Scholar] [CrossRef] [PubMed]
- Lapierre, L.A.; Dorn, M.C.; Zimmerman, C.F.; Navarre, J.; Burnette, J.O.; Goldenring, J.R. Rab11b resides in a vesicular compartment distinct from Rab11a in parietal cells and other epithelial cells. Exp. Cell Res. 2003, 290, 322–331. [Google Scholar] [CrossRef] [PubMed]
- Krishnan, M.; Lapierre, L.A.; Knowles, B.C.; Goldenring, J.R. Rab25 regulates integrin expression in polarized colonic epithelial cells. Mol. Biol. Cell 2013, 24, 818–831. [Google Scholar] [CrossRef]
- Yamaguchi, Y.; Sakai, E.; Okamoto, K.; Kajiya, H.; Okabe, K.; Naito, M.; Kadowaki, T.; Tsukuba, T. Rab44, a novel large Rab GTPase, negatively regulates osteoclast differentiation by modulating intracellular calcium levels followed by NFATc1 activation. Cell. Mol. Life Sci. 2018, 75, 33–48. [Google Scholar] [CrossRef]
- Shimada-Sugawara, M.; Sakai, E.; Okamoto, K.; Fukuda, M.; Izumi, T.; Yoshida, N.; Tsukuba, T. Rab27A Regulates Transport of Cell Surface Receptors Modulating Multinucleation and Lysosome-Related Organelles in Osteoclasts. Sci. Rep. 2015, 5, 9620. [Google Scholar] [CrossRef] [Green Version]
- Okusha, Y.; Tran, M.T.; Itagaki, M.; Sogawa, C.; Eguchi, T.; Okui, T.; Kadowaki, T.; Sakai, E.; Tsukuba, T.; Okamoto, K. Rab11A Functions as a Negative Regulator of Osteoclastogenesis through Dictating Lysosome-Induced Proteolysis of c-fms and RANK Surface Receptors. Cells 2020, 9, 2384. [Google Scholar] [CrossRef]
- Huang, H.; Chang, E.J.; Ryu, J.; Lee, Z.H.; Lee, Y.; Kim, H.H. Induction of c-Fos and NFATc1 during RANKL-stimulated osteoclast differentiation is mediated by the p38 signaling pathway. Biochem. Biophys. Res. Commun. 2006, 351, 99–105. [Google Scholar] [CrossRef]
- Kim, K.; Kim, J.H.; Lee, J.; Jin, H.M.; Lee, S.H.; Fisher, D.E.; Kook, H.; Kim, K.K.; Choi, Y.; Kim, N. Nuclear Factor of Activated T Cells c1 Induces Osteoclast-associated Receptor Gene Expression during Tumor Necrosis Factor-related Activation-induced Cytokine-mediated Osteoclastogenesis. J. Biol. Chem. 2005, 280, 35209–35216. [Google Scholar] [CrossRef] [Green Version]
- Matsumoto, M.; Kogawa, M.; Wada, S.; Takayanagi, H.; Tsujimoto, M.; Katayama, S.; Hisatake, K.; Nogi, Y. Essential Role of p38 Mitogen-activated Protein Kinase in Cathepsin K Gene Expression during Osteoclastogenesis through Association of NFATc1 and PU.1. J. Biol. Chem. 2004, 279, 45969–45979. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Takayanagi, H.; Kim, S.; Koga, T.; Nishina, H.; Isshiki, M.; Yoshida, H.; Saiura, A.; Isobe, M.; Yokochi, T.; Inoue, J.; et al. Induction and Activation of the Transcription Factor NFATc1 (NFAT2) Integrate RANKL Signaling in Terminal Differentiation of Osteoclasts. Dev. Cell 2002, 3, 889–901. [Google Scholar] [CrossRef] [Green Version]
- Hogan, P.G.; Chen, L.; Nardone, J.; Rao, A. Transcriptional regulation by calcium, calcineurin, and NFAT. Genes Dev. 2003, 17, 2205–2232. [Google Scholar] [CrossRef] [Green Version]
- Chen, S.; Pan, M. NFAT Signaling and Bone Homeostasis. J. Hematol. Thromboembolic Dis. 2013, 1. [Google Scholar] [CrossRef] [Green Version]
- Morgan, A.J.; Jacob, R. Ionomycin enhances Ca2+ influx by stimulating store-regulated cation entry and not by a direct action at the plasma membrane. Biochem. J. 1994, 300 (Pt 3), 665–672. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schlierf, B.; Fey, G.H.; Hauber, J.; Hocke, G.M.; Rosorius, O. Rab11b Is Essential for Recycling of Transferrin to the Plasma Membrane. Exp. Cell Res. 2000, 259, 257–265. [Google Scholar] [CrossRef] [PubMed]
- Al-Bari, A.; Shinohara, M.; Nagai, Y.; Takayanagi, H. Inhibitory effect of chloroquine on bone resorption reveals the key role of lysosomes in osteoclast differentiation and function. Inflamm. Regen. 2012, 32, 222–231. [Google Scholar] [CrossRef] [Green Version]
- Erkhembaatar, M.; Gu, D.R.; Lee, S.H.; Yang, Y.-M.; Park, S.; Muallem, S.; Shin, D.M.; Kim, M.S. Lysosomal Ca(2+) Signaling is Essential for Osteoclastogenesis and Bone Remodeling. J. Bone Miner. Res. 2017, 32, 385–396. [Google Scholar] [CrossRef]
- Lacombe, J.; Karsenty, G.; Ferron, M. Regulation of lysosome biogenesis and functions in osteoclasts. Cell Cycle 2013, 12, 2744–2752. [Google Scholar] [CrossRef] [Green Version]
- Dikic, I. Proteasomal and Autophagic Degradation Systems. Annu. Rev. Biochem. 2017, 86, 193–224. [Google Scholar] [CrossRef]
- Lecker, S.H.; Goldberg, A.L.; Mitch, W.E. Protein Degradation by the Ubiquitin-Proteasome Pathway in Normal and Disease States. J. Am. Soc. Nephrol. 2006, 17, 1807–1819. [Google Scholar] [CrossRef] [PubMed]
- Luzio, J.P.; Pryor, P.R.; Bright, N.A. Lysosomes: Fusion and function. Nat. Rev. Mol. Cell Biol. 2007, 8, 622–632. [Google Scholar] [CrossRef] [PubMed]
- Naslavsky, N.; Caplan, S. The enigmatic endosome-sorting the ins and outs of endocytic trafficking. J. Cell Sci. 2018, 131, jcs216499. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Van Der Goot, F.G.; Gruenberg, J. Intra-endosomal membrane traffic. Trends Cell Biol. 2006, 16, 514–521. [Google Scholar] [CrossRef]
- Song, I.; Kim, J.H.; Kim, K.; Jin, H.M.; Youn, B.U.; Kim, N. Regulatory mechanism of NFATc1 in RANKL-induced osteoclast activation. FEBS Lett. 2009, 583, 2435–2440. [Google Scholar] [CrossRef] [Green Version]
- Sundaram, K.; Nishimura, R.; Senn, J.; Youssef, R.F.; London, S.D.; Reddy, S.V. RANK ligand signaling modulates the matrix metalloproteinase-9 gene expression during osteoclast differentiation. Exp. Cell Res. 2007, 313, 168–178. [Google Scholar] [CrossRef]
- Zulkefli, K.L.; Houghton, F.J.; Gosavi, P.; Gleeson, P.A. A role for Rab11 in the homeostasis of the endosome-lysosomal pathway. Exp. Cell Res. 2019, 380, 55–68. [Google Scholar] [CrossRef]
- Copp, D.H.; Cheney, B. Calcitonin—A Hormone from the Parathyroid which Lowers the Calcium-level of the Blood. Nature 1962, 193, 381–382. [Google Scholar] [CrossRef]
- Foster, G.V.; Baghdiantz, A.; Kumar, M.A.; Slack, E.; Soliman, H.A.; MacIntyre, I. Thyroid origin of Calcitonin. Nature 1964, 202, 1303–1305. [Google Scholar] [CrossRef]
- Alam, A.S.; Bax, C.M.; Shankar, V.S.; Bax, B.E.; Bevis, P.J.; Huang, C.L.; Moonga, B.S.; Pazianas, M.; Zaidi, M.; Baumrucker, C.R.; et al. Further studies on the mode of action of calcitonin on isolated rat osteoclasts: Pharmacological evidence for a second site mediating intracellular Ca2+ mobilization and cell retraction. J. Endocrinol. 1993, 136, 7–15. [Google Scholar] [CrossRef]
- Chambers, T.J.; Moore, A. The Sensitivity of Isolated Osteoclasts to Morphological Transformation by Calcitonin. J. Clin. Endocrinol. Metab. 1983, 57, 819–824. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, H.; Nakamura, I.; Takahashi, N.; Ikuhara, T.; Matsuzaki, K.; Isogai, Y.; Hori, M.; Suda, T. Calcitonin-induced changes in the cytoskeleton are mediated by a signal pathway associated with protein kinase A in osteoclasts. Endocrinology 1996, 137, 4685–4690. [Google Scholar] [CrossRef]
- Granholm, S.; Lundberg, P.; Lerner, U.H. Expression of the calcitonin receptor, calcitonin receptor-like receptor, and receptor activity modifying proteins during osteoclast differentiation. J. Cell. Biochem. 2008, 104, 920–933. [Google Scholar] [CrossRef]
- Lerner, U.H. Deletions of genes encoding calcitonin/alpha-CGRP, amylin and calcitonin receptor have given new and unexpected insights into the function of calcitonin receptors and calcitonin receptor-like receptors in bone. J. Musculoskelet. Neuronal Interact. 2006, 6, 87–95. [Google Scholar] [PubMed]
- Arai, F.; Miyamoto, T.; Ohneda, O.; Inada, T.; Sudo, T.; Brasel, K.; Miyata, T.; Anderson, D.M.; Suda, T. Commitment and Differentiation of Osteoclast Precursor Cells by the Sequential Expression of C-Fms and Receptor Activator of Nuclear Factor κb (Rank) Receptors. J. Exp. Med. 1999, 190, 1741–1754. [Google Scholar] [CrossRef] [PubMed]
- Choi, Y.; Faccio, R.; Teitelbaum, S.L.; Takayanagi, H. Osteoclast Biology: Regulation of Formation and Function. In Osteoimmunology; Academic Press: Cambridge, MA, USA, 2016; pp. 41–70. [Google Scholar] [CrossRef]
- Feng, X. RANKing Intracellular Signaling in Osteoclasts. IUBMB Life 2005, 57, 389–395. [Google Scholar] [CrossRef]
- Miyamoto, T.; Suda, T. Differentiation and function of osteoclasts. Keio J. Med. 2003, 52, 1–7. [Google Scholar] [CrossRef] [Green Version]
- Hienz, S.A.; Paliwal, S.; Ivanovski, S. Mechanisms of Bone Resorption in Periodontitis. J. Immunol. Res. 2015, 2015, 615486. [Google Scholar] [CrossRef] [Green Version]
- Karmakar, S.; Kay, J.; Gravallese, E.M. Bone Damage in Rheumatoid Arthritis: Mechanistic Insights and Approaches to Prevention. Rheum. Dis. Clin. N. Am. 2010, 36, 385–404. [Google Scholar] [CrossRef] [Green Version]
- Rachner, T.D.; Khosla, S.; Hofbauer, L.C. Osteoporosis: Now and the future. Lancet 2011, 377, 1276–1287. [Google Scholar] [CrossRef] [Green Version]
- Sabharwal, R.; Gupta, S.; Sepolia, S.; Panigrahi, R.; Mohanty, S.; Subudhi, S.K.; Kumar, M. An Insight in to Paget’s Disease of Bone. Niger. J. Surg. 2014, 20, 9–15. [Google Scholar] [CrossRef] [PubMed]
- Zupan, J.; Komadina, R.; Marc, J. The relationship between osteoclastogenic and anti-osteoclastogenic pro-inflammatory cytokines differs in human osteoporotic and osteoarthritic bone tissues. J. Biomed. Sci. 2012, 19, 28. [Google Scholar] [CrossRef]
- Sakai, E.; Shimada-Sugawara, M.; Nishishita, K.; Fukuma, Y.; Naito, M.; Okamoto, K.; Nakayama, K.; Tsukuba, T. Suppression of RANKL-dependent heme oxygenase-1 is required for high mobility group box 1 release and osteoclastogenesis. J. Cell. Biochem. 2012, 113, 486–498. [Google Scholar] [CrossRef] [PubMed]
- Nakanishi, H.; Tominaga, K.; Amano, T.; Hirotsu, I.; Inoue, T.; Yamamoto, K. Age-Related Changes in Activities and Localizations of Cathepsins D, E, B, and L in the Rat Brain Tissues. Exp. Neurol. 1994, 126, 119–128. [Google Scholar] [CrossRef] [PubMed]
- Kukita, T.; Wada, N.; Kukita, A.; Kakimoto, T.; Sandra, F.; Toh, K.; Nagata, K.; Iijima, T.; Horiuchi, M.; Matsusaki, H.; et al. RANKL-induced DC-STAMP Is Essential for Osteoclastogenesis. J. Exp. Med. 2004, 200, 941–946. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Watanabe, T.; Kukita, T.; Kukita, A.; Wada, N.; Toh, K.; Nagata, K.; Nomiyama, H.; Iijima, T. Direct stimulation of osteoclastogenesis by MIP-1alpha: Evidence obtained from studies using RAW264 cell clone highly responsive to RANKL. J. Endocrinol. 2004, 180, 193–201. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Primer (Name) | Forward Sequence (5′→3′) | Reverse Sequence (5′→3′) |
---|---|---|
Rab11a | ACGTCATCTCAGGGCAGTTC | TTGGCTTGTTCTCAGTGGTG |
Rab11b | AGAAGCTAAAAGCCCCTTGC | CAACTGGCCAGCGCGGAAAG |
NFATc-1 | TCATCCTGTCCAACACCAAA | TCACCCTGGTGTTCTTCCTC |
c-Fms | TTGGACTGGCTAGGGACATC | GGTTCAGACCAAGCGAGAAG |
RANK | CTTGGACACCTGGAATGAAGAAG | AGGGCCTTGCCTGCATC-3 |
GAPDH | ACCACAGTCCATGCCATCAC | TCCACCACCCTGTTGCTGTA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tran, M.T.; Okusha, Y.; Feng, Y.; Morimatsu, M.; Wei, P.; Sogawa, C.; Eguchi, T.; Kadowaki, T.; Sakai, E.; Okamura, H.; et al. The Inhibitory Role of Rab11b in Osteoclastogenesis through Triggering Lysosome-Induced Degradation of c-Fms and RANK Surface Receptors. Int. J. Mol. Sci. 2020, 21, 9352. https://doi.org/10.3390/ijms21249352
Tran MT, Okusha Y, Feng Y, Morimatsu M, Wei P, Sogawa C, Eguchi T, Kadowaki T, Sakai E, Okamura H, et al. The Inhibitory Role of Rab11b in Osteoclastogenesis through Triggering Lysosome-Induced Degradation of c-Fms and RANK Surface Receptors. International Journal of Molecular Sciences. 2020; 21(24):9352. https://doi.org/10.3390/ijms21249352
Chicago/Turabian StyleTran, Manh Tien, Yuka Okusha, Yunxia Feng, Masatoshi Morimatsu, Penggong Wei, Chiharu Sogawa, Takanori Eguchi, Tomoko Kadowaki, Eiko Sakai, Hirohiko Okamura, and et al. 2020. "The Inhibitory Role of Rab11b in Osteoclastogenesis through Triggering Lysosome-Induced Degradation of c-Fms and RANK Surface Receptors" International Journal of Molecular Sciences 21, no. 24: 9352. https://doi.org/10.3390/ijms21249352
APA StyleTran, M. T., Okusha, Y., Feng, Y., Morimatsu, M., Wei, P., Sogawa, C., Eguchi, T., Kadowaki, T., Sakai, E., Okamura, H., Naruse, K., Tsukuba, T., & Okamoto, K. (2020). The Inhibitory Role of Rab11b in Osteoclastogenesis through Triggering Lysosome-Induced Degradation of c-Fms and RANK Surface Receptors. International Journal of Molecular Sciences, 21(24), 9352. https://doi.org/10.3390/ijms21249352