PKM2 Determines Myofiber Hypertrophy In Vitro and Increases in Response to Resistance Exercise in Human Skeletal Muscle
Abstract
:1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Male Human Biopsy Study
4.2. Muscle Biopsies
4.3. Western Blotting
4.4. Immunohistochemistry of Human Skeletal Muscle
4.5. Rat Skeletal Muscle Histochemistry
4.6. Cell Culture
4.7. RNA Isolation
4.8. Real-Time Quantitative PCR
4.9. siRNA-Mediated Knockdown of Pkm, Pkm1 and Pkm2
4.10. Myotube Size Assay
4.11. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Janssen, I.; Heymsfield, S.B.; Ross, R. Low Relative Skeletal Muscle Mass (Sarcopenia) in Older Persons Is Associated with Functional Impairment and Physical Disability. J. Am. Geriatr. Soc. 2002, 50, 889–896. [Google Scholar] [CrossRef] [Green Version]
- Wolfe, R.R. The underappreciated role of muscle in health and disease. Am. J. Clin. Nutr. 2006, 84, 475–482. [Google Scholar] [CrossRef]
- Schoenfeld, B.J. The Mechanisms of Muscle Hypertrophy and Their Application to Resistance Training. J. Strength Cond. Res. 2010, 24, 2857–2872. [Google Scholar] [CrossRef] [Green Version]
- Wackerhage, H.; Schoenfeld, B.J.; Hamilton, D.L.; Lehti, M.; Hulmi, J.J. Stimuli and sensors that initiate skeletal muscle hypertrophy following resistance exercise. J. Appl. Physiol. 2019, 126, 30–43. [Google Scholar] [CrossRef]
- Kathage, B.; Gehlert, S.; Ulbricht, A.; Lüdecke, L.; Tapia, V.E.; Orfanos, Z.; Wenzel, D.; Bloch, W.; Volkmer, R.; Fleischmann, B.K.; et al. The cochaperone BAG3 coordinates protein synthesis and autophagy under mechanical strain through spatial regulation of mTORC1. BBA Mol. Cell Res. 2017, 1864, 62–75. [Google Scholar] [CrossRef] [PubMed]
- Goodman, C.A. Role of mTORC1 in mechanically induced increases in translation and skeletal muscle mass. J. Appl. Physiol. 2019, 127, 581–590. [Google Scholar] [CrossRef] [PubMed]
- Schiaffino, S.; Reggiani, C. Fiber Types in Mammalian Skeletal Muscles. Physiol. Rev. 2011, 91, 1447–1531. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- van Wessel, T.; de Haan, A.; van der Laarse, W.J.; Jaspers, R.T. The muscle fiber type–fiber size paradox: Hypertrophy or oxidative metabolism? Eur. J. Appl. Physiol. 2010, 110, 665–694. [Google Scholar] [CrossRef] [Green Version]
- Andersen, J.L.; Aagaard, P. Myosin heavy chain IIX overshoot in human skeletal muscle. Muscle Nerve 2000, 23, 1095–1104. [Google Scholar] [CrossRef]
- Kim, P.L.; Staron, R.S.; Phillips, S.M. Fasted-state skeletal muscle protein synthesis after resistance exercise is altered with training. J. Physiol. 2005, 568, 283–290. [Google Scholar] [CrossRef] [Green Version]
- Saxton, R.A.; Sabatini, D.M. mTOR Signaling in Growth, Metabolism, and Disease. Cell 2017, 168, 960–976. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hanahan, D.; Weinberg, R.A. Hallmarks of Cancer: The Next Generation. Cell 2011, 144, 646–674. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Warburg, O.; Wind, F.; Negelein, E. THE METABOLISM OF TUMORS IN THE BODY. J. Gen. Physiol. 1927, 8, 519–530. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- House, S.W.; Warburg, O.; Burk, D.; Schade, A.L. On Respiratory Impairment in Cancer Cells on JSTOR. Science 1956, 124, 267–272. [Google Scholar]
- DeBerardinis, R.J.; Chandel, N.S. Fundamentals of cancer metabolism. Sci. Adv. 2016, 2, e1600200. [Google Scholar] [CrossRef] [Green Version]
- Gaude, E.; Frezza, C. Tissue-specific and convergent metabolic transformation of cancer correlates with metastatic potential and patient survival. Nat. Commun. 2016, 7, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Bai, X.; Wang, X.; Zhuang, H. Long-lasting FDG uptake in the muscles after strenuous exercise. Clin. Nucl. Med. 2015, 40, 975–976. [Google Scholar] [CrossRef]
- Fathinul, F.; Lau, W.F.E. Avid 18F-FDG uptake of pectoralis major muscle: An equivocal sequela of strenuous physical exercise. Biomed. Imaging Interv. J. 2009, 5, e7. [Google Scholar] [CrossRef] [Green Version]
- Semsarian, C.; Sutrave, P.; Richmond, D.R.; Graham, R.M.; Biochemical, P.S. Insulin-like growth factor (IGF-I) induces myotube hypertrophy associated with an increase in anaerobic glycolysis in a clonal skeletal-muscle cell model. Biochem. J. 1999, 339, 443–451. [Google Scholar] [CrossRef]
- Amin, S.; Yang, P.; Li, Z. Pyruvate kinase M2: A multifarious enzyme in non-canonical localization to promote cancer progression. Biochim. Biophys. Acta Rev. Cancer 2019, 1871, 331–341. [Google Scholar] [CrossRef]
- Dayton, T.L.; Gocheva, V.; Miller, K.M.; Bhutkar, A.; Lewis, C.A.; Bronson, R.T.; Vander Heiden, M.G.; Jacks, T. Isoform-specific deletion of PKM2 constrains tumor initiation in a mouse model of soft tissue sarcoma. Cancer Metab. 2018, 6, 1–9. [Google Scholar] [CrossRef] [PubMed]
- David, C.J.; Chen, M.; Assanah, M.; Canoll, P.; Manley, J.L. HnRNP proteins controlled by c-Myc deregulate pyruvate kinase mRNA splicing in cancer. Nature 2010, 463, 364–368. [Google Scholar] [CrossRef] [PubMed]
- Hsu, M.-C.; Hung, W.-C. Pyruvate kinase M2 fuels multiple aspects of cancer cells: From cellular metabolism, transcriptional regulation to extracellular signaling. Mol. Cancer 2018, 17, 1–9. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vander Heiden, M.G.; Lunt, S.Y.; Dayton, T.L.; Fiske, B.P.; Israelsen, W.J.; Mattaini, K.R.; Vokes, N.I.; Stephanopoulos, G.; Cantley, L.C.; Metallo, C.M.; et al. Metabolic Pathway Alterations that Support Cell Proliferation. Cold Spring Harb. Symp. Quant. Biol. 2011, 76, 325–334. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Z.; Deng, X.; Liu, Y.; Liu, Y.; Sun, L.; Chen, F. PKM2, function and expression and regulation. Cell Biosci. 2019, 9, 52. [Google Scholar] [CrossRef] [Green Version]
- Shaw, R.J.; Cantley, L.C. Decoding key nodes in the metabolism of cancer cells: Sugar & spice and all things nice. F1000 Biol. Rep. 2012, 4, 2. [Google Scholar]
- Dayton, T.L.; Jacks, T.; Vander Heiden, M.G. PKM2, cancer metabolism, and the road ahead. EMBO Rep. 2016, 17, 1721–1730. [Google Scholar] [CrossRef] [Green Version]
- Yang, W.; Lu, Z. Nuclear PKM2 regulates the Warburg effect. Cell Cycle 2013, 12, 3154–3158. [Google Scholar] [CrossRef] [Green Version]
- Pan, Y.; Wang, W.; Huang, S.; Ni, W.; Wei, Z.; Cao, Y.; Yu, S.; Jia, Q.; Wu, Y.; Chai, C.; et al. Beta-elemene inhibits breast cancer metastasis through blocking pyruvate kinase M2 dimerization and nuclear translocation. J. Cell. Mol. Med. 2019, 23, 6846–6858. [Google Scholar] [CrossRef]
- Blum, J.; Gheller, B.; Yi, J.; Thalacker-Mercer, A. Glycolytic and Mitochondrial Metabolism Are Essential for Muscle Progenitor Cell Proliferation and Impacted by Pyruvate Kinase M2 (P08-135-19). Curr. Dev. Nutr. 2019, 3. [Google Scholar] [CrossRef]
- Guguen-Guillouzo, C.; Szajnert, M.-F.; Marie, J.; Delain, D.; Schapira, F. Differentiation in vivo and in vitro of pyruvate kinase isozymes in rat muscle. Biochimie 1977, 59, 65–71. [Google Scholar] [CrossRef]
- Yang, Y.-L.; Xiang, R.-L.; Yang, C.; Liu, X.-J.; Shen, W.-J.; Zuo, J.; Chang, Y.-S.; Fang, F.-D. Gene Expression Profile of Human Skeletal Muscle and Adipose Tissue of Chinese Han Patients with Type 2 Diabetes Mellitus. Biomed. Environ. Sci. 2009, 22, 359–368. [Google Scholar] [CrossRef]
- Baar, K.; Esser, K. Phosphorylation of p70S6k correlates with increased skeletal muscle mass following resistance exercise. Am. J. Physiol. 1999, 276, C120–C127. [Google Scholar] [CrossRef] [PubMed]
- Giordani, L.; He, G.J.; Negroni, E.; Sakai, H.; Law, J.Y.C.; Siu, M.M.; Wan, R.; Corneau, A.; Tajbakhsh, S.; Cheung, T.H.; et al. High-Dimensional Single-Cell Cartography Reveals Novel Skeletal Muscle-Resident Cell Populations. Mol. Cell 2019, 74, 609–621.e6. [Google Scholar] [CrossRef] [PubMed]
- Stefanetti, R.J.; Zacharewicz, E.; Gatta Della, P.; Garnham, A.; Russell, A.P.; Lamon, S. Ageing has no effect on the regulation of the ubiquitin proteasome-related genes and proteins following resistance exercise. Front. Physiol. 2014, 5, 30. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Park, Y.S.; Kim, D.J.; Koo, H.; Jang, S.H.; You, Y.-M.; Cho, J.H.; Yang, S.-J.; Yu, E.S.; Jung, Y.; Lee, D.C.; et al. AKT-induced PKM2 phosphorylation signals for IGF-1-stimulated cancer cell growth. Oncotarget 2016, 7, 48155–48167. [Google Scholar] [CrossRef]
- Salani, B.; Ravera, S.; Amaro, A.; Salis, A.; Passalacqua, M.; Millo, E.; Damonte, G.; Marini, C.; Pfeffer, U.; Sambuceti, G.; et al. IGF1 regulates PKM2 function through Akt phosphorylation. Cell Cycle 2015, 14, 1559–1567. [Google Scholar] [CrossRef] [Green Version]
- Chi, M.M.; Hintz, C.S.; Coyle, E.F.; Martin, W.H., 3rd; Ivy, J.L.; Nemeth, P.M.; Holloszy, J.O.; Lowry, O.H. Effects of detraining on enzymes of energy metabolism in individual human muscle fibers. AJP Cell Physiol. 1983, 244, C276–C287. [Google Scholar] [CrossRef]
- Noguchi, T.; Inoue, H.; Tanaka, T. The M1- and M2-type isozymes of rat pyruvate kinase are produced from the same gene by alternative RNA splicing. J. Biol. Chem. 1986, 261, 13807–13812. [Google Scholar]
- Pillon, N.J.; Gabriel, B.M.; Dollet, L.; Smith, J.A.B.; Sardón Puig, L.; Botella, J.; Bishop, D.J.; Krook, A.; Zierath, J.R. Transcriptomic profiling of skeletal muscle adaptations to exercise and inactivity. Nat. Commun. 2020, 11, 1–15. [Google Scholar] [CrossRef] [Green Version]
- Potts, G.K.; McNally, R.M.; Blanco, R.; You, J.-S.; Hebert, A.S.; Westphall, M.S.; Coon, J.J.; Hornberger, T.A. A map of the phosphoproteomic alterations that occur after a bout of maximal-intensity contractions. J. Physiol. 2017, 595, 5209–5226. [Google Scholar] [PubMed]
- Fazelzadeh, P.; Hangelbroek, R.W.J.; Tieland, M.; de Groot, L.C.P.G.M.; Verdijk, L.B.; van Loon, L.J.C.; Smilde, A.K.; Alves, R.D.A.M.; Vervoort, J.; Müller, M.; et al. The Muscle Metabolome Differs between Healthy and Frail Older Adults. J. Proteome Res. 2016, 15, 499–509. [Google Scholar] [PubMed] [Green Version]
- Gao, Z.; Cooper, T.A. Reexpression of pyruvate kinase M2 in type 1 myofibers correlates with altered glucose metabolism in myotonic dystrophy. Proc. Natl. Acad. Sci. USA 2013, 110, 13570–13575. [Google Scholar] [PubMed] [Green Version]
- Newsholme, P.; Cruzat, V.F.; Keane, K.N.; Carlessi, R.; de Bittencourt, P.I.H. Molecular mechanisms of ROS production and oxidative stress in diabetes. Biochem. J. 2016, 473, 4527–4550. [Google Scholar] [PubMed]
- Powers, S.K.; Smuder, A.J.; Judge, A.R. Oxidative stress and disuse muscle atrophy: Cause or consequence? Curr. Opin. Clin. Nutr. Metab. Care 2012, 15, 240–245. [Google Scholar]
- Nishimura, A.; Sugita, M.; Kato, K.; Fukuda, A.; Sudo, A.; Uchida, A. Hypoxia increases muscle hypertrophy induced by resistance training. Int. J. Sports Physiol. Perform. 2010, 5, 497–508. [Google Scholar]
- Deldicque, L.; Francaux, M. Acute vs chronic hypoxia: What are the consequences for skeletal muscle mass? Cell. Mol. Exerc. Physiol. 2013, 2, 1–23.e5. [Google Scholar]
- Kawada, S.; Ishii, N. Changes in skeletal muscle size, fibre-type composition and capillary supply after chronic venous occlusion in rats. Acta Physiol. (Oxf.) 2008, 192, 541–549. [Google Scholar]
- Dayton, T.L.; Gocheva, V.; Miller, K.M.; Israelsen, W.J.; Bhutkar, A.; Clish, C.B.; Davidson, S.M.; Luengo, A.; Bronson, R.T.; Jacks, T.; et al. Germline loss of PKM2 promotes metabolic distress and hepatocellular carcinoma. Genes Dev. 2016, 30, 1020–1033. [Google Scholar]
- Vander Heiden, M.G.; Christofk, H.R.; Schuman, E.; Subtelny, A.O.; Sharfi, H.; Harlow, E.E.; Xian, J.; Cantley, L.C. Identification of small molecule inhibitors of pyruvate kinase M2. Biochem. Pharm. 2010, 79, 1118–1124. [Google Scholar]
- Gehlert, S.; Suhr, F.; Gutsche, K.; Willkomm, L.; Kern, J.; Jacko, D.; Knicker, A.; Schiffer, T.; Wackerhage, H.; Bloch, W. High force development augments skeletal muscle signalling in resistance exercise modes equalized for time under tension. Pflugers Arch. Eur. J. Physiol. 2014, 467, 1343–1356. [Google Scholar] [CrossRef] [PubMed]
- Gallagher, D.; Heymsfield, S.B. Comments on Point:Counterpoint: IGF is/is not the major physiological regulator of muscle mass. J. Appl. Physiol. 2010, 108, 1825–1831. [Google Scholar]
- Bodine, S.C. mTOR Signaling and the Molecular Adaptation to Resistance Exercise. Med. Sci. Sports Exerc. 2006, 38, 1950–1957. [Google Scholar] [PubMed]
- Chin, E.R.; Olson, E.N.; Richardson, J.A.; Yang, Q.; Humphries, C.; Shelton, J.M.; Wu, H.; Zhu, W.; Bassel-Duby, R.; Williams, R.S. A calcineurin-dependent transcriptional pathway controls skeletal muscle fiber type. Genes Dev. 1998, 12, 2499–2509. [Google Scholar] [CrossRef] [Green Version]
- Shanely, R.A.; Zwetsloot, K.A.; Childs, T.E.; Lees, S.J.; Tsika, R.W.; Booth, F.W. IGF-I activates the mouse type IIb myosin heavy chain gene. Am. J. Physiol. Cell Physiol. 2009, 297, C1019–C1027. [Google Scholar] [CrossRef] [Green Version]
- Koopman, R.; Ly, C.H.; Ryall, J.G. A metabolic link to skeletal muscle wasting and regeneration. Front. Physiol. 2014, 5, 32. [Google Scholar] [CrossRef]
- Fu, X.; Zhu, M.-J.; Dodson, M.V.; Du, M. AMP-activated protein kinase stimulates Warburg-like glycolysis and activation of satellite cells during muscle regeneration. J. Biol. Chem. 2015, 290, 26445–26456. [Google Scholar] [CrossRef] [Green Version]
- Ryall, J.G. Metabolic reprogramming as a novel regulator of skeletal muscle development and regeneration. FEBS J. 2013, 280, 4004–4013. [Google Scholar] [CrossRef]
- Forsberg, A.M.; Nilsson, E.; Werneman, J.; Bergström, J.; Hultman, E. Muscle composition in relation to age and sex. Clin. Sci. 1991, 81, 249–256. [Google Scholar] [CrossRef] [Green Version]
- Figueiredo, V.C.; Caldow, M.K.; Massie, V.; Markworth, J.F.; Cameron-Smith, D.; Blazevich, A.J. Ribosome biogenesis adaptation in resistance training-induced human skeletal muscle hypertrophy. AJP Endocrinol. Metab. 2015, 309, E72–E83. [Google Scholar] [CrossRef]
- Lunt, S.Y.; Muralidhar, V.; Hosios, A.M.; Israelsen, W.J.; Gui, D.Y.; Newhouse, L.; Ogrodzinski, M.; Hecht, V.; Xu, K.; Acevedo, P.N.M.; et al. Pyruvate kinase isoform expression alters nucleotide synthesis to impact cell proliferation. Mol. Cell 2015, 57, 95–107. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jacko, D.; Bersiner, K.; Schulz, O.; Przyklenk, A.; Spahiu, F.; Höhfeld, J.; Bloch, W.; Gehlert, S. Coordinated alpha-crystallin B phosphorylation and desmin expression indicate adaptation and deadaptation to resistance exercise-induced loading in human skeletal muscle. AJP Cell Physiol. 2020, 319, C300–C312. [Google Scholar] [CrossRef] [PubMed]
- Evans, W.J.; Phinney, S.D.; Young, V.R. Suction applied to a muscle biopsy maximizes sample size. Med. Sci. Sports Exerc. 1982, 14, 101–102. [Google Scholar] [PubMed]
- Gehlert, S.; Weber, S.; Weidmann, B.; Gutsche, K.; Platen, P.; Graf, C.; Kappes-Horn, K.; Bloch, W. Cycling exercise-induced myofiber transitions in skeletal muscle depend on basal fiber type distribution. Eur. J. Appl. Physiol. 2011, 112, 2393–2402. [Google Scholar] [CrossRef]
- Brooke, M.H.; Kaiser, K.K. Muscle fiber types: How many and what kind? Arch. Neurol. 1970, 23, 369–379. [Google Scholar] [CrossRef]




| Gene | Forward | Reverse |
|---|---|---|
| 18 S rRNA | GTAACCCGTTGAACCCCATT | CCATCCAATCGGTAGTAGCG |
| Pkm1 | CATGCAGCACCTGATAGCTC | TGAGGTCTGTGGAGTGACTG |
| Pkm2 | CATGCAGCACCTGATTGCC | CCTCGAATAGCTCGCAAGTGG |
| Silenced Gene | Sense | Anti-Sense |
|---|---|---|
| Pkm | CCAUCAAGAAUGUCCGUGATT | UCACGGACAUUCUUGAUGGTC |
| Pkm1 | GGCAGAGGCUGCCAUCUACTT | TTCCGUCUCCGACGGUAGAUG |
| Pkm2 | GUGCGAGCCUCCAGUCACUTT | AGUGACUGGAGGCUCGCACTT |
| Control | AGUACUGCUUACGAUACGGTT | CCGUAUCGUAAGCAGUACUTT |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Verbrugge, S.A.J.; Gehlert, S.; Stadhouders, L.E.M.; Jacko, D.; Aussieker, T.; M. J. de Wit, G.; Vogel, I.S.P.; Offringa, C.; Schönfelder, M.; Jaspers, R.T.; et al. PKM2 Determines Myofiber Hypertrophy In Vitro and Increases in Response to Resistance Exercise in Human Skeletal Muscle. Int. J. Mol. Sci. 2020, 21, 7062. https://doi.org/10.3390/ijms21197062
Verbrugge SAJ, Gehlert S, Stadhouders LEM, Jacko D, Aussieker T, M. J. de Wit G, Vogel ISP, Offringa C, Schönfelder M, Jaspers RT, et al. PKM2 Determines Myofiber Hypertrophy In Vitro and Increases in Response to Resistance Exercise in Human Skeletal Muscle. International Journal of Molecular Sciences. 2020; 21(19):7062. https://doi.org/10.3390/ijms21197062
Chicago/Turabian StyleVerbrugge, Sander A. J., Sebastian Gehlert, Lian E. M. Stadhouders, Daniel Jacko, Thorben Aussieker, Gerard M. J. de Wit, Ilse S. P. Vogel, Carla Offringa, Martin Schönfelder, Richard T. Jaspers, and et al. 2020. "PKM2 Determines Myofiber Hypertrophy In Vitro and Increases in Response to Resistance Exercise in Human Skeletal Muscle" International Journal of Molecular Sciences 21, no. 19: 7062. https://doi.org/10.3390/ijms21197062
APA StyleVerbrugge, S. A. J., Gehlert, S., Stadhouders, L. E. M., Jacko, D., Aussieker, T., M. J. de Wit, G., Vogel, I. S. P., Offringa, C., Schönfelder, M., Jaspers, R. T., & Wackerhage, H. (2020). PKM2 Determines Myofiber Hypertrophy In Vitro and Increases in Response to Resistance Exercise in Human Skeletal Muscle. International Journal of Molecular Sciences, 21(19), 7062. https://doi.org/10.3390/ijms21197062

