Role of Norepinephrine in IL-1β-Induced Chondrocyte Dedifferentiation under Physioxia
Abstract
:1. Introduction
2. Results
2.1. Chondrocyte Dedifferentiation under Physioxia
2.2. AR and IL-1βR Expression Profile of Human Articular Chondrocytes
2.3. NE-Induced Intracellular Signaling in Human Articular Chondrocytes
2.4. Effects of NE and IL-1β on Chondrocyte Morphology and Viability during Dedifferentiation
2.5. NE- and IL-1β-Mediated Effects on Gene Expression
2.6. NE- and IL-1β-Mediated Effects on ECM Deposition
2.7. Changes in AR Expression during Dedifferentiation
3. Discussion
4. Materials and Methods
4.1. Human Articular Chondrocyte Isolation and Culture
4.2. Chondrocyte Stimulation
4.3. NE-Dependent Signal Transduction
4.4. Morphological Analyzes
4.5. Determination of Cell Viability
4.6. RNA Isolation and PCR
4.7. Cytological Staining
4.8. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
AR | Adrenergic receptor |
ACAN | Aggrecan |
ADAMTS4 | ADAM metallopeptidase with thrombospondin type 1 motif 4 |
ADAMTS5 | ADAM metallopeptidase with thrombospondin type 1 motif 5 |
cDNA | Complementary desoxyribonucleic acid |
COL1A1 | Collagen type I alpha 1 chain |
COL2A1 | Collagen type II alpha 1 chain |
COL10A1 | Collagen type X alpha 1 chain |
COMP | Cartilage oligomeric matrix protein |
DA | Dopamine |
DMEM | Dulbecco’s modified Eagle’s medium |
DMMB | 1,9-Dimethyl-methylene blue |
DPBS | Dulbeccos phosphate-buffered saline |
E | Epinephrine |
ECM | Extracellular matrix |
ERK | Extracellular signal-regulated kinases |
FCS | Fetal calf serum |
GAG | Glycosaminoglycan |
GAPDH | Glyceraldehyde-3-phosphate dehydrogenase |
HRP | Horseradish peroxidase |
IL-1β | Interleukin-1 beta |
IL1β-R | Interleukin-1 receptor type 1 |
L-DOPA | L-3,4-dihydroxyphenylalanin |
LDH | Lactate dehydrogenase |
MMP13 | Matrix metallopeptidase 13 |
mRNA | Messenger ribonucleic acid |
NE | Norepinephrine |
OA | Osteoarthritis |
PCR | Polymerase chain reaction |
PFA | Paraformaldehyde |
PKA | Proteinkinase A |
PVDF | Polyvinylidene difluoride |
RPII | RNA polymerase II subunit A |
RT-PCR | Reverse-transcriptase PCR |
sGAG | Sulphated glycosaminoglycans |
SDS-PAGE | Sodium dodecyl sulfate polyacrylamide gel electrophoresis |
SOX9 | SRY-box 9 |
TBST | Tris buffered saline with Tween20 |
TH | Tyrosine hydroxylase |
References
- Lozano, R.; Naghavi, M.; Foreman, K.; Lim, S.; Shibuya, K.; Aboyans, V.; Abraham, J.; Adair, T.; Aggarwal, R.; Ahn, S.Y.; et al. Global and regional mortality from 235 causes of death for 20 age groups in 1990 and 2010: A systematic analysis for the global burden of disease study 2010. Lancet 2012, 380, 2095–2128. [Google Scholar] [CrossRef]
- Allen, K.D.; Golightly, Y.M. State of the evidence. Curr. Opin. Rheumatol. 2015, 27, 276–283. [Google Scholar] [CrossRef] [PubMed]
- Haq, I.; Murphy, E.; Dacre, J. Osteoarthritis. Postgrad. Med. J. 2003, 79, 377–383. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Studer, D.; Millan, C.; Öztürk, E.; Maniura-Weber, K.; Zenobi-Wong, M. Molecular and biophysical mechanisms regulating hypertrophic differentiation in chondrocytes and mesenchymal stem cells. Eur. Cell Mater. 2012, 24, 118–135, discussion 135. [Google Scholar] [CrossRef] [PubMed]
- Darling, E.M.; Athanasiou, K.A. Rapid phenotypic changes in passaged articular chondrocyte subpopulations. J. Orthop. Res. 2005, 23, 425–432. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Y.; Chai, G.; Liu, W.; Zhou, G.D.; Cui, L.; Cao, Y.L. Microarray analysis of dedifferentiation related gene expression of human chondrocytes cultured in vitro. Zhonghua Zheng Xing Wai Ke Za Zhi 2007, 23, 331–334. [Google Scholar] [PubMed]
- Elima, K.; Vuorio, E. Expression of mrnas for collagens and other matrix components in dedifferentiating and redifferentiating human chondrocytes in culture. FEBS Lett. 1989, 258, 195–198. [Google Scholar] [CrossRef]
- Zaucke, F.; Dinser, R.; Maurer, P.; Paulsson, M. Cartilage oligomeric matrix protein (comp) and collagen ix are sensitive markers for the differentiation state of articular primary chondrocytes. Biochem. J. 2001, 358, 17–24. [Google Scholar] [CrossRef] [PubMed]
- Rosenzweig, D.H.; Ou, S.J.; Quinn, T.M. P38 mitogen-activated protein kinase promotes dedifferentiation of primary articular chondrocytes in monolayer culture. J. Cell. Mol. Med. 2013, 17, 508–517. [Google Scholar] [CrossRef] [PubMed]
- Schulze-Tanzil, G. Activation and dedifferentiation of chondrocytes: Implications in cartilage injury and repair. Ann. Anat. 2009, 191, 325–338. [Google Scholar] [CrossRef] [PubMed]
- Daheshia, M.; Yao, J.Q. The interleukin 1beta pathway in the pathogenesis of osteoarthritis. J. Rheumatol. 2008, 35, 2306–2312. [Google Scholar] [CrossRef] [PubMed]
- Jenei-Lanzl, Z.; Meurer, A.; Zaucke, F. Interleukin-1β signaling in osteoarthritis—Chondrocytes in focus. Cell Signal. 2018, 53, 212–223. [Google Scholar] [CrossRef] [PubMed]
- Panina, S.B.; Krolevets, I.V.; Milyutina, N.P.; Sagakyants, A.B.; Kornienko, I.V.; Ananyan, A.A.; Zabrodin, M.A.; Plotnikov, A.A.; Vnukov, V.V. Circulating levels of proinflammatory mediators as potential biomarkers of post-traumatic knee osteoarthritis development. J. Orthop. Traumatol. 2017, 18, 349–357. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- McNulty, A.L.; Rothfusz, N.E.; Leddy, H.A.; Guilak, F. Synovial fluid concentrations and relative potency of interleukin-1 alpha and beta in cartilage and meniscus degradation. J. Orthop. Res. 2013, 31, 1039–1045. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, M.; Yoo, S.J.; Kang, S.W.; Kwon, J.; Choi, I.; Lee, C.H. Tnfα and il-1β in the synovial fluid facilitate mucosal-associated invariant t (mait) cell migration. Cytokine 2017, 99, 91–98. [Google Scholar] [CrossRef] [PubMed]
- Grässel, S.; Muschter, D. Peripheral nerve fibers and their neurotransmitters in osteoarthritis pathology. Int. J. Mol. Sci. 2017, 18, 931. [Google Scholar] [CrossRef] [PubMed]
- Mach, D.B.; Rogers, S.D.; Sabino, M.C.; Luger, N.M.; Schwei, M.J.; Pomonis, J.D.; Keyser, C.P.; Clohisy, D.R.; Adams, D.J.; O’Leary, P.; et al. Origins of skeletal pain: Sensory and sympathetic innervation of the mouse femur. Neuroscience 2002, 113, 155–166. [Google Scholar] [CrossRef]
- Jenei-Lanzl, Z.; Grässel, S.; Pongratz, G.; Kees, F.; Miosge, N.; Angele, P.; Straub, R.H. Norepinephrine inhibition of mesenchymal stem cell and chondrogenic progenitor cell chondrogenesis and acceleration of chondrogenic hypertrophy. Arthritis Rheumatol. 2014, 66, 2472–2481. [Google Scholar] [CrossRef] [PubMed]
- Lorenz, J.; Schäfer, N.; Bauer, R.; Jenei-Lanzl, Z.; Springorum, R.H.; Grässel, S. Norepinephrine modulates osteoarthritic chondrocyte metabolism and inflammatory responses. Osteoarthr. Cartil. 2016, 24, 325–334. [Google Scholar] [CrossRef] [PubMed]
- Molinoff, P.B. Alpha- and beta-adrenergic receptor subtypes properties, distribution and regulation. Drugs 1984, 28 (Suppl. 2), 1–15. [Google Scholar] [CrossRef]
- Grässel, S.; Straub, R.H.; Jenei-Lanzl, Z. The sensory and sympathetic nervous system in cartilage physiology and pathophysiology. In Cartilage; Grässel, S., Aszódi, A., Eds.; Springer Nature: Cham, Switzerland, 2017; Volume 2, pp. 191–227. [Google Scholar]
- Brighton, C.T.; Heppenstall, R.B. Oxygen tension in zones of the epiphyseal plate, the metaphysis and diaphysis. An in vitro and in vivo study in rats and rabbits. J. Bone Joint Surg. Am. 1971, 53, 719–728. [Google Scholar] [CrossRef] [PubMed]
- Mennan, C.; Garcia, J.; McCarthy, H.; Owen, S.; Perry, J.; Wright, K.; Banerjee, R.; Richardson, J.B.; Roberts, S. Human articular chondrocytes retain their phenotype in sustained hypoxia while normoxia promotes their immunomodulatory potential. Cartilage 2018. [Google Scholar] [CrossRef] [PubMed]
- Haudenschild, D.R.; Chen, J.; Steklov, N.; Lotz, M.K.; D’Lima, D.D. Characterization of the chondrocyte actin cytoskeleton in living three-dimensional culture: Response to anabolic and catabolic stimuli. Mol. Cell. Biomech. 2009, 6, 135–144. [Google Scholar] [PubMed]
- Goldring, M.B.; Otero, M. Inflammation in osteoarthritis. Curr. Opin. Rheumatol. 2011, 23, 471–478. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Loeser, R.F.; Goldring, S.R.; Scanzello, C.R.; Goldring, M.B. Osteoarthritis: A disease of the joint as an organ. Arthritis Rheumatol. 2012, 64, 1697–1707. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mobasheri, A.; Batt, M. An update on the pathophysiology of osteoarthritis. Ann. Phys. Rehabil. Med. 2016, 59, 333–339. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Diaz-Romero, J.; Gaillard, J.P.; Grogan, S.P.; Nesic, D.; Trub, T.; Mainil-Varlet, P. Immunophenotypic analysis of human articular chondrocytes: Changes in surface markers associated with cell expansion in monolayer culture. J. Cell Physiol. 2005, 202, 731–742. [Google Scholar] [CrossRef] [PubMed]
- Cheng, T.; Maddox, N.C.; Wong, A.W.; Rahnama, R.; Kuo, A.C. Comparison of gene expression patterns in articular cartilage and dedifferentiated articular chondrocytes. J. Orthop. Res. 2012, 30, 234–245. [Google Scholar] [CrossRef] [PubMed]
- Benya, P.D.; Padilla, S.R.; Nimni, M.E. Independent regulation of collagen types by chondrocytes during the loss of differentiated function in culture. Cell 1978, 15, 1313–1321. [Google Scholar] [CrossRef]
- Stokes, D.G.; Liu, G.; Dharmavaram, R.; Hawkins, D.; Piera-Velazquez, S.; Jimenez, S.A. Regulation of type-ii collagen gene expression during human chondrocyte de-differentiation and recovery of chondrocyte-specific phenotype in culture involves sry-type high-mobility-group box (sox) transcription factors. Biochem. J. 2001, 360, 461–470. [Google Scholar] [CrossRef] [PubMed]
- Lin, Z.; Fitzgerald, J.B.; Xu, J.; Willers, C.; Wood, D.; Grodzinsky, A.J.; Zheng, M.H. Gene expression profiles of human chondrocytes during passaged monolayer cultivation. J. Orthop. Res. 2008, 26, 1230–1237. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Duval, E.; Leclercq, S.; Elissalde, J.M.; Demoor, M.; Galéra, P.; Boumédiene, K. Hypoxia-inducible factor 1alpha inhibits the fibroblast-like markers type i and type iii collagen during hypoxia-induced chondrocyte redifferentiation: Hypoxia not only induces type ii collagen and aggrecan, but it also inhibits type i and type iii collagen in the hypoxia-inducible factor 1alpha-dependent redifferentiation of chondrocytes. Arthritis Rheumatol. 2009, 60, 3038–3048. [Google Scholar]
- Duan, L.; Ma, B.; Liang, Y.; Chen, J.; Zhu, W.; Li, M.; Wang, D. Cytokine networking of chondrocyte dedifferentiation in vitro and its implications for cell-based cartilage therapy. Am. J. Transl. Res. 2015, 7, 194–208. [Google Scholar] [PubMed]
- Thompson, C.L.; Plant, J.C.; Wann, A.K.; Bishop, C.L.; Novak, P.; Mitchison, H.M.; Beales, P.L.; Chapple, J.P.; Knight, M.M. Chondrocyte expansion is associated with loss of primary cilia and disrupted hedgehog signalling. Eur. Cell Mater. 2017, 34, 128–141. [Google Scholar] [CrossRef] [PubMed]
- Zheng, M.H.; King, E.; Kirilak, Y.; Huang, L.; Papadimitriou, J.M.; Wood, D.J.; Xu, J. Molecular characterisation of chondrocytes in autologous chondrocyte implantation. Int. J. Mol. Med. 2004, 13, 623–628. [Google Scholar] [CrossRef] [PubMed]
- Eckhart, A.D.; Zhu, Z.; Arendshorst, W.J.; Faber, J.E. Oxygen modulates alpha 1b-adrenergic receptor gene expression by arterial but not venous vascular smooth muscle. Am. J. Physiol. 1996, 271, H1599–H1608. [Google Scholar] [CrossRef] [PubMed]
- Mitchell, J.; Lai, L.P.; Peralta, F.; Xu, Y.; Sugamori, K. B2-adrenergic receptors inhibit the expression of collagen type ii in growth plate chondrocytes by stimulating the ap-1 factor jun-b. Am. J. Physiol. Endocrinol. Metab. 2011, 300, E633–E639. [Google Scholar] [CrossRef] [PubMed]
- Aigner, T.; Reichenberger, E.; Bertling, W.; Kirsch, T.; Stoss, H.; von der Mark, K. Type x collagen expression in osteoarthritic and rheumatoid articular cartilage. Virchows Archiv. B Cell Pathol. Incl. Mol. Pathol. 1993, 63, 205–211. [Google Scholar] [CrossRef]
- Verzijl, N.; DeGroot, J.; Bank, R.A.; Bayliss, M.T.; Bijlsma, J.W.; Lafeber, F.P.; Maroudas, A.; TeKoppele, J.M. Age-related accumulation of the advanced glycation endproduct pentosidine in human articular cartilage aggrecan: The use of pentosidine levels as a quantitative measure of protein turnover. Matrix Biol. 2001, 20, 409–417. [Google Scholar] [CrossRef]
- Jiao, K.; Zeng, G.; Niu, L.N.; Yang, H.X.; Ren, G.T.; Xu, X.Y.; Li, F.F.; Tay, F.R.; Wang, M.Q. Activation of alpha2a-adrenergic signal transduction in chondrocytes promotes degenerative remodelling of temporomandibular joint. Sci. Rep. 2016, 6, 30085. [Google Scholar] [CrossRef] [PubMed]
- Heck, D.A.; Bylund, D.B. Mechanism of down-regulation of alpha-2 adrenergic receptor subtypes. J. Pharmacol. Exp. Ther. 1997, 282, 1219–1227. [Google Scholar] [PubMed]
- Wikberg, J.E.; Akers, M.; Caron, M.G.; Hagen, P.O. Norepinephrine-induced down regulation of alpha 1 adrenergic receptors in cultured rabbit aorta smooth muscle cells. Life Sci. 1983, 33, 1409–1417. [Google Scholar] [CrossRef]
- Hadcock, J.R.; Malbon, C.C. Down-regulation of beta-adrenergic receptors: Agonist-induced reduction in receptor mrna levels. Proc. Natl. Acad. Sci. USA 1988, 85, 5021–5025. [Google Scholar] [CrossRef] [PubMed]
- Bucher, M.; Kees, F.; Taeger, K.; Kurtz, A. Cytokines down-regulate alpha1-adrenergic receptor expression during endotoxemia. Crit. Care Med. 2003, 31, 566–571. [Google Scholar] [CrossRef] [PubMed]
- Koto, H.; Mak, J.C.; Haddad, E.B.; Xu, W.B.; Salmon, M.; Barnes, P.J.; Chung, K.F. Mechanisms of impaired beta-adrenoceptor-induced airway relaxation by interleukin-1beta in vivo in the rat. J. Clin. Investig. 1996, 98, 1780–1787. [Google Scholar] [CrossRef] [PubMed]
- McCollum, R.; Martel-Pelletier, J.; DiBattista, J.; Pelletier, J.P. Regulation of interleukin 1 receptors in human articular chondrocytes. J. Rheumatol. Suppl. 1991, 27, 85–88. [Google Scholar] [PubMed]
- Naldini, A.; Pucci, A.; Carraro, F. Hypoxia induces the expression and release of interleukin 1 receptor antagonist in mitogen-activated mononuclear cells. Cytokine 2001, 13, 334–341. [Google Scholar] [CrossRef] [PubMed]
- Van der Kraan, P.; Matta, C.; Mobasheri, A. Age-related alterations in signaling pathways in articular chondrocytes: Implications for the pathogenesis and progression of osteoarthritis—A mini-review. Gerontology 2017, 63, 29–35. [Google Scholar] [CrossRef] [PubMed]
- Rahmati, M.; Nalesso, G.; Mobasheri, A.; Mozafari, M. Aging and osteoarthritis: Central role of the extracellular matrix. Ageing Res. Rev. 2017, 40, 20–30. [Google Scholar] [CrossRef] [PubMed]
- Van Beuningen, H.M.; van der Kraan, P.M.; Arntz, O.J.; van den Berg, W.B. In vivo protection against interleukin-1-induced articular cartilage damage by transforming growth factor-beta 1: Age-related differences. Ann. Rheum. Dis. 1994, 53, 593–600. [Google Scholar] [CrossRef] [PubMed]
- Moslemi, S.; Demoor, M.; Boumediene, K.; Galera, P.; Maneix, L. Estrogens Involvement in the Physiopathology of Articular Cartilage, Challenges in Rheumatology. Available online: https://www.intechopen.com/books/challenges-in-rheumatology/estrogens-involvement-in-the-physiopathology-of-articular-cartilage (accessed on 9 March 2018).
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative pcr and the 2(-delta delta c(t)) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Foldager, C.B.; Munir, S.; Ulrik-Vinther, M.; Søballe, K.; Bünger, C.; Lind, M. Validation of suitable house keeping genes for hypoxia-cultured human chondrocytes. BMC Mol. Biol. 2009, 10, 94. [Google Scholar] [CrossRef] [PubMed]
- Spitznagel, L.; Nitsche, D.P.; Paulsson, M.; Maurer, P.; Zaucke, F. Characterization of a pseudoachondroplasia-associated mutation (his587-->arg) in the c-terminal, collagen-binding domain of cartilage oligomeric matrix protein (comp). Biochem. J. 2004, 377, 479–487. [Google Scholar] [CrossRef] [PubMed]
Patient Characteristics | Number/Mean Age ± SEM |
---|---|
Total (number/age) | 10/65.33 ± 11.77 |
Female (number/age) | 6/64.83 ± 12.06 |
Male (number/age) | 4/66.33 ± 11.09 |
Gene Name | NCBI Reference | Forward (5′–3′) | Reverse (5′–3′) |
---|---|---|---|
GAPDH | NM_001289745.2 | CTCCTGTTCGACAGTCAGCC | TTCCCGTTCTCAGCCTTGAC |
TH | NM_000360.3 | CAGGCAGAGGCCATCATGT | GTGGTCCAAGTCCAGGTCAG |
ADRA1A | NM_000680.3 | CCATGCTCCAGCCAAGAGTT | TCCTGTCCTAGACTTCCTCCC |
ADRA1B | NM_000679.3 | GTCCACCGTCATCTCCATCG | GAACAAGGAGCCAAGCGGTAG |
ADRA1D | NM_000678.3 | TGACTTTCCGCGATCTCCTG | TTACCTGCCACGGCCATAAG |
ADRA2A | NM_000681.3 | TGGTCATCGGAGTGTTCGTG | GCCCACTAGGAAGATGGCTC |
ADRA2B | NM_000682.6 | GACATTTCACCGGCAACACC | GGGACTGAGAACCAGGAAGC |
ADRA2C | NM_000683.3 | CGATGTGCTGTTTTGCACCT | GGATGTACCAGGTCTCGTCG |
ADRB1 | NM_000684.2 | TAGCAGGTGAACTCGAAGCC | ATCTTCCACTCCGGTCCTCT |
ADRB2 | NM_000024.5 | CAGAGCCTGCTGACCAAGAA | GCCTAACGTCTTGAGGGCTT |
ADRB3 | NM_000025.3 | GCCAATTCTGCCTTCAACCC | GCCAGAGGTTTTCCACAGGT |
IL1R1 | NM_000877.4 | AGGGATGACTACGTTGGGGA | CTCCAGCTCAAGCAGGACAA |
POLR2A | NM_000937.5 | GACACAGGACCACTCATGAAGT | GTGCGGCTGCTTCCATAAG |
COL1A1 | NM_000088.3 | ACGTCCTGGTGAAGTTGGTC | ACCAGGGAAGCCTCTCTCTC |
COL2A1 | NM_001844.4 | TTCAGCTATGGAGATGACAATC | AGAGTCCTAGAGTGACTGAG |
COL10A1 | XM_011535433.3 | CCCTCTTGTTAGTGCCAACC | AGATTCCAGTCCTTGGGTCA |
COMP | NM_000095.2 | AGGGAGATCGTGCAGACAA | AGCTGGAGCTGTCCTGGTAG |
SOX9 | NM_000346.4 | ACACACAGCTCACTCGACCTTG | AGGGAATTCTGGTTGCTCCTCT |
ACAN | NM_001135.3 | TCCCCTGCTATTTCATCGAC | CCAGCAGCACTACCTCCTTC |
ADAMTS 4 | NM_001320336.1 | AGGGAAGGGGACAAGGACTA | TATCACCACCACCCTGGATT |
ADAMTS 5 | NM_007038.4 | TACTTGGCCTCTCCCATGAC | TTTGGACCAGGGCTTAGATG |
MMP13 | NM_002427.4 | GACTGGTAATGGCATCAAGGGA | CACCGGCAAAAGCCACTTTA |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Speichert, S.; Molotkov, N.; El Bagdadi, K.; Meurer, A.; Zaucke, F.; Jenei-Lanzl, Z. Role of Norepinephrine in IL-1β-Induced Chondrocyte Dedifferentiation under Physioxia. Int. J. Mol. Sci. 2019, 20, 1212. https://doi.org/10.3390/ijms20051212
Speichert S, Molotkov N, El Bagdadi K, Meurer A, Zaucke F, Jenei-Lanzl Z. Role of Norepinephrine in IL-1β-Induced Chondrocyte Dedifferentiation under Physioxia. International Journal of Molecular Sciences. 2019; 20(5):1212. https://doi.org/10.3390/ijms20051212
Chicago/Turabian StyleSpeichert, Saskia, Natalie Molotkov, Karima El Bagdadi, Andrea Meurer, Frank Zaucke, and Zsuzsa Jenei-Lanzl. 2019. "Role of Norepinephrine in IL-1β-Induced Chondrocyte Dedifferentiation under Physioxia" International Journal of Molecular Sciences 20, no. 5: 1212. https://doi.org/10.3390/ijms20051212