HBD Inhibits the Development of Colitis-Associated Cancer in Mice via the IL-6R/STAT3 Signaling Pathway
Abstract
:1. Introduction
2. Results
2.1. Huangqi Baizhu Decoction Inhibited the Occurrence and Progression of Colitis-Associated Cancer
2.2. HBD Inhibits Tumor Proliferation in Colitis-Associated Cancer, and Downregulates the Expression of JAK2 and P-STAT3 in IL-6/STAT3 Pathway
2.3. HBD Attenuates the Expression of Inflammatory Factors
2.4. HBD Attenuates the IL-6/STAT3/Survivin/Cyclin D1 Signaling Pathway
2.5. Atractylenolide II and Astragaloside Inhibited HCT-116 Cell Proliferation
2.6. Atractylenolide II and Astragaloside Suppress STAT3 Activation by Inhibiting the Activity of the IL-6Rα/STAT3 Pathway
3. Discussion
4. Materials and Methods
4.1. HBD Preparation
4.2. Animal Experiment
4.3. Histopathological and Immunohistochemical Analyses
4.4. Cell Viability Assays
4.5. Cell Culture and Conditioned Culture
4.6. Western Blot Analysis
4.7. RNA Extraction and Quantitative Real Time PCR Analysis
4.8. Statistical Analyses
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
Abbreviations
CAC | Colitis-associated Cancer |
UC | Ulcerative colitis |
HBD | Huangqi Baizhu Decoction |
HBL | Huangqi Baizhu Low concentration Decoction |
HBH | Huangqi Baizhu High concentration Decoction |
SASP | Sulfasalazine enteric-coated tablets |
ATR II | Atractylenolide II |
AST | Astragaloside |
AOM | Azoxymethane |
DSS | Dextran Sulfate Sodium Salt Colitis Grade |
References
- Hu, R.; OuYang, Q.; Chen, X.; Chang, Y.; Bai, A.; Wang, R.; Zhang, H. Analysisi of the articles of inflammatory bowel disease in the literature of China in recent fifteen years. Chin. J. Gastroenterol. 2007, 12, 74–77. [Google Scholar]
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2019. CA Cancer J. Clin. 2019. [Google Scholar] [CrossRef] [PubMed]
- Kuipers, E.J.; Grady, W.M.; Lieberman, D.; Seufferlein, T.; Sung, J.J.; Boelens, P.G.; van de Velde, C.J.; Watanabe, T. Colorectal cancer. Nat. Rev. Dis. Primers 2015, 65, 15065. [Google Scholar] [CrossRef] [PubMed]
- Mantovani, A.; Allavena, P.; Sica, A.; Balkwill, F. Cancer-related inflammation. Nature 2008, 454, 436–444. [Google Scholar] [CrossRef] [PubMed]
- Munkholm, P. Review article: The incidence and prevalence of colorectal cancer in inflammatory bowel disease. Aliment. Pharmacol. Ther. 2003, 18, 1–5. [Google Scholar] [CrossRef] [PubMed]
- Siegel, R.L.; Miller, K.D.; Fedewa, S.A.; Ahnen, D.J.; Meester, R.G.; Barzi, A.; Jemal, A. Colorectal cancer statistics, 2017. CA Cancer J. Clin. 2017, 67, 177–193. [Google Scholar] [CrossRef] [PubMed]
- Jess, T.; Rungoe, C.; Peyrin-Biroulet, L. Risk of colorectal cancer in patients with ulcerative colitis: A meta-analysis of population-based cohort studies. Clin. Gastroenterol. Hepatol. 2012, 10, 639–645. [Google Scholar] [CrossRef] [PubMed]
- Mitsuyama, K.; MATSUMOTO, S.; Masuda, J.; Yamasaki, H.; Kuwaki, K.; Takedatsu, H.; Sata, M. Therapeutic strategies for targeting the IL-6/STAT3 cytokine signaling pathway in inflammatory bowel disease. Anticancer Res. 2007, 27, 3749. [Google Scholar] [PubMed]
- Zhou, W.; Cheng, X.; Zhang, Y. Effect of Liuwei Dihuang decoction, a traditional Chinese medicinal prescription, on the neuroendocrine immunomodulation network. Pharmacol. Ther. 2016, 162, 170–178. [Google Scholar] [CrossRef] [PubMed]
- Shao, W.; Xie, B.; Yao, L.; Yan, X. Research progress of colitis-related precancerosis of colonic carcinoma. J. Jiangxi Univ. TCM 2010, 22, 87–91. [Google Scholar]
- Shi, Z.; Chen, W.; Li, R.; Li, Q. Effects of Baizhu Huangqi Decoction and Its Effective-part Prescription on Mice Ulcerative Colitis. Tradit. Chin. Drug Res. Clin. Pharmacol. 2007, 18, 87–90. [Google Scholar]
- Zhen, H.; Hong, B.; Jun, W. Astragaloside IV protects against the pathological cardiac hypertrophy in mice. Biomed. Pharmacother. 2017, 97, 1468–1478. [Google Scholar]
- Pang, X.; Zhao, P.; Yang, F.; Liu, L.; Cao, B. Astragaloside combine with Cetuximab inhibits proliferation and regulates autophagy of human colon cancer cell RKO. J. Pract. Med. 2016, 32, 2992–2995. [Google Scholar]
- Gao, X.-L.; Wang, B.-Y.; Chen, Y.-L.; Zai, Y.-B.; Bai, M. Atractylenolide II significantly reduces proliferation of mouse colon cancer cells. World Chin. J. Digestol. 2013, 21, 2690. [Google Scholar] [CrossRef]
- Alzahrani, A.M.; Hanieh, H.; Ibrahim, H.I.M.; Mohafez, O.; Shehata, T.; Ismail, M.B.; Alfwuaires, M. Enhancing miR-132 expression by aryl hydrocarbon receptor attenuates tumorigenesis associated with chronic colitis. Int. Immunopharmacol. 2017, 52, 342–351. [Google Scholar] [CrossRef] [PubMed]
- Jump, R.L.; Levine, A.D. Mechanisms of natural tolerance in the intestine. Implications for inflammatory bowel disease. Inflamm. Bowel Dis. 2010, 10, 462–478. [Google Scholar] [CrossRef]
- Tian, Y.; Wang, K.; Wang, Z.; Li, N.; Ji, G. Chemopreventive effect of dietary glutamine on colitis-associated colon tumorigenesis in mice. Carcinogenesis 2013, 34, 1593–1600. [Google Scholar] [CrossRef] [PubMed]
- Missiaglia, E.; Jacobs, B.; D’ario, G.; Di Narzo, A.F.; Soneson, C.; Budinska, E.; Popovici, V.; Vecchione, L.; Gerster, S.; Yan, P.; et al. Distal and proximal colon cancers differ in terms of molecular, pathological, and clinical features. Ann Oncol. 2014, 25, 1995–2001. [Google Scholar] [CrossRef] [PubMed]
- Van Leeuwen, B.L.; Pahlman, L.; Gunnarsson, U.; Sjovall, A.; Martling, A. The effect of age and gender on outcome after treatment for colon carcinoma. A population-based study in the Uppsala and Stockholm region. Crit. Rev. Oncol. Hematol. 2008, 67, 229–236. [Google Scholar] [CrossRef] [PubMed]
- Zheng, Y.Y.; Viswanathan, B.; Kesarwani, P.; Mehrotra, S. Dietary agents in cancer prevention: An immunological perspective. Photochem. Photobiol. 2012, 88, 1083–1098. [Google Scholar] [CrossRef] [PubMed]
- Ke, F.; Yadav, P.K.; Ju, L.Z. Herbal medicine in the treatment of ulcerative colitis. Saudi J. Gastroenterol. 2012, 18, 3–10. [Google Scholar] [PubMed]
- Ng, S.C.; Lam, Y.T.; Tsoi, K.K.F.; Chan, F.K.L.; Sung, J.J.Y.; Wu, J.C.Y. Systematic review: The efficacy of herbal therapy in inflammatory bowel disease. Aliment. Pharmacol. Ther. 2013, 38, 854–863. [Google Scholar] [CrossRef] [PubMed]
- Law, P.C.; Auyeung, K.K.; Chan, L.Y.; Ko, J.K. Astragalus saponins downregulate vascular endothelial growth factor under cobalt chloride-stimulated hypoxia in colon cancer cells. BMC Complementary Altern. Med. 2012, 12, 160. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Mou, J.; Cui, L.; Wang, X.; Zhang, Z. Astragaloside IV inhibits cell proliferation of colorectal cancer cell lines through down-regulation of B7-H3. Biomed. Pharmacother. Biomed. Pharmacother. 2018, 102, 1037–1044. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Zhi, W.; Liu, F.; Zhao, J.; Yao, Q.; Niu, X. Paeoniflorin inhibits VSMCs proliferation and migration by arresting cell cycle and activating HO-1 through MAPKs and NF-kappaB pathway. Int. Immunopharmacol. 2018, 54, 103–111. [Google Scholar] [CrossRef] [PubMed]
- Li, N.; Xu, Z.; Zhang, H.; Zhao, Y. New Triterpene Prosaponin and Sapogenin with Unsaturated Lactone Skeleton From Gynostemma Pentaphfllum and the Antitumor Activities Assay. In Proceedings of the 2008 International Conference on Gin-Seng, Changchun, Jilin, China, 1–3 September 2008; pp. 216–221. [Google Scholar]
- Song, X.; Voronov, E.; Dvorkin, T.; Fima, E.; Cagnano, E.; Benharroch, D.; Shendler, Y.; Bjorkdahl, O.; Segal, S.; et al. Differential Effects of IL-1 and IL-1 on Tumorigenicity Patterns and Invasiveness. J. Immunol. 2003, 171, 6448–6456. [Google Scholar] [CrossRef] [PubMed]
- Onizawa, M.; Nagaishi, T.; Kanai, T.; Nagano, K.; Oshima, S.; Nemoto, Y.; Yoshioka, A.; Totsuka, T.; Okamoto, R.; Nakamura, T.; et al. Signaling pathway via TNF-alpha/NF-kappaB in intestinal epithelial cells may be directly involved in colitis-associated carcinogenesis. Am. J. Physiol. Gastrointest. Liver Physiol. 2009, 296, G850–G859. [Google Scholar] [CrossRef] [PubMed]
- Scholzen, T.; Gerdes, J. The Ki--67 protein: From the known and the unknown. J. Cell. Physiol. 2000, 182, 311–322. [Google Scholar] [CrossRef]
- Kishimoto. Interleukin-6: from basic science tomedicine-40 years in immunology. J. Annu Rev Immunol. 2005, 23, 1–21. [CrossRef] [PubMed]
- Chen, K.F.; Chen, H.L.; Liu, C.Y.; Tai, W.T.; Ichikawa, K.; Chen, P.J.; Cheng, A.L. Dovitinib sensitizes hepatocellular carcinoma cells to TRAIL and tigatuzumab, a novel anti-DR5 antibody, through SHP-1-dependent inhibition of STAT3. Biochem. Pharmacol. 2012, 83, 769–777. [Google Scholar] [CrossRef] [PubMed]
- Pandurangan, A.K.; Esa, N.M. Signal Transducer and Activator of Transcription 3—A Promising Target in Colitis-Associated Cancer. Asian Pac. J. Cancer Prev. 2014, 15, 551–560. [Google Scholar] [CrossRef] [PubMed]
- Dai, Y.; Jiao, H.; Teng, G.; Wang, W.; Zhang, R.; Wang, Y.; Hebbard, L.; George, J.; Qiao, L. Embelin reduces colitis-associated tumorigenesis through limiting IL-6/STAT3 signaling. Mol. Cancer Ther. 2014, 13, 1206–1216. [Google Scholar] [CrossRef] [PubMed]
- Parang, B.; Barrett, C.W.; Williams, C.S. AOM/DSS Model of Colitis-Associated Cancer. Methods Mol. Biol. 2016, 1422, 297–307. [Google Scholar]
- Rose, A.H.; Huang, Z.; Mafnas, C.; Hara, J.H.; Hoffmann, F.W.; Hashimoto, A.S.; Bertino, P.; Hoffmann, P.R. Calpain-2 Inhibitor Therapy Reduces Murine Colitis and Colitis-associated Cancer. Inflamm. Bowel Dis. 2015, 21, 2005–2015. [Google Scholar] [CrossRef] [PubMed]
Name | Source | |
---|---|---|
Huangqi | Inner Mongolia | Lot: YPA7E0003 |
Baizhu | Zhejiang | Lot: YPA7E004 |
AST | Solarbio | Cat. No.: SA8640 |
ATR II | Shanghai Yuanye Biological | Lot: PA0808RA13 |
AOM | Sigma | CAS:25843-45-2 |
DSS ECL substrate | MP Biomedicals Bio-Rad | Cat. No.: 160110 |
Antibody | Host | Clonality | Dilution | Source | Cat. No. |
---|---|---|---|---|---|
Ki-67 | Rabbit | Polyclone | 1:500 | Abcam, USA | Ab15580 |
Jak2 | Rabbit | Monoclonal | 1:500 | Cell Signaling, USA | D2E12 |
P-stat3 | Rabbit | Monoclonal | 1:400 | Cell Signaling, USA | D3A7 |
Antibody | Host | Clonality | Dilution | Source | Cat. No. |
---|---|---|---|---|---|
Survivin | Rabbit | Monoclonal | 1:500 | Abcam, USA | Ab182132 |
Survivin | Rabbit | Monoclonal | 1:300 | Abcam, USA | Ab134170 |
IL-6Rα | Mouse | Monoclonal | 1:500 | Santa Cruz, USA | Sc-373708 |
P-stat3 | Mouse | Monoclonal | 1:1000 | Santa Cruz, USA | Sc-81523 |
gp130 | Rabbit | Polyclone | 1:1000 | Abacm, USA | Ab202850 |
Stat3 | Mouse | Monoclonal | 1:1000 | Cell Signaling, USA | 124H6 |
GAPDH | Mouse | Monocloanl | 1:5000 | Abcam, USA | Ab125247 |
Cyclin D1 | Rabbit | Monoclonal | 1:10000 | Abcam, USA | Ab134175 |
Gene Name | Forward | Reverse |
---|---|---|
IL-6 | CAAGAGACTTCCATCCAGTTGCCT | TTTCTCATTTCCACGATTTCCCAG |
TNF-α | CAGGCGGTGCCTATGTCTC | CGATCACCCCGAAGTTCAGTAG |
IL-1β | ATGGCAACTGTTCCTGAACTCAACT | AGGACAGGTATAGATTCTTTCCTT |
GAPDH | CAAGGCTGTGGGCAAGGTCATCC | TTTCTCCAGGCGGCAGGTCAGAT |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Deng, S.; Wang, A.; Chen, X.; Du, Q.; Wu, Y.; Chen, G.; Guo, W.; Li, Y. HBD Inhibits the Development of Colitis-Associated Cancer in Mice via the IL-6R/STAT3 Signaling Pathway. Int. J. Mol. Sci. 2019, 20, 1069. https://doi.org/10.3390/ijms20051069
Deng S, Wang A, Chen X, Du Q, Wu Y, Chen G, Guo W, Li Y. HBD Inhibits the Development of Colitis-Associated Cancer in Mice via the IL-6R/STAT3 Signaling Pathway. International Journal of Molecular Sciences. 2019; 20(5):1069. https://doi.org/10.3390/ijms20051069
Chicago/Turabian StyleDeng, Song, Aiping Wang, Xi Chen, Qun Du, Yanli Wu, Gang Chen, Wenfeng Guo, and Yanwu Li. 2019. "HBD Inhibits the Development of Colitis-Associated Cancer in Mice via the IL-6R/STAT3 Signaling Pathway" International Journal of Molecular Sciences 20, no. 5: 1069. https://doi.org/10.3390/ijms20051069
APA StyleDeng, S., Wang, A., Chen, X., Du, Q., Wu, Y., Chen, G., Guo, W., & Li, Y. (2019). HBD Inhibits the Development of Colitis-Associated Cancer in Mice via the IL-6R/STAT3 Signaling Pathway. International Journal of Molecular Sciences, 20(5), 1069. https://doi.org/10.3390/ijms20051069