Next Article in Journal
Extracellular miRNAs as Biomarkers of Head and Neck Cancer Progression and Metastasis
Previous Article in Journal
Lysyl Oxidase-Like 2 Protects against Progressive and Aging Related Knee Joint Osteoarthritis in Mice
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Correction

Correction: Li, et al. Conserved miR396b-GRF Regulation Is Involved in Abiotic Stress Responses in Pitaya (Hylocereus polyrhizus). Int. J. Mol. Sci. 2019, 20, 2501

The Key Laboratory of Plant Resources Conservation and Germplasm Innovation in Mountainous Region (Ministry of Education), Institute of Agro-Bioengineering and College of Life Sciences, Guizhou University, Guiyang 550025, China
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2019, 20(19), 4795; https://doi.org/10.3390/ijms20194795
Submission received: 25 September 2019 / Accepted: 26 September 2019 / Published: 27 September 2019
(This article belongs to the Section Molecular Plant Sciences)
The authors wish to make the following corrections to this paper [1]: In Table A2, of the Appendix, in line 4 of page 14, for the primer of the hpo-miR396b stem-loop RT sequence “GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTTCAAGA” the bold part should be changed to “AAGTTC”.
The authors would like to apologize for any inconvenience caused to the readers by these changes. The changes do not affect the scientific results.

Conflicts of Interest

The authors declare no conflict of interest.

Reference

  1. Li, A.-L.; Wen, Z.; Yang, K.; Wen, X.-P. Conserved miR396b-GRF Regulation Is Involved in Abiotic Stress Responses in Pitaya (Hylocereus polyrhizus). Int. J. Mol. Sci. 2019, 20, 2501. [Google Scholar] [CrossRef] [PubMed]

Share and Cite

MDPI and ACS Style

Li, A.-L.; Wen, Z.; Yang, K.; Wen, X.-P. Correction: Li, et al. Conserved miR396b-GRF Regulation Is Involved in Abiotic Stress Responses in Pitaya (Hylocereus polyrhizus). Int. J. Mol. Sci. 2019, 20, 2501. Int. J. Mol. Sci. 2019, 20, 4795. https://doi.org/10.3390/ijms20194795

AMA Style

Li A-L, Wen Z, Yang K, Wen X-P. Correction: Li, et al. Conserved miR396b-GRF Regulation Is Involved in Abiotic Stress Responses in Pitaya (Hylocereus polyrhizus). Int. J. Mol. Sci. 2019, 20, 2501. International Journal of Molecular Sciences. 2019; 20(19):4795. https://doi.org/10.3390/ijms20194795

Chicago/Turabian Style

Li, A-Li, Zhuang Wen, Kun Yang, and Xiao-Peng Wen. 2019. "Correction: Li, et al. Conserved miR396b-GRF Regulation Is Involved in Abiotic Stress Responses in Pitaya (Hylocereus polyrhizus). Int. J. Mol. Sci. 2019, 20, 2501" International Journal of Molecular Sciences 20, no. 19: 4795. https://doi.org/10.3390/ijms20194795

APA Style

Li, A.-L., Wen, Z., Yang, K., & Wen, X.-P. (2019). Correction: Li, et al. Conserved miR396b-GRF Regulation Is Involved in Abiotic Stress Responses in Pitaya (Hylocereus polyrhizus). Int. J. Mol. Sci. 2019, 20, 2501. International Journal of Molecular Sciences, 20(19), 4795. https://doi.org/10.3390/ijms20194795

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop