Transfer of the Experimental Autoimmune Glaucoma Model from Rats to Mice—New Options to Study Glaucoma Disease
Abstract
:1. Introduction
2. Results
2.1. Intraocular Pressure in Normal Range
2.2. Loss of Retinal Ganglion Cells
2.3. No Alterations in Bipolar Cells
2.4. Photoreceptors Are Not Affected
2.5. Remodeling of Synapses
2.6. Activated Microglia in the Retina
2.7. Optic Nerve Degeneration
2.8. Glia Activation in the Optic Nerves
3. Discussion
3.1. Glaucomatous Damage in EAG Mice
3.2. Synaptic Alterations after Immunization
3.3. Reactive Gliosis in the Optic Nerves
4. Methods
4.1. Animals
4.2. Immunization
4.3. Measurement of Intraocular Pressure
4.4. Retina and Optic Nerve Histology
4.5. Immunohistology
4.6. Histological Examination
4.7. Histopathological Staining and Scoring
4.8. Quantitative Real-Time PCR
4.9. Statistics
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- European Glaucoma Society Terminology and Guidelines for Glaucoma, 4th Edition—Chapter 2: Classification and terminology. Br. J. Ophthalmol. 2017, 101, 73–127. [CrossRef] [PubMed]
- Wax, M.B.; Tezel, G.; Yang, J.; Peng, G.; Patil, R.V.; Agarwal, N.; Sappington, R.M.; Calkins, D.J. Induced autoimmunity to heat shock proteins elicits glaucomatous loss of retinal ganglion cell neurons via activated T-cell-derived fas-ligand. J. Neurosci 2008, 28, 12085–12096. [Google Scholar] [CrossRef] [PubMed]
- Laspas, P.; Gramlich, O.W.; Muller, H.D.; Cuny, C.S.; Gottschling, P.F.; Pfeiffer, N.; Dick, H.B.; Joachim, S.C.; Grus, F.H. Autoreactive antibodies and loss of retinal ganglion cells in rats induced by immunization with ocular antigens. Investig. Ophthalmol. Vis. Sci. 2011, 52, 8835–8848. [Google Scholar] [CrossRef]
- Noristani, R.; Kuehn, S.; Stute, G.; Reinehr, S.; Stellbogen, M.; Dick, H.B.; Joachim, S.C. Retinal and Optic Nerve Damage is Associated with Early Glial Responses in an Experimental Autoimmune Glaucoma Model. J. Mol. Neurosci. 2016, 58, 470–482. [Google Scholar] [CrossRef] [PubMed]
- Reinehr, S.; Reinhard, J.; Gandej, M.; Kuehn, S.; Noristani, R.; Faissner, A.; Dick, H.B.; Joachim, S.C. Simultaneous Complement Response via Lectin Pathway in Retina and Optic Nerve in an Experimental Autoimmune Glaucoma Model. Front. Cell. Neurosci. 2016, 10, 140. [Google Scholar] [CrossRef] [Green Version]
- Joachim, S.C.; Mondon, C.; Gramlich, O.W.; Grus, F.H.; Dick, H.B. Apoptotic retinal ganglion cell death in an autoimmune glaucoma model is accompanied by antibody depositions. J. Mol. Neurosci. 2014, 52, 216–224. [Google Scholar] [CrossRef] [PubMed]
- Joachim, S.C.; Gramlich, O.W.; Laspas, P.; Schmid, H.; Beck, S.; von Pein, H.D.; Dick, H.B.; Pfeiffer, N.; Grus, F.H. Retinal ganglion cell loss is accompanied by antibody depositions and increased levels of microglia after immunization with retinal antigens. PLoS ONE 2012, 7, e40616. [Google Scholar] [CrossRef] [PubMed]
- Reinehr, S.; Reinhard, J.; Gandej, M.; Gottschalk, I.; Stute, G.; Faissner, A.; Dick, H.B.; Joachim, S.C. S100B immunization triggers NFκB and complement activation in an autoimmune glaucoma model. Sci. Rep. 2018, 8, 9821. [Google Scholar] [CrossRef] [PubMed]
- Reinehr, S.; Reinhard, J.; Wiemann, S.; Stute, G.; Kuehn, S.; Woestmann, J.; Dick, H.B.; Faissner, A.; Joachim, S.C. Early remodelling of the extracellular matrix proteins tenascin-C and phosphacan in retina and optic nerve of an experimental autoimmune glaucoma model. J. Cell. Mol. Med. 2016, 20, 2122–2137. [Google Scholar] [CrossRef]
- Abbott, C.J.; Choe, T.E.; Lusardi, T.A.; Burgoyne, C.F.; Wang, L.; Fortune, B. Imaging axonal transport in the rat visual pathway. Biomed. Opt. Express 2013, 4, 364–386. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Reinehr, S.; Kuehn, S.; Casola, C.; Koch, D.; Stute, G.; Grotegut, P.; Dick, H.B.; Joachim, S.C. HSP27 immunization reinforces AII amacrine cell and synapse damage induced by S100 in an autoimmune glaucoma model. Cell Tissue Res. 2018, 371, 237–249. [Google Scholar] [CrossRef] [PubMed]
- Knafo, S.; Alonso-Nanclares, L.; Gonzalez-Soriano, J.; Merino-Serrais, P.; Fernaud-Espinosa, I.; Ferrer, I.; DeFelipe, J. Widespread changes in dendritic spines in a model of Alzheimer’s disease. Cereb. Cortex 2009, 19, 586–592. [Google Scholar] [CrossRef]
- Koffie, R.M.; Meyer-Luehmann, M.; Hashimoto, T.; Adams, K.W.; Mielke, M.L.; Garcia-Alloza, M.; Micheva, K.D.; Smith, S.J.; Kim, M.L.; Lee, V.M.; et al. Oligomeric amyloid beta associates with postsynaptic densities and correlates with excitatory synapse loss near senile plaques. Proc. Natl. Acad. Sci. USA 2009, 106, 4012–4017. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez-Perdigon, M.; Tordera, R.M.; Gil-Bea, F.J.; Gerenu, G.; Ramirez, M.J.; Solas, M. Down-regulation of glutamatergic terminals (VGLUT1) driven by Abeta in Alzheimer’s disease. Hippocampus 2016, 26, 1303–1312. [Google Scholar] [CrossRef] [PubMed]
- Antes, R.; Ezra-Elia, R.; Weinberger, D.; Solomon, A.; Ofri, R.; Michaelson, D.M. ApoE4 induces synaptic and ERG impairments in the retina of young targeted replacement apoE4 mice. PLoS ONE 2013, 8, e64949. [Google Scholar] [CrossRef] [PubMed]
- Tyagarajan, S.K.; Fritschy, J.M. Gephyrin: A master regulator of neuronal function? Nat. Rev. Neurosci. 2014, 15, 141–156. [Google Scholar] [CrossRef] [PubMed]
- Hales, C.M.; Rees, H.; Seyfried, N.T.; Dammer, E.B.; Duong, D.M.; Gearing, M.; Montine, T.J.; Troncoso, J.C.; Thambisetty, M.; Levey, A.I.; et al. Abnormal gephyrin immunoreactivity associated with Alzheimer disease pathologic changes. J. Neuropathol. Exp. Neurol. 2013, 72, 1009–1015. [Google Scholar] [CrossRef]
- Schmitt, B.; Knaus, P.; Becker, C.M.; Betz, H. The Mr 93,000 polypeptide of the postsynaptic glycine receptor complex is a peripheral membrane protein. Biochemistry 1987, 26, 805–811. [Google Scholar] [CrossRef] [PubMed]
- Agarwal, S.; Tannenberg, R.K.; Dodd, P.R. Reduced expression of the inhibitory synapse scaffolding protein gephyrin in Alzheimer’s disease. J. Alzheimer’s Dis. 2008, 14, 313–321. [Google Scholar] [CrossRef]
- Butler, M.H.; Hayashi, A.; Ohkoshi, N.; Villmann, C.; Becker, C.M.; Feng, G.; De Camilli, P.; Solimena, M. Autoimmunity to gephyrin in Stiff-Man syndrome. Neuron 2000, 26, 307–312. [Google Scholar] [CrossRef]
- Reiss, J.; Lenz, U.; Aquaviva-Bourdain, C.; Joriot-Chekaf, S.; Mention-Mulliez, K.; Holder-Espinasse, M. A GPHN point mutation leading to molybdenum cofactor deficiency. Clin. Genet. 2011, 80, 598–599. [Google Scholar] [CrossRef] [PubMed]
- Rees, M.I.; Harvey, K.; Ward, H.; White, J.H.; Evans, L.; Duguid, I.C.; Hsu, C.C.; Coleman, S.L.; Miller, J.; Baer, K.; et al. Isoform heterogeneity of the human gephyrin gene (GPHN), binding domains to the glycine receptor, and mutation analysis in hyperekplexia. J. Biol. Chem. 2003, 278, 24688–24696. [Google Scholar] [CrossRef] [PubMed]
- Lionel, A.C.; Vaags, A.K.; Sato, D.; Gazzellone, M.J.; Mitchell, E.B.; Chen, H.Y.; Costain, G.; Walker, S.; Egger, G.; Thiruvahindrapuram, B.; et al. Rare exonic deletions implicate the synaptic organizer Gephyrin (GPHN) in risk for autism, schizophrenia and seizures. Hum. Mol. Genet. 2013, 22, 2055–2066. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Koulen, P.; Sassoe-Pognetto, M.; Grunert, U.; Wassle, H. Selective clustering of GABA(A) and glycine receptors in the mammalian retina. J. Neurosci. 1996, 16, 2127–2140. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wilhelmsson, U.; Bushong, E.A.; Price, D.L.; Smarr, B.L.; Phung, V.; Terada, M.; Ellisman, M.H.; Pekny, M. Redefining the concept of reactive astrocytes as cells that remain within their unique domains upon reaction to injury. Proc. Natl. Acad. Sci. USA 2006, 103, 17513–17518. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pekny, M.; Nilsson, M. Astrocyte activation and reactive gliosis. Glia 2005, 50, 427–434. [Google Scholar] [CrossRef]
- Bringmann, A.; Pannicke, T.; Grosche, J.; Francke, M.; Wiedemann, P.; Skatchkov, S.N.; Osborne, N.N.; Reichenbach, A. Muller cells in the healthy and diseased retina. Prog. Retin. Eye Res. 2006, 25, 397–424. [Google Scholar] [CrossRef] [PubMed]
- Ramirez, J.M.; Trivino, A.; Ramirez, A.I.; Salazar, J.J.; Garcia-Sanchez, J. Structural specializations of human retinal glial cells. Vis. Res. 1996, 36, 2029–2036. [Google Scholar] [CrossRef]
- Verardo, M.R.; Lewis, G.P.; Takeda, M.; Linberg, K.A.; Byun, J.; Luna, G.; Wilhelmsson, U.; Pekny, M.; Chen, D.F.; Fisher, S.K. Abnormal reactivity of muller cells after retinal detachment in mice deficient in GFAP and vimentin. Investig. Ophthalmol. Vis. Sci. 2008, 49, 3659–3665. [Google Scholar] [CrossRef]
- Wang, X.; Tay, S.S.; Ng, Y.K. An immunohistochemical study of neuronal and glial cell reactions in retinae of rats with experimental glaucoma. Exp. Brain Res. 2000, 132, 476–484. [Google Scholar] [CrossRef]
- Akiyama, H.; Nakazawa, T.; Shimura, M.; Tomita, H.; Tamai, M. Presence of mitogen-activated protein kinase in retinal Muller cells and its neuroprotective effect ischemia-reperfusion injury. Neuroreport 2002, 13, 2103–2107. [Google Scholar] [CrossRef] [PubMed]
- Goldman, D. Muller glial cell reprogramming and retina regeneration. Nat. Rev. Neurosci. 2014, 15, 431–442. [Google Scholar] [CrossRef]
- Block, M.L.; Zecca, L.; Hong, J.S. Microglia-mediated neurotoxicity: Uncovering the molecular mechanisms. Nat. Rev. Neurosci. 2007, 8, 57–69. [Google Scholar] [CrossRef] [PubMed]
- Gallego, B.I.; Salazar, J.J.; de Hoz, R.; Rojas, B.; Ramirez, A.I.; Salinas-Navarro, M.; Ortin-Martinez, A.; Valiente-Soriano, F.J.; Aviles-Trigueros, M.; Villegas-Perez, M.P.; et al. IOP induces upregulation of GFAP and MHC-II and microglia reactivity in mice retina contralateral to experimental glaucoma. J. Neuroinflamm. 2012, 9, 92. [Google Scholar] [CrossRef] [PubMed]
- Inman, D.M.; Horner, P.J. Reactive nonproliferative gliosis predominates in a chronic mouse model of glaucoma. Glia 2007, 55, 942–953. [Google Scholar] [CrossRef]
- Ramirez, A.I.; Salazar, J.J.; de Hoz, R.; Rojas, B.; Gallego, B.I.; Salinas-Navarro, M.; Alarcon-Martinez, L.; Ortin-Martinez, A.; Aviles-Trigueros, M.; Vidal-Sanz, M.; et al. Quantification of the effect of different levels of IOP in the astroglia of the rat retina ipsilateral and contralateral to experimental glaucoma. Investig. Ophthalmol. Vis. Sci. 2010, 51, 5690–5696. [Google Scholar] [CrossRef] [PubMed]
- Bolz, S.; Schuettauf, F.; Fries, J.E.; Thaler, S.; Reichenbach, A.; Pannicke, T. K+ currents fail to change in reactive retinal glial cells in a mouse model of glaucoma. Graefe’s Arch. Clin. Exp. Ophthalmol. 2008, 246, 1249–1254. [Google Scholar] [CrossRef]
- Soto, I.; Oglesby, E.; Buckingham, B.P.; Son, J.L.; Roberson, E.D.; Steele, M.R.; Inman, D.M.; Vetter, M.L.; Horner, P.J.; Marsh-Armstrong, N. Retinal ganglion cells downregulate gene expression and lose their axons within the optic nerve head in a mouse glaucoma model. J. Neurosci. 2008, 28, 548–561. [Google Scholar] [CrossRef]
- Cooper, M.L.; Collyer, J.W.; Calkins, D.J. Astrocyte remodeling without gliosis precedes optic nerve Axonopathy. Acta Neuropathol. Commun. 2018, 6, 38. [Google Scholar] [CrossRef] [PubMed]
- Schneider, M.; Fuchshofer, R. The role of astrocytes in optic nerve head fibrosis in glaucoma. Exp. Eye Res. 2016, 142, 49–55. [Google Scholar] [CrossRef]
- Hernandez, M.R.; Pena, J.D. The optic nerve head in glaucomatous optic neuropathy. Arch. Ophthalmol. 1997, 115, 389–395. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Cioffi, G.A.; Cull, G.; Dong, J.; Fortune, B. Immunohistologic evidence for retinal glial cell changes in human glaucoma. Investig. Ophthalmol. Vis. Sci. 2002, 43, 1088–1094. [Google Scholar]
- Seitz, R.; Ohlmann, A.; Tamm, E.R. The role of Muller glia and microglia in glaucoma. Cell Tissue Res. 2013, 353, 339–345. [Google Scholar] [CrossRef]
- Sun, D.; Qu, J.; Jakobs, T.C. Reversible reactivity by optic nerve astrocytes. Glia 2013, 61, 1218–1235. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Casanovas, A.; Salvany, S.; Lahoz, V.; Tarabal, O.; Piedrafita, L.; Sabater, R.; Hernandez, S.; Caldero, J.; Esquerda, J.E. Neuregulin 1-ErbB module in C-bouton synapses on somatic motor neurons: molecular compartmentation and response to peripheral nerve injury. Sci. Rep. 2017, 7, 40155. [Google Scholar] [CrossRef] [Green Version]
- Bucolo, C.; Campana, G.; Di Toro, R.; Cacciaguerra, S.; Spampinato, S. Sigma1 recognition sites in rabbit iris-ciliary body: topical sigma1-site agonists lower intraocular pressure. J. Pharmacol. Exp. Ther. 1999, 289, 1362–1369. [Google Scholar]
- Vecino, E.; Rodriguez, F.D.; Ruzafa, N.; Pereiro, X.; Sharma, S.C. Glia-neuron interactions in the mammalian retina. Prog. Retin. Eye Res. 2016, 51, 1–40. [Google Scholar] [CrossRef] [PubMed]
- Ransohoff, R.M.; Cardona, A.E. The myeloid cells of the central nervous system parenchyma. Nature 2010, 468, 253–262. [Google Scholar] [CrossRef]
- Nimmerjahn, A.; Kirchhoff, F.; Helmchen, F. Resting microglial cells are highly dynamic surveillants of brain parenchyma in vivo. Science 2005, 308, 1314–1318. [Google Scholar] [CrossRef]
- Cen, L.P.; Han, M.; Zhou, L.; Tan, L.; Liang, J.J.; Pang, C.P.; Zhang, M. Bilateral retinal microglial response to unilateral optic nerve transection in rats. Neuroscience 2015, 311, 56–66. [Google Scholar] [CrossRef]
- Trost, A.; Motloch, K.; Bruckner, D.; Schroedl, F.; Bogner, B.; Kaser-Eichberger, A.; Runge, C.; Strohmaier, C.; Klein, B.; Aigner, L.; et al. Time-dependent retinal ganglion cell loss, microglial activation and blood-retina-barrier tightness in an acute model of ocular hypertension. Exp. Eye Res. 2015, 136, 59–71. [Google Scholar] [CrossRef]
- Kezic, J.M.; Chrysostomou, V.; Trounce, I.A.; McMenamin, P.G.; Crowston, J.G. Effect of anterior chamber cannulation and acute IOP elevation on retinal macrophages in the adult mouse. Investig. Ophthalmol. Vis. Sci. 2013, 54, 3028–3036. [Google Scholar] [CrossRef]
- Joachim, S.C.; Reinehr, S.; Kuehn, S.; Laspas, P.; Gramlich, O.W.; Kuehn, M.; Tischoff, I.; von Pein, H.D.; Dick, H.B.; Grus, F.H. Immune response against ocular tissues after immunization with optic nerve antigens in a model of autoimmune glaucoma. Mol. Vis. 2013, 19, 1804–1814. [Google Scholar] [PubMed]
- Kleiter, I.; Song, J.; Lukas, D.; Hasan, M.; Neumann, B.; Croxford, A.L.; Pedre, X.; Hovelmeyer, N.; Yogev, N.; Mildner, A.; et al. Smad7 in T cells drives T helper 1 responses in multiple sclerosis and experimental autoimmune encephalomyelitis. Brain 2010, 133 Pt 4, 1067–1081. [Google Scholar] [CrossRef]
- Casola, C.; Reinehr, S.; Kuehn, S.; Stute, G.; Spiess, B.M.; Dick, H.B.; Joachim, S.C. Specific Inner Retinal Layer Cell Damage in an Autoimmune Glaucoma Model Is Induced by GDNF With or Without HSP27. Investig. Ophthalmol. Vis. Sci. 2016, 57, 3626–3639. [Google Scholar] [CrossRef] [Green Version]
- Casola, C.; Schiwek, J.E.; Reinehr, S.; Kuehn, S.; Grus, F.H.; Kramer, M.; Dick, H.B.; Joachim, S.C. S100 Alone Has the Same Destructive Effect on Retinal Ganglion Cells as in Combination with HSP 27 in an Autoimmune Glaucoma Model. J. Mol. Neurosci. 2015, 56, 228–236. [Google Scholar] [CrossRef] [PubMed]
- Horstmann, L.; Kuehn, S.; Pedreiturria, X.; Haak, K.; Pfarrer, C.; Dick, H.B.; Kleiter, I.; Joachim, S.C. Microglia response in retina and optic nerve in chronic experimental autoimmune encephalomyelitis. J. Neuroimmunol. 2016, 298, 32–41. [Google Scholar] [CrossRef]
- Shindler, K.S.; Revere, K.; Dutt, M.; Ying, G.S.; Chung, D.C. In vivo detection of experimental optic neuritis by pupillometry. Exp. Eye Res. 2012, 100, 1–6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Horstmann, L.; Schmid, H.; Heinen, A.P.; Kurschus, F.C.; Dick, H.B.; Joachim, S.C. Inflammatory demyelination induces glia alterations and ganglion cell loss in the retina of an experimental autoimmune encephalomyelitis model. J. Neuroinflamm. 2013, 10, 888. [Google Scholar] [CrossRef] [PubMed]
- Reinhard, J.; Renner, M.; Wiemann, S.; Shakoor, D.A.; Stute, G.; Dick, H.B.; Faissner, A.; Joachim, S.C. Ischemic injury leads to extracellular matrix alterations in retina and optic nerve. Sci. Rep. 2017, 7, 43470. [Google Scholar] [CrossRef]
- Palmhof, M.; Lohmann, S.; Schulte, D.; Stute, G.; Wagner, N.; Dick, H.B.; Joachim, S.C. Fewer Functional Deficits and Reduced Cell Death after Ranibizumab Treatment in a Retinal Ischemia Model. Int. J. Mol. Sci. 2018, 19, 1636. [Google Scholar] [CrossRef] [PubMed]
- Wilmes, A.T.; Reinehr, S.; Kuhn, S.; Pedreiturria, X.; Petrikowski, L.; Faissner, S.; Ayzenberg, I.; Stute, G.; Gold, R.; Dick, H.B.; et al. Laquinimod protects the optic nerve and retina in an experimental autoimmune encephalomyelitis model. J. Neuroinflamm. 2018, 15, 183. [Google Scholar] [CrossRef] [PubMed]
- Pfaffl, M.W.; Horgan, G.W.; Dempfle, L. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 2002, 30, e36. [Google Scholar] [CrossRef] [PubMed]
Primary antibodies | Secondary antibodies | ||||||||
---|---|---|---|---|---|---|---|---|---|
Antibody | Company | Catalog Number | Tissue | Dilution | Antibody | Company | Catalog Number | Tissue | Dilution |
Anti-Brn-3a | Santa Cruz | sc-31984 | Retina | 1:100 | Donkey anti-goat Alexa Fluor 488 | Dianova | 705-545-147 | Retina | 1:500 |
Anti-F4/80 | AdB Serotec | MCAA97G | Retina | 1:100 | Donkey anti-rat Alexa Fluor 488 | Thermo Fisher | A-21208 | Retina | 1:500 |
Optic nerve | Optic nerve | ||||||||
Anti-gephyrin | SySy | 147008 | Retina | 1:500 | Donkey anti-rabbit Alexa Fluor 488 | Jackson ImmunoResearch | 711-547-003 | Retina | 1:500 |
Anti-GFAP | Millipore | AB5541 | Retina | 1:250 | Donkey anti-chicken Cy3 | Millipore | AP194C | Retina | 1:500 |
Optic nerve | 1:500 | Optic nerve | |||||||
Anti-Iba1 | Wako Chemicals | 019-19741 | Retina | 1:500 | Donkey anti-rabbit Alexa Fluor 555 | Invitrogen | A31572 | Retina | 1:500 |
Optic nerve | Optic nerve | ||||||||
Anti-opsin | Millipore | AB5405 | Retina | 1:500 | Donkey anti-rabbit Alexa Fluor 555 | Invitrogen | A31752 | Retina | 1:500 |
Anti-PKCα | Santa Cruz | sc-8393 | Retina | 1:500 | Goat anti-mouse Alexa Fluor 488 | Invitrogen | A11029 | Retina | 1:500 |
Anti-PSD95 | Calbiochem | CP35 | Retina | 1:200 | Goat anti-mouse Alexa Fluor 555 | Invitrogen | A21424 | Retina | 1:500 |
Anti-recoverin | Millipore | AB5585 | Retina | 1:1000 | Donkey anti-rabbit Alexa Fluor 555 | Invitrogen | A31572 | Retina | 1:500 |
Anti-rhodopsin | Abcam | ab3267 | Retina | 1:400 | Goat anti-mouse Alexa Fluor 488 | Invitrogen | A11029 | Retina | 1:500 |
Anti-SMI-32 | Biolegend | 801701 | Optic nerve | 1:2000 | Goat anti-mouse Alexa Fluor 488 | Invitrogen | A11029 | Optic nerve | 1:500 |
Anti-Vglut1 | SySy | 135316 | Retina | 1:500 | Donkey anti-chicken Cy3 | Millipore | AP194C | Retina | 1:500 |
Protein | Background Subtraction (Pixel) | Lower Threshold | Upper Threshold |
---|---|---|---|
Gephyrin | 50 | 7.28 | 75.41 |
GFAP | 20 | 8.30 | 176.00 |
PSD95 | 50 | 5.94 | 259.67 |
Rhodopsin | 50 | 9.27 | 254.87 |
VGlut1 | 50 | 4.80 | 69.17 |
Gene | Forward (F) and Reverse (R) Oligonucleotides | GenBank acc. No. | Amplicon Size |
---|---|---|---|
β-actin-F β-actin-R | ctaaggccaaccgtgaaaag accagaggcatacagggaca | NM_007393.5 | 104 bp |
Cd68-F Cd68-R | tgatcttgctaggaccgctta taacggcctttttgtgagga | NM_001291058.1 | 66 bp |
Dlg4-F Dlg4-R | cggatgaagatggcgatag tctgtgcgagaggtagcaga | NM_007864.3 | 110 bp |
Gphn-F Gphn-R | tgatcttcatgctcagatcca ttgcaaatgttgttggcaag | NM_145965.2 | 68 bp |
Gfap-F Gfap-R | acagactttctccaacctccag ccttctgacacggatttggt | NM_010277.3 | 63 bp |
Iba1-F Iba1-R | ggatttgcagggaggaaaa tgggatcatcgaggaattg | D86382.1 | 92 bp |
Pou4f1-F Pou4f1-R | ctccctgagcacaagtaccc ctggcgaagaggttgctc | AY706205.1 | 98 bp |
Ppid-F Ppid-R | aaggatggcaaggattgaaa ctttaagcaattctgcctgga | NM_026352 | 105 bp |
Rho-F Rho-R | tgtggtcttcacctggatcat gaacattgcatgccctcag | NM_145383.1 | 90 bp |
Slc17a7-F Slc17a7-R | gtgcaatgaccaaggacaag agatgacaccgccgtagtg | NM_182993.2 | 103 bp |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Reinehr, S.; Reinhard, J.; Wiemann, S.; Hesse, K.; Voss, C.; Gandej, M.; Dick, H.B.; Faissner, A.; Joachim, S.C. Transfer of the Experimental Autoimmune Glaucoma Model from Rats to Mice—New Options to Study Glaucoma Disease. Int. J. Mol. Sci. 2019, 20, 2563. https://doi.org/10.3390/ijms20102563
Reinehr S, Reinhard J, Wiemann S, Hesse K, Voss C, Gandej M, Dick HB, Faissner A, Joachim SC. Transfer of the Experimental Autoimmune Glaucoma Model from Rats to Mice—New Options to Study Glaucoma Disease. International Journal of Molecular Sciences. 2019; 20(10):2563. https://doi.org/10.3390/ijms20102563
Chicago/Turabian StyleReinehr, Sabrina, Jacqueline Reinhard, Susanne Wiemann, Karoline Hesse, Christina Voss, Marcel Gandej, H. Burkhard Dick, Andreas Faissner, and Stephanie C. Joachim. 2019. "Transfer of the Experimental Autoimmune Glaucoma Model from Rats to Mice—New Options to Study Glaucoma Disease" International Journal of Molecular Sciences 20, no. 10: 2563. https://doi.org/10.3390/ijms20102563
APA StyleReinehr, S., Reinhard, J., Wiemann, S., Hesse, K., Voss, C., Gandej, M., Dick, H. B., Faissner, A., & Joachim, S. C. (2019). Transfer of the Experimental Autoimmune Glaucoma Model from Rats to Mice—New Options to Study Glaucoma Disease. International Journal of Molecular Sciences, 20(10), 2563. https://doi.org/10.3390/ijms20102563