Mitochondrial-Derived Peptide MOTS-c Increases Adipose Thermogenic Activation to Promote Cold Adaptation
Abstract
:1. Introduction
2. Results
2.1. MOTS-c Administration Promotes the Ability of Cold Adaptation
2.2. MOTS-c Administration Prevents Acute Cold-Induced Liver Lipid Deposition
2.3. MOTS-c Administration Increases the White Fat “Browning”and Brown Fat Activation upon Acute Cold Exposure
2.4. MOTS-c Improves the Expression of Thermogenic Genes In Vitro
3. Discussion
4. Materials and Methods
4.1. Experimental Groups
4.2. Synthesis of Peptides
4.3. Serum Parameters Analysis
4.4. H&E (Hematoxylin–Eosin) Staining
4.5. Liver Glycogen Staining and Glycogen Content Analysis
4.6. Liver Oil Red O Staining and Triglyceride Content Analysis
4.7. Cell Culture and Adipocyte Differentiation
4.8. RNA Isolation and Quantitative RT-PCR
4.9. Western Blot Analysis
4.10. Micro PET/CT Imaging
4.11. Tissue Oxygen Consumption Test
4.12. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
Abbreviations
MOTS-c | Mitochondrial ORF of the twelve S c |
UCP1 | Uncoupled protein 1 |
PGC1α | PPARG coactivator 1 alpha |
Dio2 | Iodothyronine deiodinase 2 |
Elovl3 | ELOVL fatty acid elongase 3 |
TGs | Triglycerides |
References
- Ikaheimo, T.M. Cardiovascular diseases, cold exposure and exercise. Temperature 2018, 5, 123–146. [Google Scholar] [CrossRef] [PubMed]
- Jones, D.M.; Bailey, S.P.; Roelands, B.; Buono, M.J.; Meeusen, R. Cold acclimation and cognitive performance: A review. Auton. Neurosci. 2017, 208, 36–42. [Google Scholar] [CrossRef] [PubMed]
- Xu, D.; Zhang, Y.; Wang, B.; Yang, H.; Ban, J.; Liu, F.; Li, T. Acute effects of temperature exposure on blood pressure: An hourly level panel study. Environ. Int. 2019, 124, 493–500. [Google Scholar] [CrossRef]
- Castellani, J.W.; Young, A.J. Human physiological responses to cold exposure: Acute responses and acclimatization to prolonged exposure. Auton. Neurosci. 2016, 196, 63–74. [Google Scholar] [CrossRef]
- Enriquez, T.; Renault, D.; Charrier, M.; Colinet, H. Cold Acclimation Favors Metabolic Stability in Drosophila suzukii. Front. Physiol. 2018, 9, 1506. [Google Scholar] [CrossRef] [PubMed]
- Enriquez, T.; Colinet, H. Cold acclimation triggers lipidomic and metabolic adjustments in the spotted wing drosophila Drosophila suzukii (Matsumara). Am. J. Physiol. Regul. Integr. Comp. Physiol. 2019. [Google Scholar] [CrossRef] [PubMed]
- Gordon, K.; Blondin, D.P.; Friesen, B.J.; Tingelstad, H.C.; Kenny, G.P.; Haman, F. Seven days of cold acclimation substantially reduces shivering intensity and increases non-shivering thermogenesis in adult humans. J. Appl. Physiol. 2019. [Google Scholar] [CrossRef]
- Ouellet, V.; Labbe, S.M.; Blondin, D.P.; Phoenix, S.; Guerin, B.; Haman, F.; Turcotte, E.E.; Richard, D.; Carpentier, A.C. Brown adipose tissue oxidative metabolism contributes to energy expenditure during acute cold exposure in humans. J. Clin. Investig. 2012, 122, 545–552. [Google Scholar] [CrossRef] [PubMed]
- Cairo, M.; Campderros, L.; Gavalda-Navarro, A.; Cereijo, R.; Delgado-Angles, A.; Quesada-Lopez, T.; Giralt, M.; Villarroya, J.; Villarroya, F. Parkin controls brown adipose tissue plasticity in response to adaptive thermogenesis. EMBO Rep. 2019, 20, e46832. [Google Scholar] [CrossRef]
- Bartelt, A.; Bruns, O.T.; Reimer, R.; Hohenberg, H.; Ittrich, H.; Peldschus, K.; Kaul, M.G.; Tromsdorf, U.I.; Weller, H.; Waurisch, C.; et al. Brown adipose tissue activity controls triglyceride clearance. Nat. Med. 2011, 17, 200–205. [Google Scholar] [CrossRef] [PubMed]
- Mika, A.; Macaluso, F.; Barone, R.; Di Felice, V.; Sledzinski, T. Effect of Exercise on Fatty Acid Metabolism and Adipokine Secretion in Adipose Tissue. Front. Physiol. 2019, 10, 26. [Google Scholar] [CrossRef] [PubMed]
- Miletta, M.C.; Horvath, T.L. From white to beige: A new hypothalamic pathway. EMBO Rep. 2018, 19. [Google Scholar] [CrossRef]
- Wu, J.; Bostrom, P.; Sparks, L.M.; Ye, L.; Choi, J.H.; Giang, A.H.; Khandekar, M.; Virtanen, K.A.; Nuutila, P.; Schaart, G.; et al. Beige adipocytes are a distinct type of thermogenic fat cell in mouse and human. Cell 2012, 150, 366–376. [Google Scholar] [CrossRef] [PubMed]
- Cao, L.; Choi, E.Y.; Liu, X.; Martin, A.; Wang, C.; Xu, X.; During, M.J. White to brown fat phenotypic switch induced by genetic and environmental activation of a hypothalamic-adipocyte axis. Cell Metab. 2011, 14, 324–338. [Google Scholar] [CrossRef]
- Cataldo, L.R.; Fernandez-Verdejo, R.; Santos, J.L.; Galgani, J.E. Plasma MOTS-c levels are associated with insulin sensitivity in lean but not in obese individuals. J. Investig. Med. 2018, 66, 1019–1022. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.J.; Miller, B.; Kumagai, H.; Yen, K.; Cohen, P. MOTS-c: An equal opportunity insulin sensitizer. J. Mol. Med. 2019, 97, 487–490. [Google Scholar] [CrossRef]
- Lee, C.; Kim, K.H.; Cohen, P. MOTS-c: A novel mitochondrial-derived peptide regulating muscle and fat metabolism. Free Radic. Biol. Med. 2016, 100, 182–187. [Google Scholar] [CrossRef]
- Qin, Q.; Delrio, S.; Wan, J.; Jay Widmer, R.; Cohen, P.; Lerman, L.O.; Lerman, A. Downregulation of circulating MOTS-c levels in patients with coronary endothelial dysfunction. Int. J. Cardiol. 2018, 254, 23–27. [Google Scholar] [CrossRef]
- Lee, C.; Zeng, J.; Drew, B.G.; Sallam, T.; Martin-Montalvo, A.; Wan, J.; Kim, S.J.; Mehta, H.; Hevener, A.L.; de Cabo, R.; et al. The mitochondrial-derived peptide MOTS-c promotes metabolic homeostasis and reduces obesity and insulin resistance. Cell Metab. 2015, 21, 443–454. [Google Scholar] [CrossRef] [PubMed]
- Ming, W.; Lu, G.; Xin, S.; Huanyu, L.; Yinghao, J.; Xiaoying, L.; Chengming, X.; Banjun, R.; Li, W.; Zifan, L. Mitochondria related peptide MOTS-c suppresses ovariectomy-induced bone loss via AMPK activation. Biochem. Biophys. Res. Commun. 2016, 476, 412–419. [Google Scholar] [CrossRef] [PubMed]
- Lu, H.; Wei, M.; Zhai, Y.; Li, Q.; Ye, Z.; Wang, L.; Luo, W.; Chen, J.; Lu, Z. MOTS-c peptide regulates adipose homeostasis to prevent ovariectomy-induced metabolic dysfunction. J. Mol. Med. 2019, 97, 473–485. [Google Scholar] [CrossRef]
- Hankir, M.K.; Klingenspor, M. Brown adipocyte glucose metabolism: A heated subject. EMBO Rep. 2018, 19, e46404. [Google Scholar] [CrossRef] [PubMed]
- Lee, P.; Werner, C.D.; Kebebew, E.; Celi, F.S. Functional thermogenic beige adipogenesis is inducible in human neck fat. Int. J. Obes. 2014, 38, 170–176. [Google Scholar] [CrossRef]
- Singh, A.K.; Aryal, B.; Chaube, B.; Rotllan, N.; Varela, L.; Horvath, T.L.; Suarez, Y.; Fernandez-Hernando, C. Brown adipose tissue derived ANGPTL4 controls glucose and lipid metabolism and regulates thermogenesis. Mol. Metab. 2018, 11, 59–69. [Google Scholar] [CrossRef]
- Berbee, J.F.; Boon, M.R.; Khedoe, P.P.; Bartelt, A.; Schlein, C.; Worthmann, A.; Kooijman, S.; Hoeke, G.; Mol, I.M.; John, C.; et al. Brown fat activation reduces hypercholesterolaemia and protects from atherosclerosis development. Nat. Commun. 2015, 6, 6356. [Google Scholar] [CrossRef] [PubMed]
- Dong, M.; Yang, X.; Lim, S.; Cao, Z.; Honek, J.; Lu, H.; Zhang, C.; Seki, T.; Hosaka, K.; Wahlberg, E.; et al. Cold exposure promotes atherosclerotic plaque growth and instability via UCP1-dependent lipolysis. Cell Metab. 2013, 18, 118–129. [Google Scholar] [CrossRef]
- Rosell, M.; Kaforou, M.; Frontini, A.; Okolo, A.; Chan, Y.W.; Nikolopoulou, E.; Millership, S.; Fenech, M.E.; MacIntyre, D.; Turner, J.O.; et al. Brown and white adipose tissues: Intrinsic differences in gene expression and response to cold exposure in mice. Am. J. Physiol. Endocrinol. Metab. 2014, 306, E945–E964. [Google Scholar] [CrossRef] [PubMed]
- Blondin, D.P.; Daoud, A.; Taylor, T.; Tingelstad, H.C.; Bezaire, V.; Richard, D.; Carpentier, A.C.; Taylor, A.W.; Harper, M.E.; Aguer, C.; et al. Four-week cold acclimation in adult humans shifts uncoupling thermogenesis from skeletal muscles to brown adipose tissue. J. Physiol. 2017, 595, 2099–2113. [Google Scholar] [CrossRef]
- Kim, K.H.; Son, J.M.; Benayoun, B.A.; Lee, C. The Mitochondrial-Encoded Peptide MOTS-c Translocates to the Nucleus to Regulate Nuclear Gene Expression in Response to Metabolic Stress. Cell Metab. 2018, 28, 516–524.e7. [Google Scholar] [CrossRef]
- Zhang, Y.; Li, R.; Meng, Y.; Li, S.; Donelan, W.; Zhao, Y.; Qi, L.; Zhang, M.; Wang, X.; Cui, T.; et al. Irisin stimulates browning of white adipocytes through mitogen-activated protein kinase p38 MAP kinase and ERK MAP kinase signaling. Diabetes 2014, 63, 514–525. [Google Scholar] [CrossRef]
- Zhai, D.; Ye, Z.; Jiang, Y.; Xu, C.; Ruan, B.; Yang, Y.; Lei, X.; Xiang, A.; Lu, H.; Zhu, Z.; et al. MOTS-c peptide increases survival and decreases bacterial load in mice infected with MRSA. Mol. Immunol. 2017, 92, 151–160. [Google Scholar] [CrossRef] [PubMed]
- Kobilka, B.K. Structural insights into adrenergic receptor function and pharmacology. Trends Pharmacol. Sci. 2011, 32, 213–218. [Google Scholar] [CrossRef] [PubMed]
- Gnad, T.; Scheibler, S.; von Kugelgen, I.; Scheele, C.; Kilic, A.; Glode, A.; Hoffmann, L.S.; Reverte-Salisa, L.; Horn, P.; Mutlu, S.; et al. Adenosine activates brown adipose tissue and recruits beige adipocytes via A2A receptors. Nature 2014, 516, 395–399. [Google Scholar] [CrossRef] [PubMed]
- Ying, G.; Iribarren, P.; Zhou, Y.; Gong, W.; Zhang, N.; Yu, Z.X.; Le, Y.; Cui, Y.; Wang, J.M. Humanin, a newly identified neuroprotective factor, uses the G protein-coupled formylpeptide receptor-like-1 as a functional receptor. J. Immunol. 2004, 172, 7078–7085. [Google Scholar] [CrossRef] [PubMed]
- Neves, S.R.; Ram, P.T.; Iyengar, R. G protein pathways. Science 2002, 296, 1636–1639. [Google Scholar] [CrossRef] [PubMed]
- Xue, C.; Lu, H.; Liu, Y.; Zhang, J.; Wang, J.; Luo, W.; Zhang, W.; Chen, J. Trans-Ferulic Acid-4-beta-Glucoside Alleviates Cold-Induced Oxidative Stress and Promotes Cold Tolerance. Int. J. Mol. Sci. 2018, 19, 2321. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Kang, F.; Gao, Y.; Liu, Y.; Xu, X.; Ma, X.; Ma, W.; Yang, W.; Wang, J. Metformin Promotes 2-Deoxy-2-[18F]Fluoro-d-Glucose Uptake in Hepatocellular Carcinoma Cells Through FoxO1-Mediated Downregulation of Glucose-6-Phosphatase. Mol. Imaging Biol. 2018, 20, 388–397. [Google Scholar] [CrossRef]
Gene Symbol | Forward | Reverse |
---|---|---|
36B4 | GAAACTGCTGCCTCACATCCG | GCTGGCACAGTGACCTCACACG |
UCP1 | ACTGCCACACCTCCAGTCATT | CTTTGCCTCACTCAGGATTGG |
PGC1α | AGCCGTGACCACTGACAACGAG | GCTGCATGGTTCTGAGTGCTAAG |
Dio2 | CAGTGTGGTGCACGTCTCCAATC | TGAACCAAAGTTGACCACCAG |
ELovl3 | TCCGCGTTCTCATGTAGGTCT | GGACCTGATGCAACCCTATGA |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lu, H.; Tang, S.; Xue, C.; Liu, Y.; Wang, J.; Zhang, W.; Luo, W.; Chen, J. Mitochondrial-Derived Peptide MOTS-c Increases Adipose Thermogenic Activation to Promote Cold Adaptation. Int. J. Mol. Sci. 2019, 20, 2456. https://doi.org/10.3390/ijms20102456
Lu H, Tang S, Xue C, Liu Y, Wang J, Zhang W, Luo W, Chen J. Mitochondrial-Derived Peptide MOTS-c Increases Adipose Thermogenic Activation to Promote Cold Adaptation. International Journal of Molecular Sciences. 2019; 20(10):2456. https://doi.org/10.3390/ijms20102456
Chicago/Turabian StyleLu, Huanyu, Shan Tang, Chong Xue, Ying Liu, Jiye Wang, Wenbin Zhang, Wenjing Luo, and Jingyuan Chen. 2019. "Mitochondrial-Derived Peptide MOTS-c Increases Adipose Thermogenic Activation to Promote Cold Adaptation" International Journal of Molecular Sciences 20, no. 10: 2456. https://doi.org/10.3390/ijms20102456