Mutual Expression of ALDH1A1, LOX, and Collagens in Ovarian Cancer Cell Lines as Combined CSCs- and ECM-Related Models of Drug Resistance Development
Abstract
:1. Introduction
2. Results
2.1. LOX Gene and Protein Expression in Drug-Resistant Ovarian Cancer Cell Lines
2.2. Early Response to Cytotoxic Drug Treatment in Ovarian Cancer Cell Line
2.3. ALDH1A1 Gene and Protein Expression in Drug-Resistant Ovarian Cancer Cell Lines
2.4. Flow Cytometry Analysis of the ALDH1A1 Population
2.5. Coexpression of P-gp and ALDH1A1
2.6. Coexpression of LOX and Collagens
2.7. Coexpression of ALDH1A1 and Collagens
2.8. Coexpression of LOX and ALDH1A1
2.9. Immunohistochemical Expression of LOX, COL1A2, COL3A1, COL21A1, and ALDH1A1 Proteins
3. Discussion
4. Materials and Methods
4.1. Reagents and Antibodies
4.2. Cell Lines
4.3. QPCR Gene Expression Analysis
4.4. Protein Isolation and Western Blot Analysis
4.5. ALDEFLUOR Assay
4.6. Immunofluorescence Analysis
4.7. Double Immunofluorescence Analysis
4.8. Immunohistochemistry
4.9. PAC and TOP Response in Time Course Experiment
4.10. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
Abbreviations
LOX | Lysyl Oxidase |
ALDH1A1 | Aldehyde Dehydrogenase 1 |
ECM | Extracellular Matrix |
CSCs | Cancer Stem Cells |
CAM-DR | Cell Adhesion Mediated Drug Resistance |
TR | Topotecan Resistance |
PR | Paclitaxel Resistance |
References
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2015. CA Cancer J. Clin. 2015, 65, 5–29. [Google Scholar] [CrossRef] [PubMed]
- Hennessy, B.T.; Coleman, R.L.; Markman, M. Ovarian cancer. Lancet 2009, 374, 1371–1382. [Google Scholar] [CrossRef]
- Prat, J. New insights into ovarian cancer pathology. Ann. Oncol. 2012, 23, 111–117. [Google Scholar] [CrossRef] [PubMed]
- Parmar, M.K.; Ledermann, J.A.; Colombo, N.; du Bois, A.; Delaloye, J.F.; Kristensen, G.B.; Wheeler, S.; Swart, A.M.; Qian, W.; Torri, V.; et al. Paclitaxel plus platinum-based chemotherapy versus conventional platinum-based chemotherapy in women with relapsed ovarian cancer: The ICON4/AGO-OVAR-2.2 trial. Lancet 2003, 361, 2099–2106. [Google Scholar] [PubMed]
- Mahner, S.; Meier, W.; du Bois, A.; Brown, C.; Lorusso, D.; Dell’Anna, T.; Cretin, J.; Havsteen, H.; Bessette, P.; Zeimet, A.G.; et al. Carboplatin and pegylated liposomal doxorubicin versus carboplatin and paclitaxel in very platinum-sensitive ovarian cancer patients: Results from a subset analysis of the CALYPSO phase III trial. Eur. J. Cancer 2015, 51, 352–358. [Google Scholar] [CrossRef] [PubMed]
- Sehouli, J.; Stengel, D.; Oskay-Oezcelik, G.; Zeimet, A.G.; Sommer, H.; Klare, P.; Stauch, M.; Paulenz, A.; Camara, O.; Keil, E.; et al. Nonplatinum topotecan combinations versus topotecan alone for recurrent ovarian cancer: Results of a phase III study of the North-Eastern German Society of Gynecological Oncology Ovarian Cancer Study Group. J. Clin. Oncol. 2008, 26, 3176–3182. [Google Scholar] [CrossRef] [PubMed]
- Kartalou, M.; Essigmann, J.M. Mechanisms of resistance to cisplatin. Mutat. Res. 2001, 478, 23–43. [Google Scholar] [CrossRef]
- Jordan, A.; Hadfield, J.A.; Lawrence, N.J.; McGown, A.T. Tubulin as a target for anticancer drugs: Agents which interact with the mitotic spindle. Med. Res. Rev. 1998, 18, 259–296. [Google Scholar] [CrossRef]
- Rubin, EH.; Li, T.; Duan, P.; Liu, L.F. Cellular resistance to topoisomerase poisons. Cancer Treat. Res. 1996, 243–260. [Google Scholar] [CrossRef]
- Stavrovskaya, A.A. Cellular mechanism of multidrug resistance of tumor cells. Biochemistry 2000, 65, 95–106. [Google Scholar]
- Leonard, G.D.; Fojo, T.; Bates, S.E. The role of ABC transporters in clinical practice. Oncologist 2003, 8, 411–424. [Google Scholar] [CrossRef] [PubMed]
- Januchowski, R.; Wojtowicz, K.; Andrzejewska, M.; Zabel, M. Expression of MDR1 and MDR3 gene products in paclitaxel-, doxorubicin- and vincristine-resistant cell lines. Biomed. Pharmacother. 2014, 68, 111–117. [Google Scholar] [CrossRef] [PubMed]
- Januchowski, R.; Sterzyńska, K.; Zaorska, K.; Sosińska, P.; Klejewski, A.; Brązert, M.; Nowicki, M.; Zabel, M. Analysis of MDR genes expression and cross-resistance in eight drug resistant ovarian cancer cell lines. J. Ovarian Res. 2016, 9, 65. [Google Scholar] [CrossRef] [PubMed]
- Robey, R.W.; Polgar, O.; Deeken, J.; To, K.W.; Bates, S.E. ABCG2: Determining its relevance in clinical drug resistance. Cancer Metastasis Rev. 2007, 26, 39–57. [Google Scholar] [CrossRef] [PubMed]
- Guminski, A.D.; Balleine, R.L.; Chiew, Y.E.; Webster, L.R.; Tapner, M.; Farrell, G.C.; Harnett, P.R.; Defazio, A. MRP2 (ABCC2) and cisplatin sensitivity in hepatocytes and human ovarian carcinoma. Gynecol. Oncol. 2006, 100, 239–246. [Google Scholar] [CrossRef] [PubMed]
- Wojtowicz, K.; Januchowski, R.; Nowicki, M.; Zabel, M. Inhibition of protein glycosylation reverses the MDR phenotype of cancer cell lines. Biomed. Pharmacother. 2015, 74, 49–56. [Google Scholar] [CrossRef]
- Tannock, I.F.; Lee, C.M.; Tunggal, J.K.; Cowan, D.S.; Egorin, M.J. Limited penetration of anticancer drugs through tumor tissue: A potential cause of resistance of solid tumors to chemotherapy. Clin. Cancer Res. 2002, 8, 878–884. [Google Scholar]
- Netti, P.A.; Berk, D.A.; Swartz, M.A.; Grodzinsky, A.J.; Jain, R.K. Role of extracellular matrix assembly in interstitial transport in solid tumors. Cancer Res. 2000, 60, 2497–2503. [Google Scholar]
- Stylianopoulos, T.; Diop-Frimpong, B.; Munn, L.L.; Jain, R.K. Diffusion anisotropy in collagen gels and tumors: The effect of fiber network orientation. Biophys. J. 2010, 99, 3119–3128. [Google Scholar] [CrossRef]
- Di Paolo, A.; Bocci, G. Drug distribution in tumors: Mechanisms, role in drug resistance, and methods for modification. Curr. Oncol. Rep. 2007, 9, 109–114. [Google Scholar] [CrossRef]
- Correia, A.L.; Bissell, M.J. The tumor microenvironment is a dominant force in multidrug resistance. Drug Resist. Updat. 2012, 15, 39–49. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Morin, P.J. Drug resistance and the microenvironment: Nature and nurture. Drug Resist. Updat. 2003, 6, 169–172. [Google Scholar] [CrossRef]
- Sherman-Baust, C.A.; Weeraratna, A.T.; Rangel, L.B.; Pizer, E.S.; Cho, K.R.; Schwartz, D.R.; Shock, T.; Morin, P.J. Remodeling of the extracellular matrix through overexpression of collagen VI contributes to cisplatin resistance in ovarian cancer cells. Cancer Cell 2003, 3, 377–386. [Google Scholar] [CrossRef]
- Januchowski, R.; Zawierucha, P.; Ruciński, M.; Zabel, M. Microarray-based detection and expression analysis of extracellular matrix proteins in drug-resistant ovarian cancer cell lines. Oncol. Rep. 2014, 32, 1981–1990. [Google Scholar] [CrossRef] [PubMed]
- Işeri, O.D.; Kars, M.D.; Arpaci, F.; Gündüz, U. Gene expression analysis of drug-resistant MCF-7 cells: Implications for relation to extracellular matrix proteins. Cancer Chemother. Pharmacol. 2010, 65, 447–455. [Google Scholar] [CrossRef] [PubMed]
- Januchowski, R.; Zawierucha, P.; Ruciński, M.; Nowicki, M.; Zabel, M. Extracellular matrix proteins expression profiling in chemoresistant variants of the A2780 ovarian cancer cell line. Biomed. Res. Int. 2014, 365867. [Google Scholar] [CrossRef] [PubMed]
- Januchowski, R.; Świerczewska, M.; Sterzyńska, K.; Wojtowicz, K.; Nowicki, M.; Zabel, M. Increased expression of several collagen genes is associated with drug resistance in ovarian cancer cell lines. J. Cancer 2016, 25, 1295–1310. [Google Scholar] [CrossRef]
- Smith-Mungo, L.I.; Kagan, H.M. Lysyl oxidase: Properties, regulation and multiple functions in biology. Matrix Biol. 1998, 16, 387–398. [Google Scholar] [CrossRef]
- Panchenko, M.V.; Stetler-Stevenson, W.G.; Trubetskoy, O.V.; Gacheru, S.N.; Kagan, H.M. Metalloproteinase activity secreted by fibrogenic cells in the processing of prolysyl oxidase: Potential role of procollagen C-proteinase. J. Biol. Chem. 1996, 271, 7113–7119. [Google Scholar] [CrossRef]
- Lucero, H.A.; Kagan, H.M. Lysyl oxidase: An oxidative enzyme and effector of cell function. Cell. Mol. Life Sci. 2006, 63, 2304–2316. [Google Scholar] [CrossRef]
- Kagan, H.M.; Li, W. Lysyl oxidase: Properties, specificity, and biological roles inside and outside of the cell. J. Cell. Biochem. 2003, 88, 660–667. [Google Scholar] [CrossRef] [PubMed]
- Barker, H.E.; Cox, T.R.; Erler, J.T. The rationale for targeting the LOX family in cancer. Nat. Rev. Cancer 2012, 12, 540–552. [Google Scholar] [CrossRef] [PubMed]
- Csiszar, K.; Fong, S.F.; Ujfalusi, A.; Krawetz, S.A.; Salvati, E.P.; Mackenzie, J.W.; Boyd, C.D. Somatic mutations of the lysyl oxidase gene on chromosome 5q23.1 in colorectal tumors. Int. J. Cancer 2002, 97, 636–642. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kaneda, A.; Wakazono, K.; Tsukamoto, T.; Watanabe, N.; Yagi, Y.; Tatematsu, M.; Kaminishi, M.; Sugimura, T.; Ushijima, T. Lysyl oxidase is a tumor suppressor gene inactivated by methylation and loss of heterozygosity in human gastric cancers. Cancer Res. 2004, 64, 6410–6415. [Google Scholar] [CrossRef] [PubMed]
- Bouez, C.; Reynaud, C.; Noblesse, E.; Thepot, A.; Gleyzal, C.; Kanitakis, J.; Perrier, E.; Damour, O.; Sommer, P. The lysyl oxidase LOX is absent in basal and squamous cell carcinomas and its knockdown induces an invading phenotype in a skin equivalent model. Clin. Cancer Res. 2006, 12, 1463–1469. [Google Scholar] [CrossRef] [PubMed]
- Wilgus, M.L.; Borczuk, A.C.; Stoopler, M.; Ginsburg, M.; Gorenstein, L.; Sonett, J.R.; Powell, C.A. Lysyl Oxidase: A Lung Adenocarcinoma Biomarker of Invasion and Survival. Cancer 2011, 117, 2186–2191. [Google Scholar] [CrossRef] [PubMed]
- Erler, J.T.; Bennewith, K.L.; Nicolau, M.; Dornhöfer, N.; Kong, C.; Le, Q.T.; Chi, J.T.; Jeffrey, S.S.; Giaccia, A.J. Lysyl oxidase is essential for hypoxia-induced metastasis. Nature 2006, 440, 1222–1226. [Google Scholar] [CrossRef]
- El-Haibi, C.P.; Bell, G.W.; Zhang, J.; Collmann, A.Y.; Wood, D.; Scherber, C.M.; Csizmadia, E.; Mariani, O.; Zhu, C.; Campagne, A.; et al. Critical role for lysyl oxidase in mesenchymal stem cell-driven breast cancer malignancy. Proc. Natl. Acad. Sci. USA 2012, 109, 17460–17465. [Google Scholar] [CrossRef] [Green Version]
- Liu, N.; Cox, T.R.; Cui, W.; Adell, G.; Holmlund, B.; Ping, J.; Jarlsfelt, I.; Erler, J.T.; Sun, X.F. Nuclear expression of lysyl oxidase enzyme is an independent prognostic factor in rectal cancer patients. Oncotarget 2017, 8, 60015–60024. [Google Scholar] [CrossRef]
- Cheon, D.J.; Tong, Y.; Sim, M.S.; Dering, J.; Berel, D.; Cui, X.; Lester, J.; Beach, J.A.; Tighiouart, M.; Walts, A.E.; et al. A Collagen-Remodeling Gene Signature Regulated by TGF-b Signaling Is Associated with Metastasis and Poor Survival in Serous Ovarian Cancer. Clin. Cancer Res. 2014, 20, 711–723. [Google Scholar] [CrossRef]
- Ji, F.; Wang, Y.; Qiu, L.; Li, S.; Zhu, J.; Liang, Z.; Wan, Y.; Di, W. Hypoxia inducible factor 1α-mediated LOX expression correlates with migration and invasion in epithelial ovarian cancer. Int. J. Oncol. 2013, 42, 1578–1588. [Google Scholar] [CrossRef] [Green Version]
- Greaves, M.; Maley, C.C. Clonal evolution in cancer. Nature 2012, 481, 306–313. [Google Scholar] [CrossRef] [Green Version]
- Januchowski, R.; Wojtowicz, K.; Zabel, M. The role of aldehyde dehydrogenase (ALDH) in cancer drug resistance. Biomed. Pharmacother. 2013, 67, 669–680. [Google Scholar] [CrossRef] [PubMed]
- Clevers, H. The cancer stem cell: Premises, promises and challenges. Nat. Med. 2011, 17, 313–319. [Google Scholar] [CrossRef]
- Moitra, K.; Lou, H.; Dean, M. Multidrug efflux pumps and cancer stem cells: Insights into multidrug resistance and therapeutic development. Clin. Pharmacol. Ther. 2011, 89, 491–502. [Google Scholar] [CrossRef] [PubMed]
- Alison, M.R.; Guppy, N.J.; Lim, S.M.; Nicholson, L.J. Finding cancer stem cells: Are aldehyde dehydrogenases fit for purpose? J. Pathol. 2010, 222, 335–344. [Google Scholar] [CrossRef]
- Tanei, T.; Morimoto, K.; Shimazu, K.; Kim, J.S.; Tanji, Y.; Taguchi, T.; Tamaki, Y.; Noguchi, S. Association of breast cancer stem cells identified by aldehyde dehydrogenase 1 expression with resistance to sequential paclitaxel and epirubicin-based chemotherapy for breast cancers. Clin. Cancer Res. 2009, 15, 4234–4241. [Google Scholar] [CrossRef]
- Wang, Y.C.; Yo, Y.T.; Lee, H.Y.; Liao, Y.P.; Chao, T.K.; Su, P.H.; Lai, H.C. ALDH1-bright epithelial ovarian cancer cells are associated with CD44 expression, drug resistance, and poor clinical outcome. Am. J. Pathol. 2012, 180, 1159–1169. [Google Scholar] [CrossRef]
- Januchowski, R.; Wojtowicz, K.; Sterzyńska, K.; Sosińska, P.; Andrzejewska, M.; Zawierucha, P.; Nowicki, M.; Zabel, M. Inhibition of ALDH1A1 activity decreases expression of drug transporters and reduces chemotherapy resistance in ovarian cancer cell lines. Int. J. Biochem. Cell Biol. 2016, 78, 248–259. [Google Scholar] [CrossRef] [PubMed]
- Januchowski, R.; Sterzyńska, K.; Zawierucha, P.; Ruciński, M.; Świerczewska, M.; Partyka, M.; Bednarek-Rajewska, K.; Brązert, M.; Nowicki, M.; Zabel, M.; et al. Microarray-based detection and expression analysis of new genes associated with drug resistance in ovarian cancer cell lines. Oncotarget 2017, 8, 49944–49958. [Google Scholar] [CrossRef] [PubMed]
- Landen, C.N., Jr.; Goodman, B.; Katre, A.A.; Steg, A.D.; Nick, A.M.; Stone, R.L.; Miller, L.D.; Mejia, P.V.; Jennings, N.B.; Gershenson, D.M.; et al. Targeting aldehyde dehydrogenase cancer stem cells in ovarian cancer. Mol. Cancer Ther. 2010, 9, 3186–3199. [Google Scholar] [CrossRef] [PubMed]
- Croker, A.K.; Allan, A.L. Inhibition of aldehyde dehydrogenase (ALDH) activity reduces chemotherapy and radiation resistance of stem-likeALDHhiCD44+ human breast cancer cells. Breast Cancer Res. Treat. 2012, 133, 75–87. [Google Scholar] [CrossRef] [PubMed]
- Baker, A.M.; Cox, T.R.; Bird, D.; Lang, G.; Murray, G.I.; Sun, X.F.; Southall, S.M.; Wilson, J.R.; Erler, J.T. The role of lysyl oxidase in SRC-dependent proliferation and metastasis of colorectal cancer. J. Natl. Cancer Inst. 2011, 103, 407–424. [Google Scholar] [CrossRef] [PubMed]
- Di Stefano, V.; Torsello, B.; Bianchi, C.; Cifola, I.; Mangano, E.; Bovo, G.; Cassina, V.; De Marco, S.; Corti, R.; Meregalli, C.; et al. Major Action of Endogenous Lysyl Oxidase in Clear Cell Renal Cell Carcinoma Progression and Collagen Stiffness Revealed by Primary Cell Cultures. Am. J. Pathol. 2016, 186, 2473–2485. [Google Scholar] [CrossRef] [PubMed]
- Sakai, M.; Kato, H.; Sano, A.; Tanaka, N.; Inose, T.; Kimura, H.; Sohda, M.; Nakajima, M.; Kuwano, H. Expression of lysyl oxidase is correlated with lymph node metastasis and poor prognosis in esophageal squamous cell carcinoma. Ann. Surg. Oncol. 2009, 16, 2494–2501. [Google Scholar] [CrossRef] [PubMed]
- De Donato, M.; Petrillo, M.; Martinelli, E.; Filippetti, F.; Zannoni, G.F.; Scambia, G.; Gallo, D. Uncovering the role of nuclear Lysyl oxidase (LOX) in advanced high grade serous ovarian cancer. Gynecol. Oncol. 2017, 146, 170–178. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Ma, J.; Shen, H.; Wang, C.; Sun, Y.; Howell, S.B.; Lin, X. Reactive oxygen species promote ovarian cancer progression via the HIF-1α/LOX/E-cadherin pathway. Oncol. Rep. 2014, 32, 2150–2158. [Google Scholar] [CrossRef] [Green Version]
- Boufraqech, M.; Wei, D.; Weyemi, U.; Zhang, L.; Quezado, M.; Kalab, P.; Kebebew, E. LOX is a novel mitotic spindle-associated protein essential for mitosis. Oncotarget 2016, 7, 29023–29035. [Google Scholar] [CrossRef] [Green Version]
- Świerczewska, M.; Klejewski, A.; Brązert, M.; Kaźmierczak, D.; Iżycki, D.; Nowicki, M.; Zabel, M.; Januchowski, R. New and Old Genes Associated with Primary and Established Responses to Paclitaxel Treatment in Ovarian Cancer Cell Lines. Molecules 2018, 23, 891. [Google Scholar] [CrossRef] [Green Version]
- Sterzyńska, K.; Klejewski, A.; Wojtowicz, K.; Świerczewska, M.; Andrzejewska, M.; Rusek, D.; Sobkowski, M.; Kędzia, W.; Brązert, J.; Nowicki, M.; et al. The Role of Matrix Gla Protein (MGP) Expression in Paclitaxel and Topotecan Resistant Ovarian Cancer Cell Lines. Int. J. Mol. Sci. 2018, 19, 2901. [Google Scholar] [CrossRef]
- Klejewski, A.; Świerczewska, M.; Zaorska, K.; Brązert, M.; Nowicki, M.; Zabel, M.; Januchowski, R. New and Old Genes Associated with Topotecan Resistance Development in Ovarian Cancer Cell Lines. Anticancer Res. 2017, 37, 1625–1636. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Świerczewska, M.; Klejewski, A.; Wojtowicz, K.; Brązert, M.; Iżycki, D.; Nowicki, M.; Zabel, M.; Januchowski, R. New and Old Genes Associated with Primary and Established Responses to Cisplatin and Topotecan Treatment in Ovarian Cancer Cell Lines. Molecules 2017, 22, 1717. [Google Scholar] [CrossRef] [PubMed]
- Ma, I.; Allan, A.L. The role of human aldehyde dehydrogenase in normal and cancer stem cells. Stem Cell Rev. 2011, 7, 292–306. [Google Scholar] [CrossRef] [PubMed]
- Silva, I.A.; Bai, S.; McLean, K.; Yang, K.; Griffith, K.; Thomas, D.; Ginestier, C.; Johnston, C.; Kueck, A.; Reynolds, R.K.; et al. Aldehyde dehydrogenase in combination with CD133 defines angiogenic ovarian cancer stem cells that portend poor patient survival. Cancer Res. 2011, 71, 3991–4001. [Google Scholar] [CrossRef] [PubMed]
- Klejewski, A.; Sterzyńska, K.; Wojtowicz, K.; Świerczewska, M.; Partyka, M.; Brązert, M.; Nowicki, M.; Zabel, M.; Januchowski, R. The significance of lumican expression in ovarian cancer drug-resistant cell lines. Oncotarget 2017, 8, 74466–74478. [Google Scholar] [CrossRef] [PubMed]
- Chauhan, V.P.; Stylianopoulos, T.; Boucher, Y.; Jain, R.K. Delivery of molecular and nanoscale medicine to tumors: Transport barriers and strategies. Annu. Rev. Chem. Biomol. Eng. 2011, 2, 281–298. [Google Scholar] [CrossRef]
- Morton, J.P.; Pinese, M.; Saturno, G.; Jamieson, N.B.; McGhee, E.; Timpson, P.; Leach, J.; McGarry, L.; Shanks, E.; Bailey, P.; et al. Targeting the LOX/hypoxia axis reverses many of the features that make pancreatic cancer deadly: Inhibition of LOX abrogates metastasis and enhances drug efficacy. EMBO Mol. Med. 2015, 7, 1063–1076. [Google Scholar] [CrossRef]
- Sterzyńska, K.; Klejewski, A.; Świerczewska, M.; Nowicki, M.; Brązert, J.; Januchowski, R. Myotilin, a New Topotecan Resistant Protein in Ovarian Cancer Cell Lines. J. Cancer 2018, 9, 4413–4421. [Google Scholar] [CrossRef]
- Le Calve, B.; Griveau, A.; Vindrieux, D.; Marechal, R.; Wiel, C.; Svrcek, M.; Gout, J.; Azzi, L.; Payen, L.; Cros, J.; et al. Lysyl oxidase family activity promotes resistance of pancreatic ductal adenocarcinoma to chemotherapy by limiting the intratumoral anticancer drug distribution. Oncotarget 2016, 7, 32100–32112. [Google Scholar] [CrossRef] [Green Version]
- Ryber, L.; Guan, Y.; Firestein, R.; Xiao, Y.; Choi, Y.; Rabe, C.; Lu, S.; Fuentes, E.; Huw, L.Y.; Lackner, M.R.; et al. Upregulation of Periostin and Reactive Stroma Is Associated with Primary Chemoresistance and Predicts Clinical Outcomes in Epithelial Ovarian. Cancer Clin. Cancer Res. 2015, 21, 2941–2951. [Google Scholar] [CrossRef]
- Yasui, W.; Oue, N.; Ito, R.; Kuraoka, K.; Nakayama, H. Search for new biomarkers of gastric cancer through serial analysis of gene expression and its clinical implications. Cancer Sci. 2004, 95, 385–392. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chou, M.Y.; Li, H.C. Genomic organization and characterization of the human type XXI collagen (COL21A1) gene. Genomics 2002, 79, 395–401. [Google Scholar] [CrossRef] [PubMed]
- Xiong, G.; Deng, L.; Zhu, J.; Rychahou, P.G.; Xu, R. Prolyl-4-hydroxylase α subunit 2 promotes breast cancer progression and metastasis by regulating collagen deposition. BMC Cancer 2014, 14. [Google Scholar] [CrossRef] [PubMed]
- Helleman, J.; Jansen, M.P.; Span, P.N.; van Staveren, I.L.; Massuger, L.F.; Meijer-van Gelder, M.E.; Sweep, F.C.; Ewing, P.C.; van der Burg, M.E.; Stoter, G.; et al. Molecular profiling of platinum resistant ovarian cancer. Int. J. Cancer 2006, 118, 1963–1971. [Google Scholar] [CrossRef]
- Januchowski, R.; Wojtowicz, K.; Sujka-Kordowska, P.; Andrzejewska, M.; Zabel, M. MDR gene expression analysis of six drug-resistant ovarian cancer cell lines. Biomed. Res. Int. 2013, 241763. [Google Scholar] [CrossRef] [PubMed]
Transcript | Sequence (5′-3′ Direction) | ENST Number http://www.ensembl.org | Product Size (bp) |
---|---|---|---|
LOX | CAGAGGAGAGTGGCTGAAGG CCAGGACTCAATCCCTGTGT | 00000231004 | 116 bp |
ALDH1A1 | GTTGTCAAACCAGCAGAGCA CTGTAGGCCCATAACCAGGA | 00000165092 | 115 bp |
GADPH | GAAGGTGAAGGTCGGAGTCA GACAAGCTTCCCGTTCTCAG | 00000229239 | 199 bp |
β-actin | TCTGGCACCACACCTTCTAC GATAGCACAGCCTGGATAGC | 00000331789 | 169 bp |
HRPT1 | CTGAGGATTTGGAAAGGGTG AATCCAGCAGGTCAGCAAAG | 00000298556 | 156 bp |
β2M | CGCTACTCTCTCTTTCTGGC ATGTCGGATGGATGAAACCC | 00000558401 | 133 bp |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sterzyńska, K.; Klejewski, A.; Wojtowicz, K.; Świerczewska, M.; Nowacka, M.; Kaźmierczak, D.; Andrzejewska, M.; Rusek, D.; Brązert, M.; Brązert, J.; et al. Mutual Expression of ALDH1A1, LOX, and Collagens in Ovarian Cancer Cell Lines as Combined CSCs- and ECM-Related Models of Drug Resistance Development. Int. J. Mol. Sci. 2019, 20, 54. https://doi.org/10.3390/ijms20010054
Sterzyńska K, Klejewski A, Wojtowicz K, Świerczewska M, Nowacka M, Kaźmierczak D, Andrzejewska M, Rusek D, Brązert M, Brązert J, et al. Mutual Expression of ALDH1A1, LOX, and Collagens in Ovarian Cancer Cell Lines as Combined CSCs- and ECM-Related Models of Drug Resistance Development. International Journal of Molecular Sciences. 2019; 20(1):54. https://doi.org/10.3390/ijms20010054
Chicago/Turabian StyleSterzyńska, Karolina, Andrzej Klejewski, Karolina Wojtowicz, Monika Świerczewska, Marta Nowacka, Dominika Kaźmierczak, Małgorzata Andrzejewska, Damian Rusek, Maciej Brązert, Jacek Brązert, and et al. 2019. "Mutual Expression of ALDH1A1, LOX, and Collagens in Ovarian Cancer Cell Lines as Combined CSCs- and ECM-Related Models of Drug Resistance Development" International Journal of Molecular Sciences 20, no. 1: 54. https://doi.org/10.3390/ijms20010054