Regulation and Function of TMEM16F in Renal Podocytes
Abstract
:1. Introduction
2. Results
2.1. TMEM16F is Expressed in Podocytes of Human and Murine Glomeruli
2.2. Inducible Knockdown of TMEM16F in AB8 Human Podocytes
2.3. Knockdown of TMEM16F Did Not Affect Expression of Proteins Related to Cell Cycle or Cell Proliferation
2.4. Knockdown of TMEM16F Affects Cell Death in Tubular Epithelial Cells but not in Glomerular Podocytes
2.5. TMEM16F Does not Control Intracellular Ca2+ Signaling and Is not Responsible for Ca2+-Activated Whole-Cell Currents in Podocytes
2.6. Regulation of TMEM16F in Podocytes
2.7. Knockout of TMEM16F in Podocytes Does Not Compromise Renal Morphology and Renal Function
3. Discussion
4. Methods
4.1. Cell Culture and Generation of Inducible Cell Lines
4.2. Cell Lysates and Western Blotting
4.3. Immunofluorescence
4.4. MTT assay
4.5. Generation of Mice with LoxP-Flanked TMEM16F Gene
4.6. Flow Cytometry and LDH Release
4.7. Animal Phenotyping
4.8. TUNEL Assay
4.9. Calcium Measurements
4.10. Patch Clamping
Author Contributions
Funding
Conflicts of Interest
References
- Brunner, J.D.; Schenck, S.; Dutzler, R. Structural basis for phospholipid scrambling in the TMEM16 family. Curr. Opin. Struct. Biol. 2016, 39, 61–70. [Google Scholar] [CrossRef] [PubMed]
- Paulino, C.; Neldner, Y.; Lam, A.K.; Kalienkova, V.; Brunner, J.D.; Schenck, S.; Dutzler, R. Structural basis for anion conduction in the calcium-activated chloride channel TMEM16A. Elife 2017, 6, e26232. [Google Scholar] [CrossRef] [PubMed]
- Faria, D.; Schlatter, E.; Witzgall, R.; Grahammer, F.; Bandulik, S.; Schweda, F.; Bierer, S.; Rock, J.R.; Heitzmann, D.; Kunzelmann, K.; et al. The calcium activated chloride channel Anoctamin 1 contributes to the regulation of renal function. Kindey Int. 2014, 85, 1369–1381. [Google Scholar] [CrossRef] [PubMed]
- Schreiber, R.; Uliyakina, I.; Kongsuphol, P.; Warth, R.; Mirza, M.; Martins, J.R.; Kunzelmann, K. Expression and Function of Epithelial Anoctamins. J. Biol. Chem. 2010, 285, 7838–7845. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Scott, R.P.; Quaggin, S.E. Review series: The cell biology of renal filtration. J. Cell Biol. 2015, 209, 199–210. [Google Scholar] [CrossRef] [PubMed]
- Gloy, J.; Henger, A.; Fischer, K.G.; Nitschke, R.; Mundel, P.; Bleich, M.; Schollmeyer, P.; Greger, R.; Pavenstadt, H. Angiotensin II depolarizes podocytes in the intact glomerulus of the Rat. J. Clin. Investig. 1997, 99, 2772–2781. [Google Scholar] [CrossRef] [PubMed]
- Greka, A.; Mundel, P. Cell biology and pathology of podocytes. Annu. Rev. Physiol. 2012, 74, 299–323. [Google Scholar] [CrossRef] [PubMed]
- Remuzzi, G.; Perico, N.; Macia, M.; Ruggenenti, P. The role of renin-angiotensin-aldosterone system in the progression of chronic kidney disease. Kidney Int. Suppl. 2005, S57–S65. [Google Scholar] [CrossRef] [PubMed]
- Ruster, C.; Franke, S.; Wenzel, U.; Schmidthaupt, R.; Fraune, C.; Krebs, C.; Wolf, G. Podocytes of AT2 receptor knockout mice are protected from angiotensin II-mediated RAGE induction. Am. J. Nephrol. 2011, 34, 309–317. [Google Scholar] [CrossRef] [PubMed]
- Pedemonte, N.; Galietta, L.J. Structure and Function of TMEM16 Proteins (Anoctamins). Physiol. Rev. 2014, 94, 419–459. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Suzuki, J.; Umeda, M.; Sims, P.J.; Nagata, S. Calcium-dependent phospholipid scrambling by TMEM16F. Nature 2010, 468, 834–838. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ousingsawat, J.; Wanitchakool, P.; Kmit, A.; Romao, A.M.; Jantarajit, W.; Schreiber, S.; Kunzelmann, K. Anoctamin 6 mediates effects essential for innate immunity downstream of P2X7-receptors in macrophages. Nat. Commun. 2015, 6, 6245. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, J.; Denning, D.P.; Imanishi, E.; Horvitz, H.R.; Nagata, S. Xk-related protein 8 and CED-8 promote phosphatidylserine exposure in apoptotic cells. Science 2013, 341, 403–406. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Martins, J.R.; Faria, D.; Kongsuphol, P.; Reisch, B.; Schreiber, R.; Kunzelmann, K. Anoctamin 6 is an essential component of the outwardly rectifying chloride channel. Proc. Natl. Acad. Sci. USA 2011, 108, 18168–18172. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kmit, A.; van Kruchten, R.; Ousingsawat, J.; Mattheij, N.J.; Senden-Gijsbers, B.; Heemskerk, J.W.; Bevers, E.M.; Kunzelmann, K. Calcium-activated and apoptotic phospholipid scrambling induced by Ano6 can occur independently of Ano6 ion currents. Cell Death Dis. 2013, 25, e611. [Google Scholar] [CrossRef] [PubMed]
- Schreiber, R.; Ousingsawat, J.; Wanitchakool, P.; Sirianant, L.; Benedetto, R.; Reiss, K.; Kunzelmann, K. Regulation of TMEM16A/ANO1 and TMEM16F/ANO6 ion currents and phospholipid scrambling by Ca2+ and plasma membrane lipid. J. Physiol. 2018, 596, 217–229. [Google Scholar] [CrossRef] [PubMed]
- Forschbach, V.; Goppelt-Struebe, M.; Kunzelmann, K.; Schreiber, R.; Piedagnel, R.; Kraus, A.; Eckardt, K.U.; Buchholz, B. Anoctamin 6 is localized in the primary cilium of renal tubular cells and is involved in apoptosis-dependent cyst lumen formation. Cell Death Dis. 2015, 6, e1899. [Google Scholar] [CrossRef] [PubMed]
- Schenk, L.K.; Schulze, U.; Henke, S.; Weide, T.; Pavenstadt, H. TMEM16F Regulates Baseline Phosphatidylserine Exposure and Cell Viability in Human Embryonic Kidney Cells. Cell Physiol. Biochem. 2016, 38, 2452–2463. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Saleem, M.A.; O’Hare, M.J.; Reiser, J.; Coward, R.J.; Inward, C.D.; Farren, T.; Xing, C.Y.; Ni, L.; Mathieson, P.W.; Mundel, P. A conditionally immortalized human podocyte cell line demonstrating nephrin and podocin expression. J. Am. Soc. Nephrol. 2002, 13, 630–638. [Google Scholar] [PubMed]
- Kunzelmann, K. Ion channels in regulated cell death. Cell Mol. Life Sci. 2016, 73, 2387–2403. [Google Scholar] [CrossRef] [PubMed]
- Sirianant, L.; Ousingsawat, J.; Wanitchakool, P.; Schreiber, R.; Kunzelmann, K. Cellular Volume regulation by Anoctamin 6:Ca2+, phospholipase A2,osmosensing. Pflügers Arch. 2015, 468, 335–349. [Google Scholar] [CrossRef] [PubMed]
- Wanitchakool, P.; Ousingsawat, J.; Sirianant, L.; MacAulay, N.; Schreiber, R.; Kunzelmann, K. Cl- channels in apoptosis. Eur. Biophys. J. 2016, 45, 599–610. [Google Scholar] [CrossRef] [PubMed]
- Cabrita, I.; Benedetto, R.; Fonseca, A.; Wanitchakool, P.; Sirianant, L.; Skryabin, B.V.; Schenk, L.K.; Pavenstadt, H.; Schreiber, R.; Kunzelmann, K. Differential effects of anoctamins on intracellular calcium signals. FASEB J. 2017, 31, 2123–2134. [Google Scholar] [CrossRef] [PubMed]
- Kunzelmann, K.; Cabrita, I.; Wanitchakool, P.; Ousingsawat, J.; Sirianant, L.; Benedetto, R.; Schreiber, R. Modulating Ca2+ signals: A common theme for TMEM16, Ist2, and TMC. Pflügers Arch. 2016, 468, 475–490. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.; Kim, A.; David, T.; Palmer, D.; Jin, T.; Tien, J.; Huang, F.; Cheng, T.; Coughlin, S.R.; Jan, Y.N.; et al. TMEM16F Forms a Ca2+-Activated Cation Channel Required for Lipid Scrambling in Platelets during Blood Coagulation. Cell 2012, 151, 111–122. [Google Scholar] [CrossRef] [PubMed]
- Ousingsawat, J.; Wanitchakool, P.; Schreiber, R.; Wuelling, M.; Vortkamp, A.; Kunzelmann, K. Anoctamin 6 controls bone mineralization by activating the calcium transporter NCX1. J. Biol. Chem. 2015, 290, 6270–6280. [Google Scholar] [CrossRef] [PubMed]
- Simoes, F.; Ousingsawat, J.; Wanitchakool, P.; Fonseca, A.; Cabrita, I.; Benedetto, R.; Schreiber, R.; Kunzelmann, K. CFTR supports cell death through ROS-dependent activation of TMEM16F (anoctamin 6). Pflugers Arch. 2018, 470, 305–314. [Google Scholar] [CrossRef] [PubMed]
- Miner, K.; Mohn, D.; Elliot, R.; Powers, D.; Chen, J.; Liu, B.; Wang, P.; Gaida, K.; Hochheimer, A.; Liu, L.; et al. The Anthelminthic Niclosamide And Related Compounds Represent Potent Tmem16a Antagonists That Fully Relax Mouse And Human Airway Rings. Am. J. Respir. Crit. Care Med. 2017, 195, A7652. [Google Scholar] [CrossRef]
- Wennmann, D.O.; Vollenbroker, B.; Eckart, A.K.; Bonse, J.; Erdmann, F.; Wolters, D.A.; Schenk, L.K.; Schulze, U.; Kremerskothen, J.; Weide, T.; et al. The Hippo pathway is controlled by Angiotensin II signaling and its reactivation induces apoptosis in podocytes. Cell Death Dis. 2014, 5, e1519. [Google Scholar] [CrossRef] [PubMed]
- Kobayashi, A.; Valerius, M.T.; Mugford, J.W.; Carroll, T.J.; Self, M.; Oliver, G.; McMahon, A.P. Six2 defines and regulates a multipotent self-renewing nephron progenitor population throughout mammalian kidney development. Cell Stem Cell 2008, 3, 169–181. [Google Scholar] [CrossRef] [PubMed]
- Hsu, H.H.; Hoffmann, S.; Endlich, N.; Velic, A.; Schwab, A.; Weide, T.; Schlatter, E.; Pavenstadt, H. Mechanisms of angiotensin II signaling on cytoskeleton of podocytes. J. Mol. Med. 2008, 86, 1379–1394. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Baig, A.A.; Haining, E.J.; Geuss, E.; Beck, S.; Swieringa, F.; Wanitchakool, P.; Schuhmann, M.K.; Stegner, D.; Kunzelmann, K.; Kleinschnitz, C.; et al. TMEM16F-Mediated Platelet Membrane Phospholipid Scrambling Is Critical for Hemostasis and Thrombosis but not Thromboinflammation in Mice. Arterioscler. Thromb. Vasc. Biol. 2016, 36, 2152–2157. [Google Scholar] [CrossRef] [PubMed]
- Sommer, A.; Kordowski, F.; Buch, J.; Maretzky, T.; Evers, A.; Andra, J.; Dusterhoft, S.; Michalek, M.; Lorenzen, I.; Somasundaram, P.; et al. Phosphatidylserine exposure is required for ADAM17 sheddase function. Nat. Commun. 2016, 7, 11523. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mattheij, N.J.; Braun, A.; van Kruchten, R.; Castoldi, E.; Pircher, J.; Baaten, C.C.; Wulling, M.; Kuijpers, M.J.; Kohler, R.; Poole, A.W.; et al. Survival protein anoctamin-6 controls multiple platelet responses including phospholipid scrambling, swelling, and protein cleavage. FASEB J. 2015, 30, 727–737. [Google Scholar] [CrossRef] [PubMed]
- Ehlen, H.W.; Chinenkova, M.; Moser, M.; Munter, H.M.; Krause, Y.; Gross, S.; Brachvogel, B.; Wuelling, M.; Kornak, U.; Vortkamp, A. Inactivation of Anoctamin-6/Tmem16f, a regulator of phosphatidylserine scrambling in osteoblasts, leads to decreased mineral deposition in skeletal tissues. J. Bone Miner. Res. 2012, 28, 246–259. [Google Scholar] [CrossRef] [PubMed]
- Hu, Y.; Kim, J.H.; He, K.; Wan, Q.; Kim, J.; Flach, M.; Kirchhausen, T.; Vortkamp, A.; Winau, F. Scramblase TMEM16F terminates T cell receptor signaling to restrict T cell exhaustion. J. Exp. Med. 2016. [Google Scholar] [CrossRef] [PubMed]
- Vert, J.P.; Foveau, N.; Lajaunie, C.; Vandenbrouck, Y. An accurate and interpretable model for siRNA efficacy prediction. BMC Bioinform. 2006, 7, 520. [Google Scholar] [CrossRef] [PubMed]
- Mali, P.; Yang, L.; Esvelt, K.M.; Aach, J.; Guell, M.; DiCarlo, J.E.; Norville, J.E.; Church, G.M. RNA-guided human genome engineering via Cas9. Science 2013, 339, 823–826. [Google Scholar] [CrossRef] [PubMed]
- Thomas, K.R.; Capecchi, M.R. Site-directed mutagenesis by gene targeting in mouse embryo-derived stem cells. Cell 1987, 51, 503–512. [Google Scholar] [CrossRef]
- Wanitchakool, P.; Ousingsawat, J.; Sirianant, L.; Cabrita, I.; Faria, D.; Schreiber, R.; Kunzelmann, K. Cellular defects by deletion of ANO10 are due to deregulated local calcium signaling. Cell Signal. 2017, 30, 41–49. [Google Scholar] [CrossRef] [PubMed]
- Ousingsawat, J.; Cabrita, I.; Wanitchakool, P.; Sirianant, L.; Krautwald, S.; Linkermann, A.; Schreiber, R.; Kunzelmann, K. Ca2+ signals, cell membrane disintegration, and activation of TMEM16F during necroptosis. Cell. Mol. Life Sci. 2017, 74, 173–181. [Google Scholar] [CrossRef] [PubMed]
Genes | Oligonucleotides |
---|---|
TMEM16F_FlAd2 | GTCTCAAGCGTCTCTTGGAACGCGTATGTTCCCACAGAAGATGGATCATAACTTA |
TMEM16F_FLAr2 | GCTCTAGACGTCTCTGAGAGCGGCCGCTCACCACGGTGCAGCTTCATCCTA |
TMEM16F_FlBd1 | TGTCGACGCACCATGTTATTGGCACTAAGGA |
TMEM16F_FlBr1 | TGGATCCTTAGTGATTCTATAATAAGGGTGATGAT |
TMEM16F_ex7d2 | TGAATTCTTAAATGGCATGTCTGTCCCTTCTGG |
TMEM16F_ex7r2 | TACGCGTATAACTTCGTATAATGTATGCTATACGAAGTTATAAGCTTGTGTGACAGCTGCCCTGCACATAC |
TMEM16F_SoD1 | TTATAGAGCTGATGTCTTCACTTTGGC |
TMEM16F_SoR1 | AGAGTGGAGCTTTACTTTCTGACACA |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Schenk, L.K.; Ousingsawat, J.; Skryabin, B.V.; Schreiber, R.; Pavenstädt, H.; Kunzelmann, K. Regulation and Function of TMEM16F in Renal Podocytes. Int. J. Mol. Sci. 2018, 19, 1798. https://doi.org/10.3390/ijms19061798
Schenk LK, Ousingsawat J, Skryabin BV, Schreiber R, Pavenstädt H, Kunzelmann K. Regulation and Function of TMEM16F in Renal Podocytes. International Journal of Molecular Sciences. 2018; 19(6):1798. https://doi.org/10.3390/ijms19061798
Chicago/Turabian StyleSchenk, Laura K., Jiraporn Ousingsawat, Boris V. Skryabin, Rainer Schreiber, Hermann Pavenstädt, and Karl Kunzelmann. 2018. "Regulation and Function of TMEM16F in Renal Podocytes" International Journal of Molecular Sciences 19, no. 6: 1798. https://doi.org/10.3390/ijms19061798
APA StyleSchenk, L. K., Ousingsawat, J., Skryabin, B. V., Schreiber, R., Pavenstädt, H., & Kunzelmann, K. (2018). Regulation and Function of TMEM16F in Renal Podocytes. International Journal of Molecular Sciences, 19(6), 1798. https://doi.org/10.3390/ijms19061798