Baicalin Inhibits Haemophilus Parasuis-Induced High-Mobility Group Box 1 Release during Inflammation
Abstract
:1. Introduction
2. Results
2.1. H. Parasuis and Lipopolysaccharide (LPS) Infection-Triggered High-Mobility Group Box 1 (HMGB1) Release in the Piglet Peripheral Blood Monocytes
2.2. Baicalin Inhibited HMGB1 Release in Piglet Peripheral Blood Monocytes Induced by H. Parasuis
2.3. The Effect of LPS on HMGB1 Release in the Piglet Model
2.4. RNA-Seq Analysis of the Interaction between Host Cells and Bacteria
2.5. Analysis of the Association among DEGs of the Main Signaling Pathways Using STRING
2.6. Real-Time Polymerase Chain Reaction (PCR) Verification of DEGs
3. Discussion
4. Materials and Methods
4.1. Bacterial Strain, Growth Conditions, and Drug
4.2. Isolation and Culture of Piglet Peripheral Blood Monocytes
4.3. Western Blot Analysis of the Release of HMGB1
4.4. Total RNA Extraction and Real-Time Polymerase Chain Reaction (RT-PCR)
4.5. RNA-Seq Analysis
4.6. Validation by Real-Time Quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR)
4.7. Determining the Effect of Baicalin on the Release of HMGB1 Triggered by H. parasuis with Enzyme-Linked Immunosorbent Assay (ELISA)
4.8. Detection of the Effect of LPS on the Secretion of HMGB1 in the Piglet Model
4.9. Statistical Analysis
Supplementary Materials
Author Contributions
Acknowledgments
Conflicts of Interest
References
- Mathieu-Denoncourt, A.; Letendre, C.; Auger, J.P.; Segura, M.; Aragon, V.; Lacouture, S.; Gottschalk, M. Limited Interactions between Streptococcus suis and Haemophilus parasuis in In Vitro Co-Infection Studies. Pathogens 2018, 7. [Google Scholar] [CrossRef] [PubMed]
- Oliveira, S.; Pijoan, C. Haemophilus parasuis: New trends on diagnosis, epidemiology and control. Vet. Microbiol. 2004, 99, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Rapp-Gabrielson, V.J.; Kocur, G.J.; Clark, J.T.; Muir, S.K. Haemophilus parasuis: Immunity in swine after vaccination. Vet. Med. 1997, 92, 83–90. [Google Scholar]
- Rafiee, M.; Blackall, P.J. Establishment, validation and use of the Kielstein-Rapp-Gabrielson serotyping scheme for Haemophilus parasuis. Aust. Vet. J. 2000, 78, 172–174. [Google Scholar] [CrossRef] [PubMed]
- Cai, X.; Chen, H.; Blackall, P.J.; Yin, Z.; Wang, L.; Liu, Z.; Jin, M. Serological characterization of Haemophilus parasuis isolates from China. Vet. Microbiol. 2005, 111, 231–236. [Google Scholar] [CrossRef] [PubMed]
- Jia, A.; Zhou, R.; Fan, H.; Yang, K.; Zhang, J.; Xu, Y.; Wang, G.; Liao, M. Development of Serotype-Specific PCR Assays for Typing of Haemophilus parasuis Isolates Circulating in Southern China. J. Clin. Microbiol. 2017, 55, 3249–3257. [Google Scholar] [CrossRef] [PubMed]
- Rosner, H.; Kielstein, P.; Müller, W.; Rohrmann, B. Relationship between serotype, virulence and SDS-PAGE protein patterns of Haemophilus parasuis. Dtsch. Tierarztl. Wochenschr. 1991, 98, 327–330. [Google Scholar] [PubMed]
- Rapp-Gabrielson, V.J.; Gabrielson, D.A.; Schamber, G.J. Comparative virulence of Haemophilus parasuis serovars 1 to 7 in guinea pigs. Am. J. Vet. Res. 1992, 53, 987–994. [Google Scholar] [PubMed]
- Amano, H.; Shibata, M.; Kajio, N.; Morozumi, T. Pathogenicity of Haemophilus parasuis serovars 4 and 5 in contact-exposed pigs. J. Vet. Med. Sci. 1996, 58, 559–561. [Google Scholar] [CrossRef] [PubMed]
- Bouchet, B.; Vanier, G.; Jacques, M.; Gottschalk, M. Interactions of Haemophilus parasuis and its LOS with porcine brain microvascular endothelial cells. Vet. Res. 2008, 39, 42. [Google Scholar] [CrossRef] [PubMed]
- Xu, C.; Zhang, L.; Zhang, B.; Feng, S.; Zhou, S.; Li, J.; Zou, Y.; Liao, M. Involvement of lipooligosaccharide heptose residues of Haemophilus parasuis SC096 strain in serum resistance, adhesion and invasion. Vet. J. 2013, 195, 200–204. [Google Scholar] [CrossRef] [PubMed]
- Zhang, B.; He, Y.; Xu, C.; Xu, L.; Feng, S.; Liao, M.; Ren, T. Cytolethal distending toxin (CDT) of the Haemophilus parasuis SC096 strain contributes to serum resistance and adherence to and invasion of PK-15 and PUVEC cells. Vet. Microbiol. 2012, 157, 237–242. [Google Scholar] [CrossRef] [PubMed]
- Zhang, B.; Yu, Y.; Zeng, Z.; Ren, Y.; Yue, H. Deletion of the rfaE gene in Haemophilus parasuis SC096 strain attenuates serum resistance, adhesion and invasion. Microb. Pathog. 2014, 74, 33–37. [Google Scholar] [CrossRef] [PubMed]
- Zhao, L.; Gao, X.; Liu, C.; Lv, X.; Jiang, N.; Zheng, S. Deletion of the vacJ gene affects the biology and virulence in Haemophilus parasuis serovar 5. Gene 2017, 603, 42–53. [Google Scholar] [CrossRef] [PubMed]
- Ding, L.; Wen, X.; He, L.; Yan, X.; Wen, Y.; Cao, S.; Huang, X.; Wu, R.; Wen, Y. The arcA gene contributes to the serum resistance and virulence of Haemophilus parasuis serovar 13 clinical strain EP3. Vet. Microbiol. 2016, 196, 67–71. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Li, Y.; Wen, Y.; Lau, G.W.; Huang, X.; Wu, R.; Yan, Q.; Huang, Y.; Zhao, Q.; Ma, X. HtrA Is Important for Stress Resistance and Virulence in Haemophilus parasuis. Infect. Immun. 2016, 84, 2209–2219. [Google Scholar] [CrossRef] [PubMed]
- Twigg, H.L., 3rd. Macrophages in innate and acquired immunity. Semin. Respir. Crit. Care Med. 2004, 25, 21–31. [Google Scholar] [CrossRef] [PubMed]
- Rocha-Ramírez, L.M.; Pérez-Solano, R.A.; Castañón-Alonso, S.L.; Moreno Guerrero, S.S.; Ramírez Pacheco, A.; García Garibay, M.; Eslava, C. Probiotic Lactobacillus Strains Stimulate the Inflammatory Response and Activate Human Macrophages. J. Immunol. Res. 2017, 2017, 4607491. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.; Wang, H.; Czura, C.J.; Tracey, K.J. HMGB1 as a cytokine and therapeutic target. J. Endotoxin. Res. 2002, 8, 469–472. [Google Scholar] [CrossRef] [PubMed]
- Fiuza, C.; Bustin, M.; Talwar, S.; Tropea, M.; Gerstenberger, E.; Shelhamer, J.H.; Suffredini, A.F. Inflammation-promoting activity of HMGB1 on human microvascular endothelial cells. Blood 2003, 101, 2652–2660. [Google Scholar] [CrossRef] [PubMed]
- Lv, Y.; Li, Y.; Zhang, D.; Zhang, A.; Guo, W.; Zhu, S. HMGB1-induced asthmatic airway inflammation through GRP75-mediated enhancement of ER-mitochondrial Ca2+ transfer and ROS increased. J. Cell. Biochem. 2018. [Google Scholar] [CrossRef] [PubMed]
- Kida, T.; Seno, T.; Nagahara, H.; Inoue, T.; Nakabayashi, A.; Kukida, Y.; Fujioka, K.; Fujii, W.; Wada, M.; Kohno, M.; et al. Roles of high-mobility group box 1 and thrombin in murine pulmonary fibrosis and the therapeutic potential of thrombomodulin. Am. J. Physiol. Lung Cell. Mol. Physiol. 2017. [Google Scholar] [CrossRef] [PubMed]
- Kigerl, K.A.; Lai, W.; Wallace, L.M.; Yang, H.; Popovich, P.G. High mobility group box-1 (HMGB1) is increased in injured mouse spinal cord and can elicit neurotoxic inflammation. Brain Behav. Immun. 2017. [Google Scholar] [CrossRef] [PubMed]
- Feghali, K.; Iwasaki, K.; Tanaka, K.; Komaki, M.; Machigashira, M.; Ishikawa, I.; Izumi, Y. Human gingival fibroblasts release high-mobility group box-1 protein through active and passive pathways. Oral Microbiol. Immunol. 2009, 24, 292–298. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Zhang, R.; Chen, J.; Shi, M.; Li, W.; Zhang, X. High Mobility Group Box1 Inhibitor Glycyrrhizic Acid Attenuates Kidney Injury in Streptozotocin-Induced Diabetic Rats. Kidney Blood Press. Res. 2017, 42, 894–904. [Google Scholar] [CrossRef] [PubMed]
- Relja, B.; Wagner, N.; Franz, N.; Dieteren, S.; Mörs, K.; Schmidt, J.; Marzi, I.; Perl, M. Ethyl pyruvate reduces acute lung damage following trauma and hemorrhagic shock via inhibition of NF-κB and HMGB1. Immunobiology 2018, 223, 310–318. [Google Scholar] [CrossRef] [PubMed]
- Chung, C.P.; Park, J.B.; Bae, K.H. Pharmacological effects of methanolic extract from the root of Scutellaria baicalensis and its flavonoids on human gingival fibroblast. Planta Med. 1995, 61, 150–153. [Google Scholar] [CrossRef] [PubMed]
- Xiang, H.; Zhang, Q.; Qi, B.; Tao, X.; Xia, S.; Song, H.; Qu, J.; Shang, D. Chinese Herbal Medicines Attenuate Acute Pancreatitis: Pharmacological Activities and Mechanisms. Front. Pharmacol. 2017, 8, 216. [Google Scholar] [CrossRef] [PubMed]
- Luo, J.; Dong, B.; Wang, K.; Cai, S.; Liu, T.; Cheng, X.; Chen, Y.; Li, Y.; Kong, J.; Chen, Y. Baicalin inhibits biofilm formation, attenuates the quorum sensing-controlled virulence and enhances Pseudomonas aeruginosa clearance in a mouse peritoneal implant infection model. PLoS ONE 2017, 12, e0176883. [Google Scholar] [CrossRef] [PubMed]
- Qiu, J.; Niu, X.; Dong, J.; Wang, D.; Wang, J.; Li, H.; Luo, M.; Li, S.; Feng, H.; Deng, X. Baicalin protects mice from Staphylococcus aureus pneumonia via inhibition of the cytolytic activity of α-hemolysin. J. Infect. Dis. 2012, 206, 292–301. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Liu, B.; Luo, Z.Q.; Qiu, J.; Zhou, X.; Li, G.; Zhang, B.; Deng, X.; Yang, Z.; Wang, J. The combination of osthole with baicalin protects mice from Staphylococcus aureus pneumonia. World J. Microbiol. Biotechnol. 2017, 33, 11. [Google Scholar] [CrossRef] [PubMed]
- Zhu, J.; Wang, J.; Sheng, Y.; Zou, Y.; Bo, L.; Wang, F.; Lou, J.; Fan, X.; Bao, R.; Wu, Y.; et al. Baicalin improves survival in a murine model of polymicrobial sepsis via suppressing inflammatory response and lymphocyte apoptosis. PLoS ONE 2012, 7, e35523. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.; Zhang, Q.; Gao, Z.; Yu, C.; Zhang, L. Baicalin alleviates IL-1β-induced inflammatory injury via down-regulating miR-126 in chondrocytes. Biomed. Pharmacother. 2018, 99, 184–190. [Google Scholar] [CrossRef] [PubMed]
- Zhou, T.; Zhang, A.; Kuang, G.; Gong, X.; Jiang, R.; Lin, D.; Li, J.; Li, H.; Zhang, X.; Wan, J.; et al. Baicalin inhibits the metastasis of highly aggressive breast cancer cells by reversing epithelial-to-mesenchymal transition by targeting β-catenin signaling. Oncol. Rep. 2017, 38, 3599–3607. [Google Scholar] [CrossRef] [PubMed]
- Fu, S.; Xu, L.; Li, S.; Qiu, Y.; Liu, Y.; Wu, Z.; Ye, C.; Hou, Y.; Hu, C.A. Baicalin suppresses NLRP3 inflammasome and nuclear factor-kappa B (NF-κB) signaling during Haemophilus parasuis infection. Vet. Res. 2016, 47, 80. [Google Scholar] [CrossRef] [PubMed]
- Ye, C.; Li, S.; Yao, W.; Xu, L.; Qiu, Y.; Liu, Y.; Wu, Z.; Hou, Y. The anti-inflammatory effects of baicalin through suppression of NLRP3 inflammasome pathway in LPS-challenged piglet mononuclear phagocytes. Innate Immun. 2016, 22, 196–204. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Li, R.; Liu, T.; Rausch-Fan, X.; Wang, M. High Mobility Group Box 1 Protein Level as a Novel Biomarker for the Development of Peri-Implant Disease. Sci. Rep. 2017, 7, 7027. [Google Scholar] [CrossRef] [PubMed]
- Fu, S.; Wang, J.; Hu, X.; Zhou, R.R.; Fu, Y.; Tang, D.; Kang, R.; Huang, Y.; Sun, L.; Li, N.; Fan, X.G. Crosstalk between hepatitis B virus X and high-mobility group box 1 facilitates autophagy in hepatocytes. Mol. Oncol. 2018. [Google Scholar] [CrossRef] [PubMed]
- Manti, S.; Harford, T.J.; Salpietro, C.; Rezaee, F.; Piedimonte, G. Induction of high mobility group box-1 in vitro and in vivo by respiratory syncytial virus. Pediatr. Res. 2018. [Google Scholar] [CrossRef] [PubMed]
- Li, B.; Yu, Y.; Zhang, Y.; Liu, J.; Li, H.; Dang, H.; Guo, S.; Wang, L.; Wu, H.; Wang, Z.; Wang, Y. Vertical and Horizontal Convergences of Targeting Pathways in Combination Therapy with Baicalin and Jasminoidin for Cerebral Ischemia. CNS. Neurol. Disord. Drug Targets 2016, 15, 740–750. [Google Scholar] [CrossRef] [PubMed]
- Oo, A.; Rausalu, K.; Merits, A.; Higgs, S.; Vanlandingham, D.; Bakar, S.A.; Zandi, K. Deciphering the potential of baicalin as an antiviral agent for Chikungunya virus infection. Antivir. Res. 2018, 150, 101–111. [Google Scholar] [CrossRef] [PubMed]
- Yang, W.; Li, H.; Cong, X.; Wang, X.; Jiang, Z.; Zhang, Q.; Qi, X.; Gao, S.; Cao, R.; Tian, W. Baicalin attenuates lipopolysaccharide induced inflammation and apoptosis of cow mammary epithelial cells by regulating NF-κB and HSP72. Int. Immunopharmacol. 2016, 40, 139–145. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Zhang, R.; Wang, J.; Yu, P.; Liu, Q.; Zeng, D.; Song, H.; Kuang, Z. Protective effects of baicalin on LPS-induced injury in intestinal epithelial cells and intercellular tight junctions. Can. J. Physiol. Pharmacol. 2015, 93, 233–237. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.; Becker, J.; Bechheim, M.; Kaiser, V.; Noursadeghi, M.; Fricker, N.; Beier, E.; Klaschik, S.; Boor, P.; Hess, T.; Hofmann, A.; et al. Characterizing the genetic basis of innate immune response in TLR4-activated human monocytes. Nat. Commun. 2014, 5, 5236. [Google Scholar] [CrossRef] [PubMed]
- Fairfax, B.P.; Humburg, P.; Makino, S.; Naranbhai, V.; Wong, D.; Lau, E.; Jostins, L.; Plant, K.; Andrews, R.; McGee, C.; et al. Innate immune activity conditions the effect of regulatory variants upon monocyte gene expression. Science 2014, 343, 1246949. [Google Scholar] [CrossRef] [PubMed]
- Lachmann, G.; von Haefen, C.; Kurth, J.; Yuerek, F.; Spies, C. Innate immunity recovers earlier than acquired immunity during severe postoperative immunosuppression. Int. J. Med. Sci. 2018, 15, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Vitale, S.; Strisciuglio, C.; Pisapia, L.; Miele, E.; Barba, P.; Vitale, A.; Cenni, S.; Bassi, V.; Maglio, M.; Del Pozzo, G.; et al. Cytokine production profile in intestinal mucosa of paediatric inflammatory bowel disease. PLoS ONE 2017, 12, e0182313. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; Bian, H.; Li, F.; Li, X.; Zhang, D.; Sun, S.; Song, S.; Zhu, Q.; Ren, W.; Qin, C.; et al. HBeAg induces the expression of macrophage miR-155 to accelerate liver injury via promoting production of inflammatory cytokines. Cell. Mol. Life Sci. 2018. [Google Scholar] [CrossRef] [PubMed]
- Sugita, A.; Kinoshita, K.; Sakurai, A.; Chiba, N.; Yamaguchi, J.; Kuwana, T.; Sawada, N.; Hori, S. Systemic impact on secondary brain aggravation due to ischemia/reperfusion injury in post-cardiac arrest syndrome: A prospective observational study using high-mobility group box 1 protein. Crit. Care 2017, 21, 247. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Bao, G.; Chen, W.; Qiang, X.; Zhu, S.; Wang, S.; He, M.; Ma, G.; Ochani, M.; Al-Abed, Y.; et al. Connexin 43 Hemichannel as a Novel Mediator of Sterile and Infectious Inflammatory Diseases. Sci. Rep. 2018, 8, 166. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.; Dong, Z.; Yang, P.; Wang, X.; Jin, G.; Yu, H.; Chen, L.; Li, L.; Tang, L.; Bai, S.; et al. Hepatitis B virus X protein stimulates high mobility group box 1 secretion and enhances hepatocellular carcinoma metastasis. Cancer Lett. 2017, 394, 22–32. [Google Scholar] [CrossRef] [PubMed]
- Johansson, L.; Snäll, J.; Sendi, P.; Linnér, A.; Thulin, P.; Linder, A.; Treutiger, C.J.; Norrby-Teglund, A. HMGB1 in severe soft tissue infections caused by Streptococcus pyogenes. Front. Cell. Infect. Microbiol. 2014, 4, 4. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sheller-Miller, S.; Urrabaz-Garza, R.; Saade, G.; Menon, R. Damage-Associated molecular pattern markers HMGB1 and cell-Free fetal telomere fragments in oxidative-Stressed amnion epithelial cell-Derived exosomes. J. Reprod. Immunol. 2017, 123, 3–11. [Google Scholar] [CrossRef] [PubMed]
- Zaghloul, N.; Addorisio, M.E.; Silverman, H.A.; Patel, H.L.; Valdés-Ferrer, S.I.; Ayasolla, K.R.; Lehner, K.R.; Olofsson, P.S.; Nasim, M.; Metz, C.N.; Wang, P.; et al. Forebrain Cholinergic Dysfunction and Systemic and Brain Inflammation in Murine Sepsis Survivors. Front. Immunol. 2017, 8, 1673. [Google Scholar] [CrossRef] [PubMed]
- Fonceca, A.M.; Zosky, G.R.; Bozanich, E.M.; Sutanto, E.N.; Kicic, A.; McNamara, P.S.; Knight, D.A.; Sly, P.D.; Turner, D.J.; Stick, S.M. Accumulation mode particles and LPS exposure induce TLR-4 dependent and independent inflammatory responses in the lung. Respir. Res. 2018, 19, 15. [Google Scholar] [CrossRef] [PubMed]
- Sieve, I.; Ricke-Hoch, M.; Kasten, M.; Battmer, K.; Stapel, B.; Falk, C.S.; Leisegang, M.S.; Haverich, A.; Scherr, M.; Hilfiker-Kleiner, D. A positive feedback loop between IL-1β, LPS and NEU1 may promote atherosclerosis by enhancing a pro-inflammatory state in monocytes and macrophages. Vasc. Pharmacol. 2018. [Google Scholar] [CrossRef] [PubMed]
- Meng, L.; Li, L.; Lu, S.; Li, K.; Su, Z.; Wang, Y.; Fan, X.; Li, X.; Zhao, G. The protective effect of dexmedetomidine on LPS-induced acute lung injury through the HMGB1-mediated TLR4/NF-κB and PI3K/Akt/mTOR pathways. Mol. Immunol. 2018, 94, 7–17. [Google Scholar] [CrossRef] [PubMed]
- Chaochao, Q.; Lou, G.; Yang, Y.; Liu, Y.; Hu, Y.; Min, Z.; Chen, P.; He, J.; Chen, Z. Macrophage Inflammatory Protein-2 in High Mobility Group Box 1 Secretion of Macrophage Cells Exposed to Lipopolysaccharide. Cell. Physiol. Biochem. 2017, 42, 913–928. [Google Scholar] [CrossRef] [PubMed]
- Saïdi, H.; Bras, M.; Formaglio, P.; Melki, M.T.; Charbit, B.; Herbeuval, J.P.; Gougeon, M.L. HMGB1 Is Involved in IFN-α Production and TRAIL Expression by HIV-1-Exposed Plasmacytoid Dendritic Cells: Impact of the Crosstalk with NK Cells. PLoS Pathog. 2016, 12, e1005407. [Google Scholar] [CrossRef] [PubMed]
- Andersson, U.; Wang, H.; Palmblad, K.; Aveberger, A.C.; Bloom, O.; Erlandsson-Harris, H.; Janson, A.; Kokkola, R.; Zhang, M.; Yang, H.; et al. High mobility group 1 protein (HMG-1) stimulates proinflammatory cytokine synthesis in human monocytes. J. Exp. Med. 2000, 192, 565–570. [Google Scholar] [CrossRef] [PubMed]
- Cheng, L.S.; Li, J.; Liu, Y.; Wang, F.P.; Wang, S.Q.; She, W.M.; Wu, S.D.; Qi, X.L.; Zhou, Y.P.; Jiang, W. HMGB1-induced autophagy: A new pathway to maintain Treg function during chronic hepatitis B virus infection. Clin. Sci. (Lond.) 2017, 131, 381–394. [Google Scholar] [CrossRef] [PubMed]
- Cheng, Y.; Xiong, J.; Chen, Q.; Xia, J.; Zhang, Y.; Yang, X.; Tao, K.; Zhang, S.; He, S. Hypoxia/reoxygenation-induced HMGB1 translocation and release promotes islet proinflammatory cytokine production and early islet graft failure through TLRs signaling. Biochim. Biophys. Acta 2017, 1863, 354–364. [Google Scholar] [CrossRef] [PubMed]
- Cheng, X.; Yang, Y.L.; Yang, H.; Wang, Y.H.; Du, G.H. Kaempferol alleviates LPS-induced neuroinflammation and BBB dysfunction in mice via inhibiting HMGB1 release and down-regulating TLR4/MyD88 pathway. Int. Immunopharmacol. 2018, 56, 29–35. [Google Scholar] [CrossRef] [PubMed]
Samples_ID | All Reads | Mapped Reads | Mapped Pair Reads | Mapped Broken-Pair Reads | Mapped Unique Reads | Mapped Multi Reads | Mapping Ratio |
---|---|---|---|---|---|---|---|
H1 | 55,854,342 | 44,980,513 | 40,035,218 | 4,945,295 | 43,121,932 | 1,858,581 | 80.53% |
H2 | 54,986,838 | 44,145,405 | 39,108,774 | 5,036,631 | 42,172,615 | 1,972,790 | 80.28% |
H3 | 50,658,012 | 40,793,438 | 36,277,250 | 4,516,188 | 39,182,384 | 1,611,054 | 80.53% |
K1 | 61,627,718 | 49,131,998 | 43,393,550 | 5,738,448 | 46,888,148 | 2,243,850 | 79.72% |
K2 | 55,917,120 | 44,938,810 | 39,598,978 | 5,339,832 | 42,736,227 | 2,202,583 | 80.37% |
K3 | 54,216,750 | 43,563,887 | 38,251,636 | 5,312,251 | 41,401,511 | 2,162,376 | 80.35% |
Gene | Nucleotide Sequence (5′–3′) | |
---|---|---|
β-actin | Forward | TGCGGGACATCAAGGAGAAG |
Reverse | AGTTGAAGGTGGTCTCGTGG | |
CCR2 | Forward | ATGCCCAGTTTTCTACGGGG |
Reverse | CCGGGCACTTGCTTTAGAGA | |
CD14 | Forward | CACTGCCTAGTGCCAAGGAT |
Reverse | CCCACGTTCGCTACACTTCT | |
Myd88 | Forward | CATCCCTTGGATGTCAGGCA |
Reverse | AAACTGGATATCGCTGGGGC | |
TLR6 | Forward | TGTTGACCACAGGGAGGGTA |
Reverse | TGGATCCACATTGCATGGCT | |
CYCS | Forward | CCTCCATGGTCTCTTTGGGC |
Reverse | GGCGGTGGCCAACTTTTACT | |
CTSK | Forward | GCCATTGATGCAAGCCTGAC |
Reverse | ATAGCCTTTGTTGCCCCAGT | |
CXCL9 | Forward | AACAGCCCGTGTCAACATGA |
Reverse | GTGGAAAGGTGTGGAATGCG | |
STAT3 | Forward | CCCCGTGTCTAATAGGGGAG |
Reverse | ATCCAAGGGGCCAGAAACTG | |
IGF-1 | Forward | TGTACTGTGCACCCCTCAAG |
Reverse | AACTCGTGCAGAGCAAAGGAT | |
CCL4 | Forward | CTTCACATACACCGTGCGGA |
Reverse | AGACCTGCCTGCCCTTTTTG |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fu, S.; Liu, H.; Chen, X.; Qiu, Y.; Ye, C.; Liu, Y.; Wu, Z.; Guo, L.; Hou, Y.; Hu, C.-A.A. Baicalin Inhibits Haemophilus Parasuis-Induced High-Mobility Group Box 1 Release during Inflammation. Int. J. Mol. Sci. 2018, 19, 1307. https://doi.org/10.3390/ijms19051307
Fu S, Liu H, Chen X, Qiu Y, Ye C, Liu Y, Wu Z, Guo L, Hou Y, Hu C-AA. Baicalin Inhibits Haemophilus Parasuis-Induced High-Mobility Group Box 1 Release during Inflammation. International Journal of Molecular Sciences. 2018; 19(5):1307. https://doi.org/10.3390/ijms19051307
Chicago/Turabian StyleFu, Shulin, Huashan Liu, Xiao Chen, Yinsheng Qiu, Chun Ye, Yu Liu, Zhongyuan Wu, Ling Guo, Yongqing Hou, and Chien-An Andy Hu. 2018. "Baicalin Inhibits Haemophilus Parasuis-Induced High-Mobility Group Box 1 Release during Inflammation" International Journal of Molecular Sciences 19, no. 5: 1307. https://doi.org/10.3390/ijms19051307