Next Article in Journal
Insulin-Like Growth Factor (IGF) System in Liver Diseases
Previous Article in Journal
Positive and Negative Regulation of Angiogenesis by Soluble Vascular Endothelial Growth Factor Receptor-1
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Baicalin Inhibits Haemophilus Parasuis-Induced High-Mobility Group Box 1 Release during Inflammation

1
Hubei Key Laboratory of Animal Nutrition and Feed Science, Wuhan Polytechnic University, Wuhan 430023, China
2
Hubei Collaborative Innovation Center for Animal Nutrition and Feed Safety, Wuhan 430023, China
3
Biochemistry and Molecular Biology, University of New Mexico School of Medicine, Albuquerque, NM 87131, USA
*
Author to whom correspondence should be addressed.
These authors contributed equally to the work.
Int. J. Mol. Sci. 2018, 19(5), 1307; https://doi.org/10.3390/ijms19051307
Submission received: 24 February 2018 / Revised: 4 April 2018 / Accepted: 24 April 2018 / Published: 27 April 2018
(This article belongs to the Section Biochemistry)

Abstract

Haemophilus parasuis (H. parasuis) can cause Glässer’s disease in pigs. However, the molecular mechanism of the inflammation response induced by H. parasuis remains unclear. The high-mobility group box 1 (HMGB1) protein is related to the pathogenesis of various infectious pathogens, but little is known about whether H. parasuis can induce the release of HMGB1 in piglet peripheral blood monocytes. Baicalin displays important anti-inflammatory and anti-microbial activities. In the present study, we investigated whether H. parasuis can trigger the secretion of HMGB1 in piglet peripheral blood monocytes and the anti-inflammatory effect of baicalin on the production of HMGB1 in peripheral blood monocytes induced by H. parasuis during the inflammation response. In addition, host cell responses stimulated by H. parasuis were determined with RNA-Seq. The RNA-Seq results showed that H. parasuis infection provokes the expression of cytokines and the activation of numerous pathways. In addition, baicalin significantly reduced the release of HMGB1 in peripheral blood monocytes induced by H. parasuis. Taken together, our study showed that H. parasuis can induce the release of HMGB1 and baicalin can inhibit HMGB1 secretion in an H. parasuis-induced peripheral blood monocytes model, which may provide a new strategy for preventing the inflammatory disorders induced by H. parasuis.

Graphical Abstract

1. Introduction

Haemophilus parasuis (H. parasuis), the causative agent of Glässer’s disease in pigs, is a Gram-negative bacterium that colonizes the upper respiratory tract of pigs [1]. The disease is characterized by fibrinous polyserositis, polyarthritis and meningitis [2]. H. parasuis can cause high morbidity and mortality, resulting in huge economic losses for the pig industry [3]. In recent years, it has become one of the most important bacterial respiratory pathogens, and has received increasing attention from pig producers. So far, 15 serovars of H. parasuis have been identified, but up to 20% of isolates cannot be serotyped according to the Kielstein–Rapp–Gabrielson serotyping scheme [4]. Serovars 4, 5 and 13 are the most prevalent serotypes in China [5,6]. In general, H. parasuis serovars are considered to be important markers of bacterial virulence [7,8]. Serovar 5 is highly virulent and serovar 4 is considered to be moderately virulent [9]. Because of the large number of H. parasuis serovars and uncertainty in the identification of some of them, preventing and controlling infection by H. parasuis has become a challenge.
Currently, the pathogenesis of H. parasuis infection remains unclear, especially the pathways causing the systemic inflammatory response and vascular injury. However, some virulence-related factors have been demonstrated to play important roles in the pathogenesis of the disease. H. parasuis lipooligosaccharides (LOS) can mediate the adhesion of H. parasuis to porcine brain microvascular endothelial cells (PBMEC) and are able to induce the release of IL-8 and IL-6 by PBMEC [10]. The contribution of the inner core oligosaccharide of LOS, cytolethal distending toxin (CDT) and the rfaE gene are associated with serum resistance and has the ability to adhere to and invade porcine kidney epithelial cells (PK-15) and porcine umbilical vein endothelial cells (PUVEC) [11,12,13]. The vacJ gene plays an essential role in maintaining biofilm formation, serum resistance, and adherence to and invasion of PK-15 cells [14]. Deletion of the arcA gene resulted in less biofilm mass being produced and reduced H. parasuis EP3 strain virulence in mice [15]. Disruption of the htrA gene affected resistance to complement-mediated killing and significantly attenuated virulence of H. parasuis in the murine model of infection [16]. Despite the numerous virulence-related factors that have currently been discovered, the pathogenesis of inflammation caused by H. parasuis still needs to be resolved.
The inflammatory immune response and inflammation injury play important roles in the pathogenesis of Glässer’s disease. Macrophages have important regulatory effects on the inflammatory response [17]. Activation of the inflammation-associated signaling pathway can induce the production of inflammatory cytokines such as IL-6 and IL-8 [18]. High-mobility group box 1 (HMGB1), which is a nuclear protein and is identified as a cytokine, is ubiquitously expressed in many mammalian cells and participates in diverse important intracellular and extracellular functions [19,20]. Previous research has shown that exposure of human bronchial epithelial cells to HMGB1 leads to pro-inflammatory cytokine secretion, enhanced ER-mitochondrial Ca2+ transfer and reactive oxygen species (ROS) production [21]. HMGB1 is involved in the pathophysiology of pulmonary fibrosis by causing the release of pro-fibrotic proteins [22]. HMGB1 production is increased in injured mouse spinal cords and can induce neurotoxic inflammation [23]. In addition, lipopolysaccharide (LPS) from Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis, and Escherichia coli significantly induced HMGB1 secretion from human gingival fibroblasts, which may contribute to periodontal tissue destruction [24]. It has been documented that the HMGB1 inhibitor glycyrrhizic acid can mediate renal injury and inflammatory responses in diabetic rats by regulating the activation of the RAGE/TLR4-related ERK and p38 MAPK/NF-κB signaling pathways [25]. Ethyl pyruvate can suppress acute lung damage through inhibition of NF-κB and HMGB1 following trauma and hemorrhagic shock [26]. Thus, we speculate that HMGB1 may be useful as a valid therapeutic target for controlling H. parasuis infection.
Baicalin is the principal component of the flavonoid derivatives in the roots of Scutellaria baicalensis Georgi [27]. It has been reported that baicalin has important anti-inflammatory, anti-microbial, and anti-oxidant activities [28]. Baicalin can inhibit biofilm formation, suppress quorum sensing-controlled virulence, and enhance Pseudomonas aeruginosa clearance in a mouse peritoneal implant infection model [29]. Baicalin reduced A549 cell injury induced by Staphylococcus aureus and protected mice from S. aureus pneumonia [30,31]. Baicalin improves the survival of mice with polymicrobial sepsis by suppressing the inflammatory response and lymphocyte apoptosis [32]. Baicalin canprotect CHON-001 cells from IL-1β-induced inflammatory injury through miR-126 downregulation [33]. Baicalin also effectively suppresses the breast cancer metastasis by reversing the epithelial-to-mesenchymal transition [34]. Thus, we speculate that baicalin may be utilized as a novel drug to control the inflammation response or injury evoked by H. parasuis.
Our previous research has shown that baicalin can suppress the inflammation response through the NLRP3 inflammasome pathway in LPS-challenged piglet mononuclear phagocytes and the NF-κB and NLRP3 inflammasome pathway in H. parasuis-induced piglet mononuclear phagocytes [35,36]. In the present study, we determined the pattern of secretion of HMGB1 in piglet mononuclear phagocytes triggered by LPS and H. parasuis. Signaling pathways related to HMGB1 in piglet mononuclear phagocytes infected by H. parasuis were also explored by RNA-Seq. In addition, we investigated the effect of baicalin on the secretion of inflammatory cytokines and HMGB1 from piglet mononuclear phagocytes. Our results suggest that baicalin can significantly inhibit the release of HMGB1 in piglet mononuclear phagocytes, which may provide a novel strategy for preventing the inflammation response or injury induced by H. parasuis.

2. Results

2.1. H. Parasuis and Lipopolysaccharide (LPS) Infection-Triggered High-Mobility Group Box 1 (HMGB1) Release in the Piglet Peripheral Blood Monocytes

To explore the pattern of production of HMGB1 promoted by H. parasuis and LPS in detail, the piglet peripheral blood monocytes were infected with H. parasuis or LPS for 12 h to 48 h. The results showed that H. parasuis could stimulate the production of HMGB1 in the piglet peripheral blood monocytes for 12 h to 48 h compared with the control cells, and the amount of HMGB1 released reached a peak at 24 h before falling at 36 h to 48 h (Figure 1A) (p < 0.05). In addition, LPS also could induce HMGB1 secretion at 12, 36, and 48 h (Figure 1A) (p < 0.05). Western blot analysis further confirmed the expression of HMGB1 in the cell supernatants when induced at 36 to 48 h (Figure 1B) (p < 0.05).

2.2. Baicalin Inhibited HMGB1 Release in Piglet Peripheral Blood Monocytes Induced by H. Parasuis

After the piglet peripheral blood monocytes were pretreated with 12.5–100 μg/mL baicalin and infected with H. parasuis for 24 to 48 h, HMGB1 secretion was measured. These data demonstrated that H. parasuis could significantly promote the release of HMGB1 in the piglet peripheral blood monocytes compared with the control cells (Figure 2) (p < 0.01). Surprisingly, N-acetyl-l-cysteine (NAC) could not trigger the production of HMGB1 compared with the controls (Figure 2). The production of HMGB1 was not significantly attenuated by 12.5 μg/mL baicalin when co-incubated with H. parasuis for 24 and 36 h, although it was attenuated after 48 h (Figure 2). In addition, 25–100 μg/mL baicalin could reduce HMGB1 secretion in the piglet peripheral blood monocytes (Figure 2) (p < 0.01).

2.3. The Effect of LPS on HMGB1 Release in the Piglet Model

After the piglets were inoculated with LPS for 3, 6, 9, 12, 24, 36, 48, and 72 h, blood samples were collected for the detection of HMGB1 release. The results demonstrated that the levels of HMGB1 secretion significantly increased from 3 to 48 h compared with the control (Figure 3) (p < 0.05). HMGB1 release rose to a peak at 36 h and then declined at 72 h (Figure 3).

2.4. RNA-Seq Analysis of the Interaction between Host Cells and Bacteria

To understand the host-pathogen interaction, we performed RNA-Seq of H. parasuis-infected piglet peripheral blood monocytes using the Illumina Hiseq 2000 platform. Then the sequences were aligned against Sus scrofa gene sequences (Sscrofa11.1). The results showed that more than 55 million raw reads for every sample were obtained. After data filtering, about 53.7 million reads could be mapped to the reference genome (Table 1), which demonstrated that the high quality of the sequences of the samples obtained could be used for the next analysis. After the cells were infected with H. parasuis for 24 h, a total of 982 genes were observed to be significantly altered (fold change ≥ 2, p < 0.05), of which 646 genes were up-regulated and 336 genes were down-regulated (Supplemental Table S1). Surprisingly, the HMGB1 gene was up-regulated 0.21-fold. To better explore the host cell response to H. parasuis, an enrichment analysis utilizing DAVID was carried out. The gene ontology (GO) enrichment analysis showed that differentially expressed genes involved in the top 30 GO enrichments were related to chemokine activity, CCR chemokine receptor binding, eosinophil migration, and chemotaxis (Figure 4A). The top 30 pathways identified as enriched in the infected cells by the Kyoto Encyclopedia of Genes and Genomes (KEGG) are shown in Figure 4B. The cytokine–cytokine receptor interaction, chemokine signaling pathway, and tumor necrosis factor (TNF) signaling pathway were the most enriched upon host cell infection, which indicated the central importance of the signaling pathways in the pathogenesis of H. parasuis.

2.5. Analysis of the Association among DEGs of the Main Signaling Pathways Using STRING

The network of the 12 DEGs which were involved in the main pathways was explored by using the Search Tool for the Retrieval of Interacting Genes/Proteins (STRING) v10 database to show the complex associations between those genes. The analysis demonstrated that most of the DEGs chosed were closely related to each other and showed a coordinated interactive network, but some proteins were not associated with each other (Figure 5). We speculated that the crosstalk of the chosen DEGs triggered inflammation in coordination following H. parasuis infection and the network interaction of HMGB1 linked to the possible proteins.

2.6. Real-Time Polymerase Chain Reaction (PCR) Verification of DEGs

Ten genes from the main signaling pathways were choosen for verification of the DEGs data of the RNA-seq by using the real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) method. The results showed that among the chosen 10 genes, 8 genes (CYCS, CXCL9, STAT3, IGF-1, Myd88, CD14, CCR2 and CCL4) demonstrated similar expression levels compared with the RNA-seq data (Figure 6). And another 2 genes (CTSK, TLR6) did not display obvious changes in expression levels by using the real-time qRT-PCR method.

3. Discussion

Although HMGB1 has recently been reported to be an important immune modulator during bacterial or viral infection [37,38,39], there is so far no evidence that H. parasuis can induce HMGB1 release during the infection process of piglet peripheral blood monocytes triggered by H. parasuis. In the present study, our work demonstrated that H. parasuis can promote the production of HMGB1 in piglet peripheral blood monocytes and, subsequently, may induce inflammatory responses.
Baicalin, a flavonoid, is an important traditional Chinese herb that is extracted from Scutellaria baicalensis. Some previous reports have shown that baicalin is an effective treatment forcerebral ischemia [40] and Chikungunya virus infection [41]. Reports also showed that baicalin could attenuate LPS-induced inflammation and apoptosis of cow mammary epithelial cells [42] and LPS-induced injury of intestinal epithelial cells and intercellular tight junctions [43]. However, all of these findings were obtained in vitro. In the present study, we found that HMGB1 release from peripheral blood monocytes was significantly inhibited by 50–100 μg/mL baicalin. Thus, we speculated that one possible effective mechanism provided by baicalin might be related to suppressing HMGB1 release, and then reducing the HMGB1-triggered inflammatory response, but this needs to be investigated in detail. Based on these data, in future we will further explore the effect of baicalin on inflammation responses induced by H. parasuis and HMGB1 release triggered by H. parasuis in a piglet model.
The innate immune system is the first line of defense and plays an important role in eliminating pathogenic microorganisms [44]. Monocytes are the major innate immune cells that can constitutively express receptors that respond to pathogens [45]. Research has shown that immune cells such as monocytes can release cytokines when induced by pathogenic microorganisms [46]. The over-expression of inflammatory cytokines and their prolonged accumulation can lead to a systemic inflammation response or organ injury [47,48]. HMGB1, a member of the HMG family, is passively secreted from damaged or injured cells following ischemia/reperfusion injury [49], thus it may serve as a damage-associated molecular pattern molecule (DAMP) [50]. It has been documented that pathogen stimulation can result in HMGB1 cytoplasmic translocation, followed by secretion into the extracellular milieu [51]. The over-secretion of HMGB1 extracellularly could lead to severe infections or tissue damage, thereby triggering inflammatory disease [52]. In this study, we used NAC as a positive control. A previous study has shown that NAC could inhibit the translocation of HMGB1 from amnion epithelial cells’ nuclei to cytoplasm [53]. Therefore, we speculated that HMGB1 may be secreted from the nuclei to the extracellular milieu following H. parasuis infection, and thus late release of HMGB1 from peripheral blood monocytes may contribute to tissue damage. How HMGB1 production follows H. parasuis stimulation and how the secretion of HMGB1 causes damage remain to be determined.
Inflammation plays important roles in the pathogenesis of H. parasuis infection. LPS is widely used to construct an inflammation model that can induce the lung and brain to trigger inflammation with the pathological state [54,55]. When monocytes were activated, induced by LPS, it may play as the inflammation central, hence release cytokines [56]. Thus, we chose LPS to induce an inflammation model in piglets. Previous research showed that LPS could induce HMGB1 production in BEAS-2B cells and trigger acute lung injury [57], and that it stimulated HMGB1 secretion in RAW264.7 cells [58]. Consistent with previous research, our results indicated that LPS also could trigger HMGB1 production in the piglet.
In this study, the piglet peripheral blood monocytes were infected with H. parasuis for 12 h to 48 h. A long co-incubation may influence the cells’ viability or trigger citotoxicity. We also detected the cell viability at each incubation time and we found that there is no significant citotoxicity induced by H. parasuis (data not shown). In this study, the results showed that HMGB1 release by the piglet peripheral blood monocytes induced by LPS at 24 h displayed no significant difference from the control. However, HMGB1 production in piglet blood at 24 h was significantly higher than the control. We speculated that there were other cells existing in the blood that can secrete HMGB1, but which cells provide this function needs to be investigated. Previous reports have shown that HMGB1 is involved in IFN-α production and TNF-related apoptosis-inducing ligand expression by HIV-1-exposed plasmacytoid dendritic cells [59]. HMGB1 can stimulate the production of IL-1, IL-6, and TNF-α in human monocytes [60] and also activate signaling pathways [61,62]. In the present work, our results showed at the RNA level, according to RNA-Seq analysis, that cytokine production, the chemokine signaling pathway, and the TNF signaling pathway were also activated in the peripheral blood monocytes stimulated by H. parasuis for 24 h. In addition, HMGB1 expression was up-regulated according to RNA-Seq, although the change fold was very low, which may be related to late cytokine release. However, whether HMGB1 is involved in the promotion of cytokine expression and signaling pathway activation in the piglet peripheral blood monocytes needs confirmation in further research.
Taken together, our study showed that H. parasuis can induce HMGB1 release and that baicalin can inhibit HMGB1 secretion in piglet peripheral blood monocytes triggered by H. parasuis. These new findings will help to advance our understanding of the molecular mechanisms of H. parasuis pathogenesis as well as the anti-inflammatory effect of baicalin. This discovery of baicalin function may provide a new strategy for preventing the inflammatory disorders induced by H. parasuis.

4. Materials and Methods

4.1. Bacterial Strain, Growth Conditions, and Drug

The H. parasuis SH0165 isolate used in this study is a highly virulent strain of serovar 5, and was isolated from the lung of a commercial pig with fibrinous polyserositis, arthritis, hemorrhagic pneumonia, and meningitis [5]. The SH0165 isolate was grown in tryptic soy broth (Difco Laboratories, Detroit, MI, USA) supplemented with a final concentration of 10 μg/mL of NAD (Sigma, St Louis, MO, USA) and 10% newborn calf serum (Gibco, Canberra, Australia) at 37 °C.
Baicalin was obtained from the National Institutes for Food and Drug Control (Beijing, China, B110715-201318). When used, baicalin was dissolved in and diluted with RPMI-1640 medium.

4.2. Isolation and Culture of Piglet Peripheral Blood Monocytes

The experiments were designed in strict accordance with the recommendations in the China Regulations for the Administration of Affairs Concerning Experimental Animals 1988 and the Hubei Regulations for the Administration of Affairs Concerning Experimental Animals 2005. The protocol was approved by the China Hubei Province Science and Technology Department [permit number SYXK(ER) 2010-0029]. At the end of the study, all experimental piglets were euthanized.
Fifteen 30-day-old, naturally farrowed early-weaned piglets each weighing 6–8 kg (Duroc × Landrace × large white), in which antibodies against H. parasuis were negative, were purchased from Wuhan Jinying Livestock Co., Ltd. (Wuhan, China) and used for in vitro and in vivo experiments.
The piglet peripheral blood monocytes were isolated and cultured according to the method our lab previously established [35]. Briefly, piglet heparinized blood from the precaval vein was layered carefully on an equal volume of phosphate-buffered saline (PBS) (pH 7.4) in a conical centrifuge tube, and then an equal volume of mixed blood was carefully layered on the surface of the lymphocyte separation medium (Tian Jin Hao Yang Co,. LTD, Tianjin, China). The suspension was centrifuged at 400× g for 20 min at 4 °C. The cells of the lymphocyte layer were collected and washed three times with PBS and centrifuged at 400× g for 20 min at 4 °C. Then the cells were resuspended in Roswell Park Memorial Institute (RPMI) 1640 medium (Gibco, Carlsbad, CA, USA) and seeded in a six-well cell culture plate (Costar, Washington, DC, USA). 3 mL of suspension were added to each well, and these were then pre-incubated in a constant temperature incubator at 37 °C with 5% CO2 for 3 h in RPMI-1640 containing 10% fetal bovine serum (Gibco, Canberra, Australia). Cells were washed three times with PBS and then washed with pre-warmed RPMI-1640 medium to discard the non-adherent cells. Attached cells (monocytes) were detached using a cell scraper and suspended in RPMI-1640 medium. Mononuclear cells were counted and their viability was determined by trypan blue exclusion.

4.3. Western Blot Analysis of the Release of HMGB1

Piglet peripheral blood monocytes (1 × 106) were seeded into 24-well plates and were treated with 1 μg/mL LPS (Sigma, St. Louis, MO, USA), or the plate wells were infected with 1.0 × 106 CFU/mL H. parasuis. The MOI was 1:1 according to our previous work [35]. After co-incubation for 24 h and 48 h, the cell supernatants were collected and used to determine the release of HMGB1 using western blot. The cell supernatants were isolated with 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and then electrophoretically transferred to a polyvinylidene difluoride (PVDF) membrane. After blocking with 5% skim milk at room temperature for 3 h and washing five times with TBST, the PVDF membrane was incubated with anti-rabbit HMGB1 polyclonal antibody (Abnova, Walnut, CA, USA) or β-actin antibody (Cell Signaling Technology, Danvers, MA, USA) for 12 h at 4 °C. The membrane was washed five times with TBST and incubated with goat anti-rabbit IgG (Cell Signaling Technology, Danvers, MA, USA) at room temperature for 3 h and visualized by utilizing ECL solution (Thermo Pierce ECL, Waltham, MA, USA). The levels of HMGB1 expression and β-actin were measured using a FluorChem FC2 AIC system (Alpha Innotech, San Leandro, CA, USA).

4.4. Total RNA Extraction and Real-Time Polymerase Chain Reaction (RT-PCR)

HMGB1 expression at the mRNA level was carried out with the RT-PCR method as previously described with some modifications [63]. Briefly, 1 × 107 piglet peripheral blood monocytes were seeded into 24-well plates and treated with 1 μg/mL LPS or infected with 1 × 107 CFU/mL H. parasuis and co-incubated for 12, 24, 36, or 48 h. Then, the cells were collected and total cellular RNA was extracted using TRISOL reagent (Thermo Fisher Scientific, Waltham, MA, USA). Next, the purified RNA was reverse-transcribed to cDNA by utilizing reverse transcriptase (TaKaRa, Beijing, China). The levels of cDNA amplification were measured using a SYBER Green PCR Kit (ABI, Vernon, CA, USA). To explore the effect of baicalin on the release of HMGB1 at the mRNA level, 1 × 107 cells were seeded into 24-well plates and pre-treated with baicalin at concentrations of 12.5, 25, 50, 100 μg/mL or NAC (Sigma, St Louis, MO, USA) 1 mM/mL for 1 h. Then 1 × 107 CFU/mL H. parasuis were added to the wells and co-cultured for 24 h. The total RNA was isolated and used for RT-PCR. The primers included β actin (forward, 5′-TGCGGGACATCAAGGAGAAG-3′; reverse, 5′-AGTTGAAGGTGGTCTCGTGG-3′) and HMGB1 (forward, 5′-CTATCCATTGGTGATGTTGC-3′; reverse, 5′-TCCTCCTCTTCCTTCTTTTT-3′). The level of transcription expression of the HMGB1 gene was measured according to the relative quantification of the 2−ΔΔCt method.

4.5. RNA-Seq Analysis

To understand the interaction between piglet peripheral blood monocytes and H. parasuis, 1 × 107 piglet peripheral blood monocytes were infected with 1 × 107 CFU/mL H. parasuis for 24 h. The cellular RNA was extracted for RNA sequence analysis (RNA-Seq) at the Shanghai Biochip Corporation (Shanghai, China). Key pathways and genes were identified by utilizing GO, KEGG and STRING.

4.6. Validation by Real-Time Quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR)

The cell RNA was extracted and cDNA synthesis was carried out by PrimeScript™ II 1st Strand cDNA Synthesis Kit (TaKaRa, Dalian, China). mRNA expression levels of 10 genes were explored (Table 2). The relative gene expression was measured by using the threshold cycle method. Then, the fold changes were calculated by using the 2−ΔΔCt formula.

4.7. Determining the Effect of Baicalin on the Release of HMGB1 Triggered by H. parasuis with Enzyme-Linked Immunosorbent Assay (ELISA)

In brief, 1 × 106 piglet peripheral blood monocytes were seeded into 24-well plates and pretreated with baicalin at 12.5, 25, 50, 100 μg/mL or NAC (1 mM/mL) for 1 h. Then 1 × 106 CFU/mL H. parasuis were added to the wells and co-infected for 36 and 48 h. The cell supernatants were collected and the HMGB1 concentration was measured with the HMGB1 enzyme-linked immunosorbent assay (ELISA) kit (Shanghai BlueGene Biotech CO., LTD, Shanghai, China) according to the manufacturer’s protocol.

4.8. Detection of the Effect of LPS on the Secretion of HMGB1 in the Piglet Model

To evaluate the effect of LPS on the secretion of HMGB1 in the piglet, three piglets were injected subcutaneously with 2 mL of 500 μg/mL LPS. Then, blood samples were collected at 3, 6, 9, 12, 24, 36, 48 and 72 h. The levels of HMGB1 in the sera were determined with the HMGB1 ELISA kit.

4.9. Statistical Analysis

The experimental data are expressed as the mean ± standard deviation (SD). The difference between the two groups was analyzed using the student’s t-test. p values of <0.05 were considered significant (* p < 0.05 and ** p < 0.01).

Supplementary Materials

Supplementary materials can be found at https://www.mdpi.com/1422-0067/19/5/1307/s1.

Author Contributions

Yinsheng Qiu conceived of the study; Yinsheng Qiu and Shulin Fu designed the experiments; Chun Ye, Yu Liu, Zhongyuan Wu, Ling Guo, Yongqing Hou and Chien-An Andy Hu analyzed the data; Shulin Fu, Huashan Liu and Xiao Chen performed the experiments; Shulin Fu and Yinsheng Qiu wrote the manuscript. All authors reviewed the manuscript.

Acknowledgments

This work was supported by the National Natural Science Foundation of China (grant No. 31572572, 31601922) and the Natural Science Foundation of Hubei Province, China (grant No. 2017CFB446).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Mathieu-Denoncourt, A.; Letendre, C.; Auger, J.P.; Segura, M.; Aragon, V.; Lacouture, S.; Gottschalk, M. Limited Interactions between Streptococcus suis and Haemophilus parasuis in In Vitro Co-Infection Studies. Pathogens 2018, 7. [Google Scholar] [CrossRef] [PubMed]
  2. Oliveira, S.; Pijoan, C. Haemophilus parasuis: New trends on diagnosis, epidemiology and control. Vet. Microbiol. 2004, 99, 1–12. [Google Scholar] [CrossRef] [PubMed]
  3. Rapp-Gabrielson, V.J.; Kocur, G.J.; Clark, J.T.; Muir, S.K. Haemophilus parasuis: Immunity in swine after vaccination. Vet. Med. 1997, 92, 83–90. [Google Scholar]
  4. Rafiee, M.; Blackall, P.J. Establishment, validation and use of the Kielstein-Rapp-Gabrielson serotyping scheme for Haemophilus parasuis. Aust. Vet. J. 2000, 78, 172–174. [Google Scholar] [CrossRef] [PubMed]
  5. Cai, X.; Chen, H.; Blackall, P.J.; Yin, Z.; Wang, L.; Liu, Z.; Jin, M. Serological characterization of Haemophilus parasuis isolates from China. Vet. Microbiol. 2005, 111, 231–236. [Google Scholar] [CrossRef] [PubMed]
  6. Jia, A.; Zhou, R.; Fan, H.; Yang, K.; Zhang, J.; Xu, Y.; Wang, G.; Liao, M. Development of Serotype-Specific PCR Assays for Typing of Haemophilus parasuis Isolates Circulating in Southern China. J. Clin. Microbiol. 2017, 55, 3249–3257. [Google Scholar] [CrossRef] [PubMed]
  7. Rosner, H.; Kielstein, P.; Müller, W.; Rohrmann, B. Relationship between serotype, virulence and SDS-PAGE protein patterns of Haemophilus parasuis. Dtsch. Tierarztl. Wochenschr. 1991, 98, 327–330. [Google Scholar] [PubMed]
  8. Rapp-Gabrielson, V.J.; Gabrielson, D.A.; Schamber, G.J. Comparative virulence of Haemophilus parasuis serovars 1 to 7 in guinea pigs. Am. J. Vet. Res. 1992, 53, 987–994. [Google Scholar] [PubMed]
  9. Amano, H.; Shibata, M.; Kajio, N.; Morozumi, T. Pathogenicity of Haemophilus parasuis serovars 4 and 5 in contact-exposed pigs. J. Vet. Med. Sci. 1996, 58, 559–561. [Google Scholar] [CrossRef] [PubMed][Green Version]
  10. Bouchet, B.; Vanier, G.; Jacques, M.; Gottschalk, M. Interactions of Haemophilus parasuis and its LOS with porcine brain microvascular endothelial cells. Vet. Res. 2008, 39, 42. [Google Scholar] [CrossRef] [PubMed]
  11. Xu, C.; Zhang, L.; Zhang, B.; Feng, S.; Zhou, S.; Li, J.; Zou, Y.; Liao, M. Involvement of lipooligosaccharide heptose residues of Haemophilus parasuis SC096 strain in serum resistance, adhesion and invasion. Vet. J. 2013, 195, 200–204. [Google Scholar] [CrossRef] [PubMed]
  12. Zhang, B.; He, Y.; Xu, C.; Xu, L.; Feng, S.; Liao, M.; Ren, T. Cytolethal distending toxin (CDT) of the Haemophilus parasuis SC096 strain contributes to serum resistance and adherence to and invasion of PK-15 and PUVEC cells. Vet. Microbiol. 2012, 157, 237–242. [Google Scholar] [CrossRef] [PubMed]
  13. Zhang, B.; Yu, Y.; Zeng, Z.; Ren, Y.; Yue, H. Deletion of the rfaE gene in Haemophilus parasuis SC096 strain attenuates serum resistance, adhesion and invasion. Microb. Pathog. 2014, 74, 33–37. [Google Scholar] [CrossRef] [PubMed]
  14. Zhao, L.; Gao, X.; Liu, C.; Lv, X.; Jiang, N.; Zheng, S. Deletion of the vacJ gene affects the biology and virulence in Haemophilus parasuis serovar 5. Gene 2017, 603, 42–53. [Google Scholar] [CrossRef] [PubMed]
  15. Ding, L.; Wen, X.; He, L.; Yan, X.; Wen, Y.; Cao, S.; Huang, X.; Wu, R.; Wen, Y. The arcA gene contributes to the serum resistance and virulence of Haemophilus parasuis serovar 13 clinical strain EP3. Vet. Microbiol. 2016, 196, 67–71. [Google Scholar] [CrossRef] [PubMed]
  16. Zhang, L.; Li, Y.; Wen, Y.; Lau, G.W.; Huang, X.; Wu, R.; Yan, Q.; Huang, Y.; Zhao, Q.; Ma, X. HtrA Is Important for Stress Resistance and Virulence in Haemophilus parasuis. Infect. Immun. 2016, 84, 2209–2219. [Google Scholar] [CrossRef] [PubMed]
  17. Twigg, H.L., 3rd. Macrophages in innate and acquired immunity. Semin. Respir. Crit. Care Med. 2004, 25, 21–31. [Google Scholar] [CrossRef] [PubMed]
  18. Rocha-Ramírez, L.M.; Pérez-Solano, R.A.; Castañón-Alonso, S.L.; Moreno Guerrero, S.S.; Ramírez Pacheco, A.; García Garibay, M.; Eslava, C. Probiotic Lactobacillus Strains Stimulate the Inflammatory Response and Activate Human Macrophages. J. Immunol. Res. 2017, 2017, 4607491. [Google Scholar] [CrossRef] [PubMed]
  19. Yang, H.; Wang, H.; Czura, C.J.; Tracey, K.J. HMGB1 as a cytokine and therapeutic target. J. Endotoxin. Res. 2002, 8, 469–472. [Google Scholar] [CrossRef] [PubMed]
  20. Fiuza, C.; Bustin, M.; Talwar, S.; Tropea, M.; Gerstenberger, E.; Shelhamer, J.H.; Suffredini, A.F. Inflammation-promoting activity of HMGB1 on human microvascular endothelial cells. Blood 2003, 101, 2652–2660. [Google Scholar] [CrossRef] [PubMed]
  21. Lv, Y.; Li, Y.; Zhang, D.; Zhang, A.; Guo, W.; Zhu, S. HMGB1-induced asthmatic airway inflammation through GRP75-mediated enhancement of ER-mitochondrial Ca2+ transfer and ROS increased. J. Cell. Biochem. 2018. [Google Scholar] [CrossRef] [PubMed]
  22. Kida, T.; Seno, T.; Nagahara, H.; Inoue, T.; Nakabayashi, A.; Kukida, Y.; Fujioka, K.; Fujii, W.; Wada, M.; Kohno, M.; et al. Roles of high-mobility group box 1 and thrombin in murine pulmonary fibrosis and the therapeutic potential of thrombomodulin. Am. J. Physiol. Lung Cell. Mol. Physiol. 2017. [Google Scholar] [CrossRef] [PubMed]
  23. Kigerl, K.A.; Lai, W.; Wallace, L.M.; Yang, H.; Popovich, P.G. High mobility group box-1 (HMGB1) is increased in injured mouse spinal cord and can elicit neurotoxic inflammation. Brain Behav. Immun. 2017. [Google Scholar] [CrossRef] [PubMed]
  24. Feghali, K.; Iwasaki, K.; Tanaka, K.; Komaki, M.; Machigashira, M.; Ishikawa, I.; Izumi, Y. Human gingival fibroblasts release high-mobility group box-1 protein through active and passive pathways. Oral Microbiol. Immunol. 2009, 24, 292–298. [Google Scholar] [CrossRef] [PubMed]
  25. Zhang, H.; Zhang, R.; Chen, J.; Shi, M.; Li, W.; Zhang, X. High Mobility Group Box1 Inhibitor Glycyrrhizic Acid Attenuates Kidney Injury in Streptozotocin-Induced Diabetic Rats. Kidney Blood Press. Res. 2017, 42, 894–904. [Google Scholar] [CrossRef] [PubMed]
  26. Relja, B.; Wagner, N.; Franz, N.; Dieteren, S.; Mörs, K.; Schmidt, J.; Marzi, I.; Perl, M. Ethyl pyruvate reduces acute lung damage following trauma and hemorrhagic shock via inhibition of NF-κB and HMGB1. Immunobiology 2018, 223, 310–318. [Google Scholar] [CrossRef] [PubMed]
  27. Chung, C.P.; Park, J.B.; Bae, K.H. Pharmacological effects of methanolic extract from the root of Scutellaria baicalensis and its flavonoids on human gingival fibroblast. Planta Med. 1995, 61, 150–153. [Google Scholar] [CrossRef] [PubMed]
  28. Xiang, H.; Zhang, Q.; Qi, B.; Tao, X.; Xia, S.; Song, H.; Qu, J.; Shang, D. Chinese Herbal Medicines Attenuate Acute Pancreatitis: Pharmacological Activities and Mechanisms. Front. Pharmacol. 2017, 8, 216. [Google Scholar] [CrossRef] [PubMed]
  29. Luo, J.; Dong, B.; Wang, K.; Cai, S.; Liu, T.; Cheng, X.; Chen, Y.; Li, Y.; Kong, J.; Chen, Y. Baicalin inhibits biofilm formation, attenuates the quorum sensing-controlled virulence and enhances Pseudomonas aeruginosa clearance in a mouse peritoneal implant infection model. PLoS ONE 2017, 12, e0176883. [Google Scholar] [CrossRef] [PubMed]
  30. Qiu, J.; Niu, X.; Dong, J.; Wang, D.; Wang, J.; Li, H.; Luo, M.; Li, S.; Feng, H.; Deng, X. Baicalin protects mice from Staphylococcus aureus pneumonia via inhibition of the cytolytic activity of α-hemolysin. J. Infect. Dis. 2012, 206, 292–301. [Google Scholar] [CrossRef] [PubMed]
  31. Liu, S.; Liu, B.; Luo, Z.Q.; Qiu, J.; Zhou, X.; Li, G.; Zhang, B.; Deng, X.; Yang, Z.; Wang, J. The combination of osthole with baicalin protects mice from Staphylococcus aureus pneumonia. World J. Microbiol. Biotechnol. 2017, 33, 11. [Google Scholar] [CrossRef] [PubMed]
  32. Zhu, J.; Wang, J.; Sheng, Y.; Zou, Y.; Bo, L.; Wang, F.; Lou, J.; Fan, X.; Bao, R.; Wu, Y.; et al. Baicalin improves survival in a murine model of polymicrobial sepsis via suppressing inflammatory response and lymphocyte apoptosis. PLoS ONE 2012, 7, e35523. [Google Scholar] [CrossRef] [PubMed]
  33. Yang, X.; Zhang, Q.; Gao, Z.; Yu, C.; Zhang, L. Baicalin alleviates IL-1β-induced inflammatory injury via down-regulating miR-126 in chondrocytes. Biomed. Pharmacother. 2018, 99, 184–190. [Google Scholar] [CrossRef] [PubMed]
  34. Zhou, T.; Zhang, A.; Kuang, G.; Gong, X.; Jiang, R.; Lin, D.; Li, J.; Li, H.; Zhang, X.; Wan, J.; et al. Baicalin inhibits the metastasis of highly aggressive breast cancer cells by reversing epithelial-to-mesenchymal transition by targeting β-catenin signaling. Oncol. Rep. 2017, 38, 3599–3607. [Google Scholar] [CrossRef] [PubMed]
  35. Fu, S.; Xu, L.; Li, S.; Qiu, Y.; Liu, Y.; Wu, Z.; Ye, C.; Hou, Y.; Hu, C.A. Baicalin suppresses NLRP3 inflammasome and nuclear factor-kappa B (NF-κB) signaling during Haemophilus parasuis infection. Vet. Res. 2016, 47, 80. [Google Scholar] [CrossRef] [PubMed]
  36. Ye, C.; Li, S.; Yao, W.; Xu, L.; Qiu, Y.; Liu, Y.; Wu, Z.; Hou, Y. The anti-inflammatory effects of baicalin through suppression of NLRP3 inflammasome pathway in LPS-challenged piglet mononuclear phagocytes. Innate Immun. 2016, 22, 196–204. [Google Scholar] [CrossRef] [PubMed]
  37. Liu, J.; Li, R.; Liu, T.; Rausch-Fan, X.; Wang, M. High Mobility Group Box 1 Protein Level as a Novel Biomarker for the Development of Peri-Implant Disease. Sci. Rep. 2017, 7, 7027. [Google Scholar] [CrossRef] [PubMed]
  38. Fu, S.; Wang, J.; Hu, X.; Zhou, R.R.; Fu, Y.; Tang, D.; Kang, R.; Huang, Y.; Sun, L.; Li, N.; Fan, X.G. Crosstalk between hepatitis B virus X and high-mobility group box 1 facilitates autophagy in hepatocytes. Mol. Oncol. 2018. [Google Scholar] [CrossRef] [PubMed]
  39. Manti, S.; Harford, T.J.; Salpietro, C.; Rezaee, F.; Piedimonte, G. Induction of high mobility group box-1 in vitro and in vivo by respiratory syncytial virus. Pediatr. Res. 2018. [Google Scholar] [CrossRef] [PubMed]
  40. Li, B.; Yu, Y.; Zhang, Y.; Liu, J.; Li, H.; Dang, H.; Guo, S.; Wang, L.; Wu, H.; Wang, Z.; Wang, Y. Vertical and Horizontal Convergences of Targeting Pathways in Combination Therapy with Baicalin and Jasminoidin for Cerebral Ischemia. CNS. Neurol. Disord. Drug Targets 2016, 15, 740–750. [Google Scholar] [CrossRef] [PubMed]
  41. Oo, A.; Rausalu, K.; Merits, A.; Higgs, S.; Vanlandingham, D.; Bakar, S.A.; Zandi, K. Deciphering the potential of baicalin as an antiviral agent for Chikungunya virus infection. Antivir. Res. 2018, 150, 101–111. [Google Scholar] [CrossRef] [PubMed]
  42. Yang, W.; Li, H.; Cong, X.; Wang, X.; Jiang, Z.; Zhang, Q.; Qi, X.; Gao, S.; Cao, R.; Tian, W. Baicalin attenuates lipopolysaccharide induced inflammation and apoptosis of cow mammary epithelial cells by regulating NF-κB and HSP72. Int. Immunopharmacol. 2016, 40, 139–145. [Google Scholar] [CrossRef] [PubMed]
  43. Chen, J.; Zhang, R.; Wang, J.; Yu, P.; Liu, Q.; Zeng, D.; Song, H.; Kuang, Z. Protective effects of baicalin on LPS-induced injury in intestinal epithelial cells and intercellular tight junctions. Can. J. Physiol. Pharmacol. 2015, 93, 233–237. [Google Scholar] [CrossRef] [PubMed]
  44. Kim, S.; Becker, J.; Bechheim, M.; Kaiser, V.; Noursadeghi, M.; Fricker, N.; Beier, E.; Klaschik, S.; Boor, P.; Hess, T.; Hofmann, A.; et al. Characterizing the genetic basis of innate immune response in TLR4-activated human monocytes. Nat. Commun. 2014, 5, 5236. [Google Scholar] [CrossRef] [PubMed]
  45. Fairfax, B.P.; Humburg, P.; Makino, S.; Naranbhai, V.; Wong, D.; Lau, E.; Jostins, L.; Plant, K.; Andrews, R.; McGee, C.; et al. Innate immune activity conditions the effect of regulatory variants upon monocyte gene expression. Science 2014, 343, 1246949. [Google Scholar] [CrossRef] [PubMed]
  46. Lachmann, G.; von Haefen, C.; Kurth, J.; Yuerek, F.; Spies, C. Innate immunity recovers earlier than acquired immunity during severe postoperative immunosuppression. Int. J. Med. Sci. 2018, 15, 1–9. [Google Scholar] [CrossRef] [PubMed]
  47. Vitale, S.; Strisciuglio, C.; Pisapia, L.; Miele, E.; Barba, P.; Vitale, A.; Cenni, S.; Bassi, V.; Maglio, M.; Del Pozzo, G.; et al. Cytokine production profile in intestinal mucosa of paediatric inflammatory bowel disease. PLoS ONE 2017, 12, e0182313. [Google Scholar] [CrossRef] [PubMed]
  48. Wang, W.; Bian, H.; Li, F.; Li, X.; Zhang, D.; Sun, S.; Song, S.; Zhu, Q.; Ren, W.; Qin, C.; et al. HBeAg induces the expression of macrophage miR-155 to accelerate liver injury via promoting production of inflammatory cytokines. Cell. Mol. Life Sci. 2018. [Google Scholar] [CrossRef] [PubMed]
  49. Sugita, A.; Kinoshita, K.; Sakurai, A.; Chiba, N.; Yamaguchi, J.; Kuwana, T.; Sawada, N.; Hori, S. Systemic impact on secondary brain aggravation due to ischemia/reperfusion injury in post-cardiac arrest syndrome: A prospective observational study using high-mobility group box 1 protein. Crit. Care 2017, 21, 247. [Google Scholar] [CrossRef] [PubMed]
  50. Li, W.; Bao, G.; Chen, W.; Qiang, X.; Zhu, S.; Wang, S.; He, M.; Ma, G.; Ochani, M.; Al-Abed, Y.; et al. Connexin 43 Hemichannel as a Novel Mediator of Sterile and Infectious Inflammatory Diseases. Sci. Rep. 2018, 8, 166. [Google Scholar] [CrossRef] [PubMed]
  51. Chen, S.; Dong, Z.; Yang, P.; Wang, X.; Jin, G.; Yu, H.; Chen, L.; Li, L.; Tang, L.; Bai, S.; et al. Hepatitis B virus X protein stimulates high mobility group box 1 secretion and enhances hepatocellular carcinoma metastasis. Cancer Lett. 2017, 394, 22–32. [Google Scholar] [CrossRef] [PubMed]
  52. Johansson, L.; Snäll, J.; Sendi, P.; Linnér, A.; Thulin, P.; Linder, A.; Treutiger, C.J.; Norrby-Teglund, A. HMGB1 in severe soft tissue infections caused by Streptococcus pyogenes. Front. Cell. Infect. Microbiol. 2014, 4, 4. [Google Scholar] [CrossRef] [PubMed]
  53. Sheller-Miller, S.; Urrabaz-Garza, R.; Saade, G.; Menon, R. Damage-Associated molecular pattern markers HMGB1 and cell-Free fetal telomere fragments in oxidative-Stressed amnion epithelial cell-Derived exosomes. J. Reprod. Immunol. 2017, 123, 3–11. [Google Scholar] [CrossRef] [PubMed]
  54. Zaghloul, N.; Addorisio, M.E.; Silverman, H.A.; Patel, H.L.; Valdés-Ferrer, S.I.; Ayasolla, K.R.; Lehner, K.R.; Olofsson, P.S.; Nasim, M.; Metz, C.N.; Wang, P.; et al. Forebrain Cholinergic Dysfunction and Systemic and Brain Inflammation in Murine Sepsis Survivors. Front. Immunol. 2017, 8, 1673. [Google Scholar] [CrossRef] [PubMed]
  55. Fonceca, A.M.; Zosky, G.R.; Bozanich, E.M.; Sutanto, E.N.; Kicic, A.; McNamara, P.S.; Knight, D.A.; Sly, P.D.; Turner, D.J.; Stick, S.M. Accumulation mode particles and LPS exposure induce TLR-4 dependent and independent inflammatory responses in the lung. Respir. Res. 2018, 19, 15. [Google Scholar] [CrossRef] [PubMed]
  56. Sieve, I.; Ricke-Hoch, M.; Kasten, M.; Battmer, K.; Stapel, B.; Falk, C.S.; Leisegang, M.S.; Haverich, A.; Scherr, M.; Hilfiker-Kleiner, D. A positive feedback loop between IL-1β, LPS and NEU1 may promote atherosclerosis by enhancing a pro-inflammatory state in monocytes and macrophages. Vasc. Pharmacol. 2018. [Google Scholar] [CrossRef] [PubMed]
  57. Meng, L.; Li, L.; Lu, S.; Li, K.; Su, Z.; Wang, Y.; Fan, X.; Li, X.; Zhao, G. The protective effect of dexmedetomidine on LPS-induced acute lung injury through the HMGB1-mediated TLR4/NF-κB and PI3K/Akt/mTOR pathways. Mol. Immunol. 2018, 94, 7–17. [Google Scholar] [CrossRef] [PubMed]
  58. Chaochao, Q.; Lou, G.; Yang, Y.; Liu, Y.; Hu, Y.; Min, Z.; Chen, P.; He, J.; Chen, Z. Macrophage Inflammatory Protein-2 in High Mobility Group Box 1 Secretion of Macrophage Cells Exposed to Lipopolysaccharide. Cell. Physiol. Biochem. 2017, 42, 913–928. [Google Scholar] [CrossRef] [PubMed]
  59. Saïdi, H.; Bras, M.; Formaglio, P.; Melki, M.T.; Charbit, B.; Herbeuval, J.P.; Gougeon, M.L. HMGB1 Is Involved in IFN-α Production and TRAIL Expression by HIV-1-Exposed Plasmacytoid Dendritic Cells: Impact of the Crosstalk with NK Cells. PLoS Pathog. 2016, 12, e1005407. [Google Scholar] [CrossRef] [PubMed]
  60. Andersson, U.; Wang, H.; Palmblad, K.; Aveberger, A.C.; Bloom, O.; Erlandsson-Harris, H.; Janson, A.; Kokkola, R.; Zhang, M.; Yang, H.; et al. High mobility group 1 protein (HMG-1) stimulates proinflammatory cytokine synthesis in human monocytes. J. Exp. Med. 2000, 192, 565–570. [Google Scholar] [CrossRef] [PubMed]
  61. Cheng, L.S.; Li, J.; Liu, Y.; Wang, F.P.; Wang, S.Q.; She, W.M.; Wu, S.D.; Qi, X.L.; Zhou, Y.P.; Jiang, W. HMGB1-induced autophagy: A new pathway to maintain Treg function during chronic hepatitis B virus infection. Clin. Sci. (Lond.) 2017, 131, 381–394. [Google Scholar] [CrossRef] [PubMed]
  62. Cheng, Y.; Xiong, J.; Chen, Q.; Xia, J.; Zhang, Y.; Yang, X.; Tao, K.; Zhang, S.; He, S. Hypoxia/reoxygenation-induced HMGB1 translocation and release promotes islet proinflammatory cytokine production and early islet graft failure through TLRs signaling. Biochim. Biophys. Acta 2017, 1863, 354–364. [Google Scholar] [CrossRef] [PubMed]
  63. Cheng, X.; Yang, Y.L.; Yang, H.; Wang, Y.H.; Du, G.H. Kaempferol alleviates LPS-induced neuroinflammation and BBB dysfunction in mice via inhibiting HMGB1 release and down-regulating TLR4/MyD88 pathway. Int. Immunopharmacol. 2018, 56, 29–35. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Detection of high-mobility group box 1 (HMGB1) release in the piglet peripheral blood monocytes triggered by H. parasuis or lipopolysaccharide (LPS) using the real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) method (A) and Western blot method (B). * p < 0.05; ** p < 0.01; HPS: H. parasuis; 36 h: LPS vs. Control (p < 0.01) and HPS vs. Control (p < 0.01); 48 h: LPS vs. Control (p < 0.01) and HPS vs. Control (p < 0.05).
Figure 1. Detection of high-mobility group box 1 (HMGB1) release in the piglet peripheral blood monocytes triggered by H. parasuis or lipopolysaccharide (LPS) using the real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) method (A) and Western blot method (B). * p < 0.05; ** p < 0.01; HPS: H. parasuis; 36 h: LPS vs. Control (p < 0.01) and HPS vs. Control (p < 0.01); 48 h: LPS vs. Control (p < 0.01) and HPS vs. Control (p < 0.05).
Ijms 19 01307 g001
Figure 2. The effect of baicalin on HMGB1 release in piglet peripheral blood monocytes induced by H. parasuis. 1 × 106 piglet peripheral blood monocytes were pretreated with baicalin at 12.5, 25, 50, 100 μg/mL or NAC (1 mM/mL) for 1 h. 1 × 106 CFU/mL H. parasuis were added to the wells and co-infected for 24, 36 and 48 h. The HMGB1 concentration was measured. ## p < 0.01 vs. control. * p < 0.05; ** p < 0.01; HPS: H. parasuis.
Figure 2. The effect of baicalin on HMGB1 release in piglet peripheral blood monocytes induced by H. parasuis. 1 × 106 piglet peripheral blood monocytes were pretreated with baicalin at 12.5, 25, 50, 100 μg/mL or NAC (1 mM/mL) for 1 h. 1 × 106 CFU/mL H. parasuis were added to the wells and co-infected for 24, 36 and 48 h. The HMGB1 concentration was measured. ## p < 0.01 vs. control. * p < 0.05; ** p < 0.01; HPS: H. parasuis.
Ijms 19 01307 g002
Figure 3. The effect of LPS on HMGB1 release in the piglet model. The piglets were inoculated with LPS for 3, 6, 9, 12, 24, 36, 48, and 72 h, blood samples were collected for the detection of HMGB1 release. * p < 0.05; ** p < 0.01.
Figure 3. The effect of LPS on HMGB1 release in the piglet model. The piglets were inoculated with LPS for 3, 6, 9, 12, 24, 36, 48, and 72 h, blood samples were collected for the detection of HMGB1 release. * p < 0.05; ** p < 0.01.
Ijms 19 01307 g003
Figure 4. Analysis of the top 30 pathway enrichment (A) and gene ontology (GO) enrichment (B) by RNA-Seq.
Figure 4. Analysis of the top 30 pathway enrichment (A) and gene ontology (GO) enrichment (B) by RNA-Seq.
Ijms 19 01307 g004
Figure 5. Search Tool for the Retrieval of Interacting Genes/Proteins (STRING) analysis of the relationship between 12 choosed DEGs.
Figure 5. Search Tool for the Retrieval of Interacting Genes/Proteins (STRING) analysis of the relationship between 12 choosed DEGs.
Ijms 19 01307 g005
Figure 6. Relative quantification of DEGs for verification by RT-PCR. RT-PCR relative expression levels of selected genes were chosen for the cells infected for 24 h.
Figure 6. Relative quantification of DEGs for verification by RT-PCR. RT-PCR relative expression levels of selected genes were chosen for the cells infected for 24 h.
Ijms 19 01307 g006
Table 1. Statistical summary analysis of RNA-seq datasets of infection cells and control cells.
Table 1. Statistical summary analysis of RNA-seq datasets of infection cells and control cells.
Samples_IDAll ReadsMapped ReadsMapped Pair ReadsMapped Broken-Pair ReadsMapped Unique ReadsMapped Multi ReadsMapping Ratio
H155,854,34244,980,51340,035,2184,945,29543,121,9321,858,58180.53%
H254,986,83844,145,40539,108,7745,036,63142,172,6151,972,79080.28%
H350,658,01240,793,43836,277,2504,516,18839,182,3841,611,05480.53%
K161,627,71849,131,99843,393,5505,738,44846,888,1482,243,85079.72%
K255,917,12044,938,81039,598,9785,339,83242,736,2272,202,58380.37%
K354,216,75043,563,88738,251,6365,312,25141,401,5112,162,37680.35%
H1, H2, H3: the infected cells; K1, K2, K3: the control cells.
Table 2. Primers for qRT-PCR.
Table 2. Primers for qRT-PCR.
GeneNucleotide Sequence (5′–3′)
β-actinForwardTGCGGGACATCAAGGAGAAG
ReverseAGTTGAAGGTGGTCTCGTGG
CCR2ForwardATGCCCAGTTTTCTACGGGG
ReverseCCGGGCACTTGCTTTAGAGA
CD14ForwardCACTGCCTAGTGCCAAGGAT
ReverseCCCACGTTCGCTACACTTCT
Myd88ForwardCATCCCTTGGATGTCAGGCA
ReverseAAACTGGATATCGCTGGGGC
TLR6ForwardTGTTGACCACAGGGAGGGTA
ReverseTGGATCCACATTGCATGGCT
CYCSForwardCCTCCATGGTCTCTTTGGGC
ReverseGGCGGTGGCCAACTTTTACT
CTSKForwardGCCATTGATGCAAGCCTGAC
ReverseATAGCCTTTGTTGCCCCAGT
CXCL9ForwardAACAGCCCGTGTCAACATGA
ReverseGTGGAAAGGTGTGGAATGCG
STAT3ForwardCCCCGTGTCTAATAGGGGAG
ReverseATCCAAGGGGCCAGAAACTG
IGF-1ForwardTGTACTGTGCACCCCTCAAG
ReverseAACTCGTGCAGAGCAAAGGAT
CCL4ForwardCTTCACATACACCGTGCGGA
ReverseAGACCTGCCTGCCCTTTTTG

Share and Cite

MDPI and ACS Style

Fu, S.; Liu, H.; Chen, X.; Qiu, Y.; Ye, C.; Liu, Y.; Wu, Z.; Guo, L.; Hou, Y.; Hu, C.-A.A. Baicalin Inhibits Haemophilus Parasuis-Induced High-Mobility Group Box 1 Release during Inflammation. Int. J. Mol. Sci. 2018, 19, 1307. https://doi.org/10.3390/ijms19051307

AMA Style

Fu S, Liu H, Chen X, Qiu Y, Ye C, Liu Y, Wu Z, Guo L, Hou Y, Hu C-AA. Baicalin Inhibits Haemophilus Parasuis-Induced High-Mobility Group Box 1 Release during Inflammation. International Journal of Molecular Sciences. 2018; 19(5):1307. https://doi.org/10.3390/ijms19051307

Chicago/Turabian Style

Fu, Shulin, Huashan Liu, Xiao Chen, Yinsheng Qiu, Chun Ye, Yu Liu, Zhongyuan Wu, Ling Guo, Yongqing Hou, and Chien-An Andy Hu. 2018. "Baicalin Inhibits Haemophilus Parasuis-Induced High-Mobility Group Box 1 Release during Inflammation" International Journal of Molecular Sciences 19, no. 5: 1307. https://doi.org/10.3390/ijms19051307

APA Style

Fu, S., Liu, H., Chen, X., Qiu, Y., Ye, C., Liu, Y., Wu, Z., Guo, L., Hou, Y., & Hu, C.-A. A. (2018). Baicalin Inhibits Haemophilus Parasuis-Induced High-Mobility Group Box 1 Release during Inflammation. International Journal of Molecular Sciences, 19(5), 1307. https://doi.org/10.3390/ijms19051307

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop