Biological and Evolutionary Significance of Terminal Extensions of Mitochondrial Translation Initiation Factor 3
Abstract
:1. Introduction
2. Results
2.1. At Least One Terminal Extension of Aim23p is Necessary for Its Function in Mitochondria
2.2. Terminal Extensions of Aim23p Make E. coli IF3 Fully Active in Yeast Mitochondria
2.3. Human mtIF3 Does Not Need Any Terminal Extension to Function Properly in Yeast Mitochondria
3. Discussion
4. Materials and Methods
4.1. Plasmids, Strains, Oligonucleotides
4.2. Cloning, Yeast Strains Construction, and Standard Procedures
4.3. Measurement of the Mitochondrial Translation
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Wiedemann, N.; Pfanner, N. Mitochondrial machineries for protein import and assembly. Annu. Rev. Biochem. 2017, 86, 685–714. [Google Scholar] [CrossRef] [PubMed]
- Ott, M.; Amunts, A.; Brown, A. Organization and regulation of mitochondrial protein synthesis. Annu. Rev. Biochem. 2016, 85, 77–101. [Google Scholar] [CrossRef] [PubMed]
- Kuzmenko, A.V.; Levitskii, S.A.; Vinogradova, E.N.; Atkinson, G.C.; Hauryliuk, V.; Zenkin, N.; Kamenski, P.A. Protein biosynthesis in mitochondria. Biochemistry 2013, 78, 855–866. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Amunts, A.; Brown, A.; Toots, J.; Scheres, S.H.; Ramakrishnan, V. The structure of the human mitochondrial ribosome. Science 2015, 348, 95–98. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Desai, N.; Brown, A.; Amunts, A.; Ramakrishnan, V. The structure of the yeast mitochondrial ribosome. Science 2017, 355, 528–531. [Google Scholar] [CrossRef] [PubMed]
- Kuzmenko, A.; Atkinson, G.C.; Levitskii, S.; Zenkin, N.; Tenson, T.; Hauryliuk, V.; Kamenski, P. Mitochondrial translation initiation machinery: Conservation and diversification. Biochimie 2014, 100, 132–140. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kummer, E.; Leibundgut, M.; Rackham, O.; Lee, R.G.; Boehringer, D.; Filipovska, A.; Ban, N. Unique features of mammalian mitochondrial translation initiation revealed by cryo-EM. Nature 2018, 560, 263–267. [Google Scholar] [CrossRef]
- Li, Y.; Holmes, W.B.; Appling, D.R.; RajBhandary, U.L. Initiation of protein synthesis in saccharomyces cerevisiae mitochondria without formylation of the initiator trna. J. Bacteriol. 2000, 182, 2886–2892. [Google Scholar] [CrossRef]
- Derbikova, K.S.; Levitsky, S.A.; Chicherin, I.V.; Vinogradova, E.N.; Kamenski, P.A. Activation of yeast mitochondrial translation: Who is in charge? Biochemistry 2018, 83, 87–97. [Google Scholar] [CrossRef]
- Christian, B.E.; Spremulli, L.L. Mechanism of protein biosynthesis in mammalian mitochondria. Biochim. Biophys. Acta 2012, 1819, 1035–1054. [Google Scholar] [CrossRef] [Green Version]
- Montoya, J.; Ojala, D.; Attardi, G. Distinctive features of the 5’-terminal sequences of the human mitochondrial mRNAs. Nature 1981, 290, 465–470. [Google Scholar] [CrossRef] [PubMed]
- Gaur, R.; Grasso, D.; Datta, P.P.; Krishna, P.D.; Das, G.; Spencer, A.; Agrawal, R.K.; Spremulli, L.; Varshney, U. A single mammalian mitochondrial translation initiation factor functionally replaces two bacterial factors. Mol. Cell 2008, 29, 180–190. [Google Scholar] [CrossRef]
- Atkinson, G.C.; Kuzmenko, A.; Kamenski, P.; Vysokikh, M.Y.; Lakunina, V.; Tankov, S.; Smirnova, E.; Soosaar, A.; Tenson, T.; Hauryliuk, V. Evolutionary and genetic analyses of mitochondrial translation initiation factors identify the missing mitochondrial IF3 in S. cerevisiae. Nucleic Acids Res. 2012, 40, 6122–6134. [Google Scholar] [CrossRef]
- Koc, E.C.; Spremulli, L.L. Identification of mammalian mitochondrial translational initiation factor 3 and examination of its role in initiation complex formation with natural mRNAs. J. Biol. Chem. 2002, 277, 35541–35549. [Google Scholar] [CrossRef]
- Kuzmenko, A.; Derbikova, K.; Salvatori, R.; Tankov, S.; Atkinson, G.C.; Tenson, T.; Ott, M.; Kamenski, P.; Hauryliuk, V. Aim-less translation: Loss of saccharomyces cerevisiae mitochondrial translation initiation factor mIF3/Aim23 leads to unbalanced protein synthesis. Sci. Rep. 2016, 6, 18749. [Google Scholar] [CrossRef] [PubMed]
- Christian, B.E.; Spremulli, L.L. Evidence for an active role of IF3mt in the initiation of translation in mammalian mitochondria. Biochemistry 2009, 48, 3269–3278. [Google Scholar] [CrossRef] [PubMed]
- Bhargava, K.; Spremulli, L.L. Role of the N- and C-terminal extensions on the activity of mammalian mitochondrial translational initiation factor 3. Nucleic Acids Res. 2005, 33, 7011–7018. [Google Scholar] [CrossRef] [Green Version]
- Haque, M.E.; Grasso, D.; Spremulli, L.L. The interaction of mammalian mitochondrial translational initiation factor 3 with ribosomes: Evolution of terminal extensions in IF3mt. Nucleic Acids Res. 2008, 36, 589–597. [Google Scholar] [CrossRef]
- Gakh, O.; Cavadini, P.; Isaya, G. Mitochondrial processing peptidases. Biochim. Biophys. Acta 2002, 1592, 63–77. [Google Scholar] [CrossRef]
- Fernandez-Silva, P.; Acin-Perez, R.; Fernandez-Vizarra, E.; Perez-Martos, A.; Enriquez, J.A. In vivo and in organello analyses of mitochondrial translation. Methods Cell Biol. 2007, 80, 571–588. [Google Scholar]
- Petrelli, D.; LaTeana, A.; Garofalo, C.; Spurio, R.; Pon, C.L.; Gualerzi, C.O. Translation initiation factor if3: Two domains, five functions, one mechanism? Embo J. 2001, 20, 4560–4569. [Google Scholar] [CrossRef] [PubMed]
- Levitskii, S.; Derbikova, K.; Baleva, M.V.; Kuzmenko, A.; Golovin, A.V.; Chicherin, I.; Krasheninnikov, I.A.; Kamenski, P. 60S dynamic state of bacterial ribosome is fixed by yeast mitochondrial initiation factor 3. PeerJ 2018, 6, e5620. [Google Scholar] [CrossRef]
- Heckman, K.L.; Pease, L.R. Gene splicing and mutagenesis by PCR-driven overlap extension. Nat. Protoc. 2007, 2, 924–932. [Google Scholar] [CrossRef] [PubMed]
- Gietz, R.D.; Schiestl, R.H. High-efficiency yeast transformation using the LiAc/SS carrier DNA/peg method. Nat. Protoc. 2007, 2, 31–34. [Google Scholar] [CrossRef] [PubMed]
- Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH image to ImageJ: 25 years of image analysis. Nat. Methods 2012, 9, 671–675. [Google Scholar] [CrossRef] [PubMed]
Plasmid | Description |
---|---|
pAim23 | pRS317 with cloned AIM23 gene |
pAim23∆MTS | pRS317 with cloned AIM23 gene lacking mitochondrial targeting sequence |
pAim23∆N | pRS317 with cloned AIM23 gene lacking N-terminal extension |
pAim23∆C | pRS317 with cloned AIM23 gene lacking C-terminal extension |
pAim23∆N∆C | pRS317 with cloned AIM23 gene lacking N- and C-terminal extensions |
pIF3 | pRS317 with cloned infC gene from E. coli (IF3-coding) fused with the Aim23p mitochondrial targeting sequence |
pIF3∆MTS | pRS317 with cloned infC gene |
pIF3N | pRS317 with cloned infC gene fused with the Aim23p N-terminal extension |
pIF3C | pRS317 with cloned infC gene fused with the Aim23p C-terminal extension |
pIF3NC | pRS317 with cloned infC gene fused with the Aim23p N- and C-terminal extensions |
pmtIF3 | pRS317 with cloned MTIF3 gene from Homo sapiens (mtIF3-coding) fused with the Aim23p mitochondrial targeting sequence |
pmtIF3∆N | pRS317 with cloned MTIF3 gene lacking N-terminal extension |
pmtIF3∆C | pRS317 with cloned MTIF3 gene lacking C-terminal extension |
pmtIF3∆N∆C | pRS317 with cloned MTIF3 gene lacking N- and C-terminal extensions |
Strain | Genotype/Description |
---|---|
∆AIM23 | MATa mal (lys2, ura3) AIM23::KanMX4 D273-10B DUL2 with AIM23 genomic disruption |
Aim23 (“wild type” on Figures) | ∆AIM23 + pAim23 |
Aim23∆MTS | ∆AIM23 + pAim23∆MTS |
Aim23∆N | ∆AIM23 + pAim23∆N |
Aim23∆C | ∆AIM23 + pAim23∆C |
Aim23∆N∆C | ∆AIM23 + pAim23∆N∆C |
IF3 | ∆AIM23 + pIF3 |
IF3∆MTS | ∆AIM23 + pIF3∆MTS |
IF3N | ∆AIM23 + pIF3N |
IF3C | ∆AIM23 + pIF3C |
IF3NC | ∆AIM23 + pIF3NC |
mtIF3 | ∆AIM23 + pmtIF3 |
mtIF3∆N | ∆AIM23 + pmtIF3∆N |
mtIF3∆C | ∆AIM23 + pmtIF3∆C |
mtIF3∆N∆C | ∆AIM23 + pmtIF3∆N∆C |
1 | AIM23 gene cloning into pRS317 | gcatAAGCTTggctatcatgcatccattg |
2 | gcaTCTAGAcagcatttcggggcaac | |
3 | AIM23∆MTS cloning into pRS317: producing first (5’) PCR-product for further OE-PCR | gcatAAGCTTggctatcatgcatccattg |
4 | atccacggacctgatgtt | |
5 | AIM23∆MTS cloning into pRS317: producing second (3’) PCR-product for further OE-PCR | aggtccgtggatATGaatgcatcatctaccacag |
6 | gcaTCTAGAcagcatttcggggcaac | |
7 | AIM23∆N cloning into pRS317: producing first (5’) PCR-product for further OE-PCR | gcatAAGCTTggctatcatgcatccattg |
8 | gtctctgctgaagtattttg | |
9 | AIM23∆N cloning into pRS317: producing second (3’) PCR-product for further OE-PCR | tacttcagcagagactggagcaccgggacag |
10 | gcaTCTAGAcagcatttcggggcaac | |
11 | AIM23∆C cloning into pRS317: producing first (5’) PCR-product for further OE-PCR | gcatAAGCTTggctatcatgcatccattg |
12 | tggtttaacgtcctttggta | |
13 | AIM23∆C cloning into pRS317: producing second (3’) PCR-product for further OE-PCR | aaaggacgttaaaccataaatagaagcaaatgacatcag |
14 | gcaTCTAGAcagcatttcggggcaac | |
15 | AIM23∆N∆C cloning into pRS317: producing third (central) PCR-product for further OE-PCR | tacttcagcagagactggagcaccgggacag |
16 | tggtttaacgtcctttggta | |
17 | IF3 versions cloning into pRS317: producing IF3 for further OE-PCRs | aaaggcggaaaacgagttc |
18 | ctgtttcttcttaggagcg | |
19 | IF3 versions cloning into pRS317: fusing AIM23 5’-flank with IF3 for further OE-PCR | gcatAAGCTTggctatcatgcatccattg |
20 | cgttttccgcctttcatatccacggacctgatg | |
21 | IF3 versions cloning into pRS317: fusing AIM23 5’-flank and MTS with IF3 for further OE-PCR | gcatAAGCTTggctatcatgcatccattg |
22 | cgttttccgcctttgtctctgctgaagtattttgt | |
23 | IF3 versions cloning into pRS317: fusing AIM23 5’-flank, MTS, and N-terminal extension with IF3 for further OE-PCR | gcatAAGCTTggctatcatgcatccattg |
24 | cgttttccgcctttagtaatcaggatttttttcctg | |
25 | IF3 versions cloning into pRS317: fusing AIM23 3’-flank and C-terminal extension with IF3 for further OE-PCR | tcctaagaagaaacagcaaaacaacgataagagggc |
26 | gcaTCTAGAcagcatttcggggcaac | |
27 | IF3 versions cloning into pRS317: fusing AIM23 3’-flank with IF3 for further OE-PCR | Tcctaagaagaaacagtaaatagaagcaaatgacatcagaat |
28 | gcaTCTAGAcagcatttcggggcaac | |
29 | mtIF3 versions cloning into pRS317: fusing AIM23 5’-flank and MTS with mtIF3 | gcatGGGCCCggctatcatgcatccattg |
30 | tgtgctggtgctgtgtctctgctgaagtattttg | |
31 | mtIF3 versions cloning into pRS317: producing mtIF3 without MTS for further OE-PCR | acagcaccagcacagttg |
32 | gtcatttgcttctatttactgatgcagaacatttgattc | |
33 | mtIF3 versions cloning into pRS317: fusing AIM23 3’-flank with mtIF3 | taaatagaagcaaatgacatca |
34 | gcaTCTAGAcagcatttcggggcaac | |
35 | mtIF3∆N cloning into pRS317: producing first (5’) PCR-product for further OE-PCR | gcatGGGCCCggctatcatgcatccattg |
36 | ccttcattctgggtgtctctgctgaagtattttg | |
37 | mtIF3∆N cloning into pRS317: producing second (3’) PCR-product for further OE-PCR | acccagaatgaaggaaaaaag |
38 | gcaTCTAGAcagcatttcggggcaac | |
39 | mtIF3∆C cloning into pRS317: producing first (5’) PCR-product for further OE-PCR | gcatGGGCCCggctatcatgcatccattg |
40 | tttgctgaaagcacgaagaa | |
41 | mtIF3∆C cloning into pRS317: producing second (3’) PCR-product for further OE-PCR | cgtgctttcagcaaataaatagaagcaaatgacatcag |
42 | gcaTCTAGAcagcatttcggggcaac | |
43 | mtIF3∆N∆C cloning into pRS317: producing third (central) PCR-product for further OE-PCR | acccagaatgaaggaaaaaag |
44 | tttgctgaaagcacgaagaa | |
45 | Screening of pRS317-based constructs | gtaaaacgacggccagt |
46 | ggaaacagctatgaccatg |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Derbikova, K.; Kuzmenko, A.; Levitskii, S.; Klimontova, M.; Chicherin, I.; Baleva, M.V.; Krasheninnikov, I.A.; Kamenski, P. Biological and Evolutionary Significance of Terminal Extensions of Mitochondrial Translation Initiation Factor 3. Int. J. Mol. Sci. 2018, 19, 3861. https://doi.org/10.3390/ijms19123861
Derbikova K, Kuzmenko A, Levitskii S, Klimontova M, Chicherin I, Baleva MV, Krasheninnikov IA, Kamenski P. Biological and Evolutionary Significance of Terminal Extensions of Mitochondrial Translation Initiation Factor 3. International Journal of Molecular Sciences. 2018; 19(12):3861. https://doi.org/10.3390/ijms19123861
Chicago/Turabian StyleDerbikova, Ksenia, Anton Kuzmenko, Sergey Levitskii, Maria Klimontova, Ivan Chicherin, Maria V. Baleva, Igor A. Krasheninnikov, and Piotr Kamenski. 2018. "Biological and Evolutionary Significance of Terminal Extensions of Mitochondrial Translation Initiation Factor 3" International Journal of Molecular Sciences 19, no. 12: 3861. https://doi.org/10.3390/ijms19123861