Melatonin and Vitamin D Interfere with the Adipogenic Fate of Adipose-Derived Stem Cells
Abstract
:1. Introduction
2. Results
2.1. Melatonin Together with Vitamin D Counteract Adipose-Derived Mesenchymal Stem Cell (ADSC) Expression of Key Adipogenic Genes
2.2. Vitamin D and Melatonin Affect the Appearance of Adipogenic Specific Proteins
2.3. Melatonin and Vitamin D Inhibit Intracellular Lipid Accumulationin in ADSCs
3. Discussion
4. Materials and Methods
4.1. Cell Isolation and Maintenance
4.2. Identification of ADSCs after Culture
4.3. Characterization of Adipose-Derived Stem Cells
4.4. Adipose-Derived Stem Cells Culturing
4.5. RNA Extraction and Quantitative Polymerase Chain Reaction
4.6. Immunostaining
4.7. Red Oil Asssay
4.8. Statistical Analysis
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Shen, W.; Wang, Z.M.; Punyanita, M.; Lei, J.; Sinav, A.; Kral, J.G.; Imielinska, C.; Ross, R.; Heymsfield, S.B. Adipose tissue quantification by imaging methods: A proposed classification. Obes. Res. 2003, 11, 5–16. [Google Scholar] [CrossRef] [PubMed]
- Finelli, C.; Sommella, L.; Gioia, S.; la Sala, N.; Tarantino, G. Should visceral fat be reduced to increase longevity? Ageing Res. Rev. 2013, 12, 996–1004. [Google Scholar] [CrossRef] [PubMed]
- Vasan, S.K.; Karpe, F. Adipose tissue: Fat, yet fit. Nat. Rev. Endocrinol. 2016, 12, 375–376. [Google Scholar] [CrossRef] [PubMed]
- Poulos, S.P.; Hausman, D.B.; Hausman, G.J. The development and endocrine functions of adipose tissue. Mol. Cell. Endocrinol. 2010, 323, 20–34. [Google Scholar] [CrossRef] [PubMed]
- Rosen, E.D.; MacDougald, O.A. Adipocyte differentiation from the inside out. Nat. Rev. Mol. Cell Biol. 2006, 7, 885–896. [Google Scholar] [CrossRef] [PubMed]
- Moreno-Navarrete, J.M.; Fernández-Real, J.M. Adipose Tissue Biology; Symonds, M.E., Ed.; Springer and Science & Business Media LLC: New York, NY, USA, 2012; pp. 1–413. [Google Scholar]
- Augello, A.; de Bari, C. The regulation of differentiation in mesenchymal stem cells. Hum. Gene Ther. 2010, 21, 1226–1238. [Google Scholar] [CrossRef] [PubMed]
- Poulsom, R.; Alison, M.R.; Forbes, S.J.; Wright, N.A. Adult stem cell plasticity. J. Pathol. 2002, 197, 441–456. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Xiao, L.; Wang, C.; Gao, J.; Zhai, Y. Epigenetic regulation of adipocyte differentiation and adipogenesis. J. Zhejiang Univ. Sci. B 2010, 11, 784–791. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.N.; Park, J.S.; Woo, D.G.; Jeon, S.Y.; Do, H.J.; Lim, H.Y.; Kim, J.H.; Park, K.H. C/EBP-α and C/EBP-β-mediated adipogenesis of human mesenchymal stem cells (hMSCs) using PLGA nanoparticles complexed with poly(ethyleneimmine). Biomaterials 2011, 32, 5924–5933. [Google Scholar] [CrossRef] [PubMed]
- Moseti, D.; Regassa, A.; Kim, W.K. Molecular regulation of adipogenesis and potential anti-adipogenic bioactive molecules. Int. J. Mol. Sci. 2016, 17, 124. [Google Scholar] [CrossRef] [PubMed]
- Wood, R.J. Vitamin D and adipogenesis: New molecular insights. Nutr. Rev. 2008, 66, 40–46. [Google Scholar] [CrossRef] [PubMed]
- Chang, E.; Kim, Y. Vitamin D decreases adipocyte lipid storage and increases NAD-SIRT1 pathway in 3T3-L1 adipocytes. Nutrition 2016, 32, 702–708. [Google Scholar] [CrossRef] [PubMed]
- Dusso, A.S.; Brown, A.J.; Slatopolsky, E. Vitamin D. Am. J. Physiol. Ren. Physiol. 2005, 289, F8–F28. [Google Scholar] [CrossRef] [PubMed]
- Kawase, T.; Oguro, A. Granulocyte colony-stimulating factor synergistically augments 1,25-dihydroxyvitamin D3-induced monocytic differentiation in murine bone marrow cell cultures. Horm. Metab. Res. 2004, 36, 445–452. [Google Scholar] [CrossRef] [PubMed]
- Song, I.; Kim, B.S.; Kim, C.S.; Im, G., II. Effects of BMP-2 and vitamin D3 on the osteogenic differentiation of adipose stem cells. Biochem. Biophys. Res. Commun. 2011, 408, 126–131. [Google Scholar] [CrossRef] [PubMed]
- Hoshiba, T.; Kawazoe, N.; Chen, G. The balance of osteogenic and adipogenic differentiation in human mesenchymal stem cells by matrices that mimic stepwise tissue development. Biomaterials 2012, 33, 2025–2031. [Google Scholar] [CrossRef] [PubMed]
- Abbas, M.A. Physiological functions of Vitamin D in adipose tissue. J. Steroid Biochem. Mol. Biol. 2017, 165, 369–381. [Google Scholar] [CrossRef] [PubMed]
- Chang, E.; Kim, Y. Vitamin D insufficiency exacerbates adipose tissue macrophage infiltration and decreases AMPK/SIRT1 activity in obese rats. Nutrients 2017, 25, 338. [Google Scholar] [CrossRef] [PubMed]
- Valle, Y.L.; Almalki, S.G.; Agrawal, D.K. Vitamin D machinery and metabolism in porcine adipose-derived mesenchymal stem cells. Stem Cell Res. Ther. 2016, 7, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Radio, N.M.; Doctor, J.S.; Witt-Enderby, P.A. Melatonin enhances alkaline phosphatase activity in differentiating human adult mesenchymal stem cells grown in osteogenic medium via MT2 melatonin receptors and the MEK/ERK (1/2) signaling cascade. J. Pineal Res. 2006, 40, 332–342. [Google Scholar] [CrossRef] [PubMed]
- Kato, H.; Ochiai-Shino, H.; Onodera, S.; Saito, A.; Shibahara, T.; Azuma, T. Promoting effect of 1,25(OH)2 vitamin D3 in osteogenic differentiation from induced pluripotent stem cells to osteocyte-like cells. Open Biol. 2015, 5, 140201. [Google Scholar] [CrossRef] [PubMed]
- Sanchez-Hidalgo, M.; Lu, Z.; Tan, D.; Maldonado, M.D.; Reiter, R.J.; Gregerman, R.I. Melatonin inhibits fatty acid-induced triglyceride accumulation in ROS17/2.8 cells: Implications for osteoblast differentiation and osteoporosis. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2007, 292, R2208–R2215. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Gan, L.; Luo, D.; Sun, C. Melatonin promotes circadian rhythm-induced proliferation through Clock/histone deacetylase 3/c-Myc interaction in mouse adipose tissue. J. Pineal Res. 2017, 62. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Gan, L.; Xu, Y.; Luo, D.; Ren, Q.; Wu, S.; Sun, C. Melatonin alleviates inflammasome-induced pyroptosis through inhibiting NF-κB/GSDMD signal in mice adipose tissue. J. Pineal Res. 2017. [Google Scholar] [CrossRef] [PubMed]
- Maioli, M.; Basoli, V.; Santaniello, S.; Cruciani, S.; Delitala, A.P.; Pinna, R.; Milia, E.; Grillari-Voglauer, R.; Fontani, V.; Rinaldi, S.; et al. Osteogenesis from Dental Pulp Derived Stem Cells: A Novel Conditioned Medium Including Melatonin within a Mixture of Hyaluronic, Butyric, and Retinoic Acids. Stem Cells Int. 2016, 2016, 2056416. [Google Scholar] [CrossRef] [PubMed]
- Chatterjee, T.K.; Basford, J.E.; Yiew, K.H.; Stepp, D.W.; Hui, D.Y.; Weintraub, N.L. Role of histone deacetylase 9 in regulating adipogenic differentiation and high fat diet-induced metabolic disease. Adipocyte 2014, 3, 333–338. [Google Scholar] [CrossRef] [PubMed]
- Lowe, C.E.; O’Rahilly, S.; Rochford, J.J. Adipogenesis at a glance. J. Cell Sci. 2011, 124, 2681–2686. [Google Scholar] [CrossRef] [PubMed]
- Kim, W.-S.; Han, J.; Hwang, S.-J.; Sung, J.-H. An update on niche composition, signaling and functional regulation of the adipose-derived stem cells. Expert Opin. Biol. Ther. 2014, 14, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Cawthorn, W.P.; Scheller, E.L.; MacDougald, O.A. Adipose tissue stem cells meet preadipocyte commitment: Going back to the future. J. Lipid Res. 2012, 53, 227–246. [Google Scholar] [CrossRef] [PubMed]
- Luchetti, F.; Canonico, B.; Bartolini, D.; Arcangeletti, M.; Ciffolilli, S.; Murdolo, G.; Piroddi, M.; Papa, S.; Reiter, R.J.; Galli, F. Melatonin regulates mesenchymal stem cell differentiation: A review. J. Pineal Res. 2014, 56, 382–397. [Google Scholar] [CrossRef] [PubMed]
- Toda, S.; Uchihashi, K.; Aoki, S.; Sonoda, E.; Yamasaki, F.; Piao, M.; Ootani, A.; Yonemitsu, N.; Sugihara, H. Adipose tissue-organotypic culture system as a promising model for studying adipose tissue biology and regeneration. Organogenesis 2009, 5, 50–56. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.H.; Kumar, S.; Barnett, A.H.; Eggo, M.C. Ceiling culture of mature human adipocytes: Use in studies of adipocyte functions. J. Endocrinol. 2000, 164, 119–128. [Google Scholar] [CrossRef] [PubMed]
- Maioli, M.; Rinaldi, S.; Santaniello, S.; Castagna, A.; Pigliaru, G.; Delitala, A.; Bianchi, F.; Tremolada, C.; Fontani, V.; Ventura, C. Radio Electric Asymmetric Conveyed Fields and Human Adipose-Derived Stem Cells Obtained With a Non-Enzymatic Method and Device: A Novel Approach To Multipotency. Cell Transplant. 2013, 23, 1–34. [Google Scholar]



| Primer Name | Forward | Reverse |
|---|---|---|
| GAPDH | GAGTCAACGGATTTGGTCGT | GACAAGCTTCCCGTTCTCAG |
| aP2 | AGACATTCTACGGGCAGCAC | TCATTTTCCCACTCCAGCCC |
| PPAR-γ | AATCCGTCTTCATCCACAGG | GTGAAGACCAGCCTCTTTGC |
| LPL | CAGGATGTGGCCCGGTTTAT | GGGACCCTCTGGTGAATGTG |
| ACOT2 | GAGGTCTTCACACTGCACCA | TCTTGGCCTCGAATGGTATC |
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Basoli, V.; Santaniello, S.; Cruciani, S.; Ginesu, G.C.; Cossu, M.L.; Delitala, A.P.; Serra, P.A.; Ventura, C.; Maioli, M. Melatonin and Vitamin D Interfere with the Adipogenic Fate of Adipose-Derived Stem Cells. Int. J. Mol. Sci. 2017, 18, 981. https://doi.org/10.3390/ijms18050981
Basoli V, Santaniello S, Cruciani S, Ginesu GC, Cossu ML, Delitala AP, Serra PA, Ventura C, Maioli M. Melatonin and Vitamin D Interfere with the Adipogenic Fate of Adipose-Derived Stem Cells. International Journal of Molecular Sciences. 2017; 18(5):981. https://doi.org/10.3390/ijms18050981
Chicago/Turabian StyleBasoli, Valentina, Sara Santaniello, Sara Cruciani, Giorgio Carlo Ginesu, Maria Laura Cossu, Alessandro Palmerio Delitala, Pier Andrea Serra, Carlo Ventura, and Margherita Maioli. 2017. "Melatonin and Vitamin D Interfere with the Adipogenic Fate of Adipose-Derived Stem Cells" International Journal of Molecular Sciences 18, no. 5: 981. https://doi.org/10.3390/ijms18050981
APA StyleBasoli, V., Santaniello, S., Cruciani, S., Ginesu, G. C., Cossu, M. L., Delitala, A. P., Serra, P. A., Ventura, C., & Maioli, M. (2017). Melatonin and Vitamin D Interfere with the Adipogenic Fate of Adipose-Derived Stem Cells. International Journal of Molecular Sciences, 18(5), 981. https://doi.org/10.3390/ijms18050981

