Next Article in Journal
Mitochondrial Oxidative Stress, Mitochondrial DNA Damage and Their Role in Age-Related Vascular Dysfunction
Previous Article in Journal
MD Simulations of tRNA and Aminoacyl-tRNA Synthetases: Dynamics, Folding, Binding, and Allostery
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 16
Issue 7
10.3390/ijms160715903
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Over-Expression of Rice CBS Domain Containing Protein, OsCBSX3, Confers Rice Resistance to Magnaporthe oryzae Inoculation

by
Shaoliang Mou
1,2,
Lanping Shi
2,3,
Wei Lin
1,
Yanyan Liu
2,3,
Lei Shen
2,3,
Deyi Guan
2,3 and
Shuilin He
2,3,*
1
College of Life Science, Fujian Agriculture and Forestry University, Fuzhou 350002, China
2
National Education Minster Key Laboratory of Plant Genetic Improvement and Comprehensive Utilization, Fujian Agriculture and Forestry University, Fuzhou 350002, China
3
College of Crop Science, Fujian Agriculture and Forestry University, Fuzhou 350002, China
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2015, 16(7), 15903-15917; https://doi.org/10.3390/ijms160715903
Submission received: 6 June 2015 / Revised: 3 July 2015 / Accepted: 9 July 2015 / Published: 13 July 2015
(This article belongs to the Section Biochemistry)
Browse Figures
Versions Notes

Abstract

:
Cystathionine β-synthase (CBS) domain containing proteins (CDCPs) constitute a big family in plants and some members in this family have been implicated in a variety of biological processes, but the precise functions and the underlying mechanism of the majority of this family in plant immunity remain to be elucidated. In the present study, a CBS domain containing protein gene, OsCBSX3, is functionally characterized in rice resistance against Magnaporthe oryzae (M. oryzae). By quantitative real-time PCR, transcripts of OsCBSX3 are up-regulated significantly by inoculation of M. oryzae and the exogenously applied salicylic acid (SA) and methyl jasmonate (MeJA). OsCBSX3 is exclusively localized to the plasma membrane by transient expression of OsCBSX3 fused to green fluorescent protein (GFP) through approach of Agrobacterium infiltration in Nicotiana benthamiana leaves. The plants of homozygous T3 transgenic rice lines of over-expressing OsCBSX3 exhibit significant enhanced resistance to M. oryzae inoculation, manifested by decreased disease symptoms, and inhibition of pathogen growth detected in DNA. Consistently, the over-expression of OsCBSX3 enhances the transcript levels of immunity associated marker genes including PR1a, PR1b, PR5, AOS2, PAL, NH1, and OsWRKY13 in plants inoculated with M. oryzae. These results suggest that OsCBSX3 acts as a positive regulator in resistance of rice to M. oryzae regulated by SA and JA-mediated signaling pathways synergistically.

Graphical Abstract

1. Introduction

As sessile organisms, plants are continuously encountered by attacks of different potentially pathogentic microbes, and have developed defense systems to cope with these pathogens. Data from transcriptomics and proteomics studies show that a great many genes or proteins are involved in the response of plants to pathogen attack [1,2,3,4,5]. Although a zigzag concept model including pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI) and effector-triggered immunity (ETI), which extensively share signaling machinery, have been established [6,7,8,9,10,11], the majority of the components and their precise role in plant inducible immunity remain uninvestigated. Functional characterization of these components may lead to the discovery of novel or alternate pathways.
Cystathionine β-synthase (CBS) domain, firstly identified in the genome of an archaebacterium Methanococcus jannaschii [12], has also been reported in yeast and animal systems that play roles in proteins of diverse functions including cytoplasmic targeting, subcellular localization of chloride channels (ClC), protein–protein interaction, protein regulation, sensors of cellular energy status, and intracellular ionic strength [12]. CBS domain containing proteins (CDCPs) have been found in eubacteria and eukaryotes [13], which containing CBS domains generally in tandem repeats, form a gene family with 34 and 59 members in Arabidopsis and rice, respectively [14]. AKINbc, a CDCP of Arabidopsis containing four CBS domains, interacted with AKINa1 and a2 kinases and its fourth CBS domain was found to be essential but not sufficient for interaction with kinases [15]. CBS domain containing proteins (CBSX1 CBSX2 and CBSX3) were found to be ubiquitous redox regulators that regulate thioredoxins in the ferredoxin-Trx system and NADP (nicotinamide adenine dinucleotide phosphate)-Trx system to modulate development and maintain homeostasis under conditions that are threatening to the cell [16]. Hybrid four-CBS-domain KINβγ subunit functions as the canonical gamma subunit of the plant energy sensor SnRK1 (SNF1-related kinase 1) [17]. OsCBSX4, a CBS domain containing protein in rice, was found that its over-expression in transgenic tobacco plants improved tolerance to salt, heavy metal, and oxidative stress [18]. OsBi1 encoding a protein containing CBS-like domain was found to be induced by herbivore feeding [19]. By transcriptomic and proteomic studies, proteins containing CBS domains exhibited differential expressional profiles in plants challenged with virus [20], fungi [21], salinity stress [22,23], and oxalic acid treatment [24]. All these data indicate that the members in this family in different plant species may play important roles in plant response to stresses. However, so far only a small number of CBS domain containing proteins have been functionally identified, the majority members in this family remain uninvestigated, especially in their role in plant immunity.
Rice (Oryza sativa) is one of the most important crops worldwide. Rice blast, caused by Magnaporthe oryzae, is the most destructive disease in rice production in China and other rice-growing regions [25]. The fungus is a filamentous ascomycete with a broad host range and leads to critically decrease in both rice yield and quality [26], and it destroys enough rice to feed more than 60 million people annually [27]. For decades, efforts to solve the problem caused by this disease have been focused on molecular mechanism studies of blast resistance, which may benefit the development of blast resistant rice varieties. However, the knowledge in this field is still limited. In the present study, we describe that a rice CDCP gene OsCBSX3, which is transcriptionally up-regulated by M. oryzae, acts as positive regulator in the response of rice to M. oryzae in a salicylic acid and jasmonate dependent manner.

2. Results

2.1. The Sequence Analysis of OsCBSX3 (Cystathionine β-Synthase (CBS) Domain Containing Protein 3)

A TDF (transcript derived fragment), which harbored two CBS domains, was found previously in our lab by cDNA-AFLP (restriction fragment length polymorphism) analysis of rice against the inoculation of M. oryzae. For cDNA-AFLP analysis, 16 pairs of primers were used for selective PCR amplification and total 12,000 TDFs were acquired. Among them, 240 differential TDFs were isolated and sequenced. In the present study, the full length cDNA of this TDF was identified by genome sequence search, and was further cloned by PCR amplification from cDNA library of Nipponbare with specific primers according to the full length cDNA, which was further cloned to pMD18-T vector and sequenced. The result showed that the full length of OsCBSX3 cDNA harboring an open reading frame 639 bps in length encoded a protein with 213 amino acids, which accordingly contained two CBS domains by SMART server (http://smart.embl-heidelberg.de/). Alignment analysis of the deduced amino acid sequence of the full length cDNA revealed that it shared 92.9%, 79.3%, 79.3%, and 75.2% identity with Oryza brachyantha (LOC102720769), Setaria italica (LOC101778698), Brachypodium distachyon (LOC100834804) and Zea mays (LOC100282160) (Figure 1), respectively.

2.2. Transcript Levels of OsCBSX3 Enhanced in Response to M. oryzae Inoculation and Exogenous Application of Salicylic Acid (SA) and Methyl Jasmonate (MeJA)

To test if OsCBSX3 was involved in pathogen defense, OsCBSX3 transcript levels were measured in rice leaves of Nipponbare after inoculation with strain guy11 of M. oryzae. Transcript levels were measured by real-time PCR at different dpi (days post inoculation). The result showed that transcript levels of OsCBSX3 enhanced significantly during 1 to 5 dpi of M. oryzae, with a rapid increase of approximate 9.5-fold at 1 dpi compared to that in mock-treated control plants. The effects of exogenous application of SA and methyl jasmonate (MeJA) in rice plants were detected by real time PCR with SA-dependent marker gene PR1a and JA-dependent basic PR1 (PR1b) gene [28,29]. The results showed that, in response to exogenously applied 100 µM SA, transcripts of OsCBSX3 enhanced significantly during 3–24 hpt (hours post treatment), with maximal levels of approximately 32.2-fold at 6 hpt compared to that in mock-treated control plants. After treatment with 100 µM MeJA, OsCBSX3 transcripts enhanced approximately 1.8- and 4.1-fold at 6- and 12-hpi, compared to that in mock-treated control plants (Figure 2).
Ijms 16 15903 g001 1024
Figure 1. Multiple sequence alignment of the amino acid sequence of OsCBSX3 (cystathionine β-synthase (CBS) domain containing protein 3) and its homolog protein. The CBS domain is underlined predicted by SMART server (http://smart.embl-heidelberg.de/). OsCBSX3 homolog proteins are from Oryza brachyantha (ObCBSX3), Setaria italica (SiCBSX3), Brachypodium distachyon (BdCBSX3) and Zea mays (ZmCBSX3). Sequeneces identical or similar are highlighted in black and red, respectively.
Figure 1. Multiple sequence alignment of the amino acid sequence of OsCBSX3 (cystathionine β-synthase (CBS) domain containing protein 3) and its homolog protein. The CBS domain is underlined predicted by SMART server (http://smart.embl-heidelberg.de/). OsCBSX3 homolog proteins are from Oryza brachyantha (ObCBSX3), Setaria italica (SiCBSX3), Brachypodium distachyon (BdCBSX3) and Zea mays (ZmCBSX3). Sequeneces identical or similar are highlighted in black and red, respectively.
Ijms 16 15903 g001
Ijms 16 15903 g002a 1024Ijms 16 15903 g002b 1024
Figure 2. Quantitative PCR analysis of relative OsCBSX3 transcript levels in rice plants exposed to pathogens and exogenous hormones.(A) OsCBSX3 transcripts tested at different time points in the rice leaves after inoculation with M. oryzae strain guy11; (B–E) OsCBSX3 transcripts examined in rice leaves at various time periods after treatment with salicylic acid (SA) (100 μM) or methyl jasmonate (MeJA) (100 μM). OsPR1a or OsPR1b genes were used as positive controls, respectively. (A–E) Transcript levels of OsCBSX3 or marker genes in pathogen- or hormone-treated rice plants were normalized to those in mock-treated control plants, which were set to a relative expression level of “1”. Error bars indicate the standard error; the experiments were repeated three times along with at least three independent repetitions of the biological experiments. Asterisks indicate significant differences (Student–Newman–Keuls test, * p < 0.05 or ** p < 0.01).
Figure 2. Quantitative PCR analysis of relative OsCBSX3 transcript levels in rice plants exposed to pathogens and exogenous hormones.(A) OsCBSX3 transcripts tested at different time points in the rice leaves after inoculation with M. oryzae strain guy11; (B–E) OsCBSX3 transcripts examined in rice leaves at various time periods after treatment with salicylic acid (SA) (100 μM) or methyl jasmonate (MeJA) (100 μM). OsPR1a or OsPR1b genes were used as positive controls, respectively. (A–E) Transcript levels of OsCBSX3 or marker genes in pathogen- or hormone-treated rice plants were normalized to those in mock-treated control plants, which were set to a relative expression level of “1”. Error bars indicate the standard error; the experiments were repeated three times along with at least three independent repetitions of the biological experiments. Asterisks indicate significant differences (Student–Newman–Keuls test, * p < 0.05 or ** p < 0.01).
Ijms 16 15903 g002aIjms 16 15903 g002b

2.3. OsCBSX3 Is Localized in the Plasma Membrane

To determine the subcellular localization of OsCBSX3, OsCBSX3 was fused to the green fluorescent protein (GFP) gene under control of 35S promoter, the resulting construct was transformed into Agrobacterium strain GV3101 and infiltrated into N. benthamiana leaves. The GFP signal was detected with fluorescence microscope (Olympus DP72), the result showed that the GFP signal was exclusively found in the plasma membrane (Figure 3).
Ijms 16 15903 g003 1024
Figure 3. Subcellular localization of OsCBSX3 protein in N. benthamiana leaves. OsCBSX3-GFP (green fluorescent protein) exclusively localized in the plasma membrane of cell in N. benthamiana leaves. GFP alone localized throughout the whole cells. Cells were detected for GFP fluorescence by fluorescence microscopy 48 h after agroinfiltration. Scale bars =10 µm.
Figure 3. Subcellular localization of OsCBSX3 protein in N. benthamiana leaves. OsCBSX3-GFP (green fluorescent protein) exclusively localized in the plasma membrane of cell in N. benthamiana leaves. GFP alone localized throughout the whole cells. Cells were detected for GFP fluorescence by fluorescence microscopy 48 h after agroinfiltration. Scale bars =10 µm.
Ijms 16 15903 g003

2.4. Over-Expression of OsCBSX3 in Transgenic Rice Plants Conferred Enhanced Resistance to M. oryzae Inoculation

Since OsCBSX3 transcripts are transcriptionally upregulated by M. oryzae inoculation and by exogenous applied SA and MeJA. It appeared that OsCBSX3 plays a role in rice immunity against M. oryzae attack. To confirm this possibility, we generated transgenic rice T3 homozygous lines constitutively expressing OsCBSX3 driven by the maize ubiquitin promoter. A total of sixteen T3 lines were acquired, and no phenotypic difference was observed between OsCBSX3-OE (over-expression) T3 lines and wildtype (Nipponbare) rice plants. Among the sixteen lines, two higher expression lines (lines #1 and #3) were chosen for further assay (Figure 4A). M. oryzae strain guy11 was used to evaluate the resistance of the OsCBSX3-OE lines and wildtype plants to rice blast disease. All of the rice plants at four-leaf stage were inoculated with guy11, and grown in a greenhouse. The rice blast symptoms were observed at 5 dpi, the two OsCBSX3-OE lines showed fewer and smaller expanding lesions compared to the wild type plants (Figure 4B). The growth of M. oryzae was detected by measuring the total DNA of M. oryzae in the inoculated rice leaves, and the results showed that growth of M. oryzae was significantly inhibited in OsCBSX3-OE lines compared to that in the wild type plants (Figure 4C) Wild type rice plants began to wilt at 20 dpi, some plants were dead at 35 dpi. In contrast, all of OsCBSX3-OE rice lines survived with decreased disease symptoms compared to those in wild-type plants (Figure 4D).
Ijms 16 15903 g004a 1024Ijms 16 15903 g004b 1024
Figure 4. Over-expression of OsCBSX3 enhanced rice resistance to blast fungus. (A) Quantitative PCR analysis of OsCBSX3 expression in wildtpye (WT) and over-expression plants (#1 and #3). Data are means ± SE with three independent experiments. Asterisks indicate significant differences (Student–Newman–Keuls test, * p < 0.05 or ** p < 0.01); (B) Lesion in leaves at 6 dpi (days post inoculation). Numbers of expanding lesions (Els) with an area greater than 0.5 mm2 per leaf and their mean areas were determined using ten leaves for WT and OsCBSX3-OE plants. Values given are means ± SE; (C) The amounts of M. oryzae DNA in the WT and OsCBSX3-OE rice leaves. The leaves were harvested at 6 dpi. Values were means ± SE of three independent experiments; (D) Symptom of rice blast in OsCBSX3-OE and WT rice plants at 30 dpi of spores of M. oryzae stain guy11 in greenhouse.
Figure 4. Over-expression of OsCBSX3 enhanced rice resistance to blast fungus. (A) Quantitative PCR analysis of OsCBSX3 expression in wildtpye (WT) and over-expression plants (#1 and #3). Data are means ± SE with three independent experiments. Asterisks indicate significant differences (Student–Newman–Keuls test, * p < 0.05 or ** p < 0.01); (B) Lesion in leaves at 6 dpi (days post inoculation). Numbers of expanding lesions (Els) with an area greater than 0.5 mm2 per leaf and their mean areas were determined using ten leaves for WT and OsCBSX3-OE plants. Values given are means ± SE; (C) The amounts of M. oryzae DNA in the WT and OsCBSX3-OE rice leaves. The leaves were harvested at 6 dpi. Values were means ± SE of three independent experiments; (D) Symptom of rice blast in OsCBSX3-OE and WT rice plants at 30 dpi of spores of M. oryzae stain guy11 in greenhouse.
Ijms 16 15903 g004aIjms 16 15903 g004b

2.5. Over-Expression of OsCBSX3 Up-Regulated the Transcript Levels of Defense Marker Genes

To further confirm the role of OsCBSX3 in disease resistance and to assay its possible mode of action, the transcriptional response of a set of pathogen-induced genes in OsCBSX3 over-expression rice plants were investigated by real-time PCR. These immunity marker genes including Phenylalanine ammonia lyase (PAL; X87946) involved in SA synthesis, Acidic pathogenesis-related (PR) protein 1 (PR1a; AJ278436), PR5 (thaumatin-like protein; X68197), and NH1 (Arabidopsis NPR1 homolog 1; AY9123983) are response to SA [30,31,32,33]. JA associated Allene oxide synthase 2 (AOS2; AY062258) [34] and PR1b (basic PR protein 1; U89895) [30,32] as well as OsWRKY13, a WRKY transcriptional factor that act as positive regulators in rice immunity by previous study [30]. Our data showed that the transcript levels of PR1a, PR1b, PR5, AOS2, and PAL were increased in OsCBSX3 over-expression plants in response to M. oryzae infection, the transcripts of PR1a, PR1b, PR5, AOS2 accumulated to significantly higher levels with and without M. oryzae inoculation in OsCBSX3 over-expression plants compared to those in wild-type plants, PAL and NH1 were only enhanced by over-expression of OsCBSX3 with M. oryzae inoculation (Figure 5).
Ijms 16 15903 g005 1024
Figure 5. Quantitative PCR analysis of relative expression levels of pathogen-related genes in leaves of wildtype plants and OsCBSX3 over-expression lines at 0 and 4 dpi of M. oryzae strain guy11. Bars represent mean ± SE of three biological replicates. Asterisks indicate significant differences between the OsCBSX3-OE and wildtype plants in the same time point (Student–Newman–Keuls test, * p < 0.05 or ** p < 0.01).
Figure 5. Quantitative PCR analysis of relative expression levels of pathogen-related genes in leaves of wildtype plants and OsCBSX3 over-expression lines at 0 and 4 dpi of M. oryzae strain guy11. Bars represent mean ± SE of three biological replicates. Asterisks indicate significant differences between the OsCBSX3-OE and wildtype plants in the same time point (Student–Newman–Keuls test, * p < 0.05 or ** p < 0.01).
Ijms 16 15903 g005

3. Discussion

Although CDCPs constitute a big family in plants and some members in this family have been implicated in a variety of biological processes, the precise functions and the underlying mechanism of the majority of this family in plant immunity remain to be investigated. In the present study, we provide evidence that OsCBSX3, a member of CDCPs in rice, plays a positive role in the response of rice to M. oryzae attack. Moreover, OsCBSX4 over-expressing transgenic tobacco plants exhibit higher abiotic stress tolerance [18]. Microarray expression data showed that some members of this family were transcriptionally altered in response to various stresses such as salinity, drought, cold, high temperature, UV, wounding and genotoxic stress [14]. So CDCPs might play an important role in biotic or abiotic stress tolerance.
Two CBS domains forming a pair were found to be present in the deduced amino acid sequence of OsCBSX3, and a high sequence similarity to other CBS domain containing proteins from rice or other plants was also found, suggesting that it is a member of the CDCP family in rice. However, unlike AtCBSX3 in Arabidopsis that was predicted to localize to the mitochondria, AtCBSX4 to the cytosol [16], OsCBSX3 is found to target to the plasma membrane. Consistently, the OsCBSX4 in rice was also found to be localized to the plasma membrane [18]. The transcriptionally up-regulation of OsCBSX3 by the M. oryzae inoculation implies its functional association to rice’s response to M. oryzae attack, since genes involved in plant immunity generally possess pathogen inducible expressional features and a close relationship has been frequently found in the expression profiling and the role in immunity of a great number of immunity associated genes [35,36]. The possible role of OsCBSX3 in rice immunity against M. oryzae is further confirmed by gain of function analysis using OsCBSX3 over-expressing rice plants of homozygous T3 transgenic lines, the result demonstrates that the susceptibility of rice plants to M. oryzae attack is significantly decreased by over-expression of OsCBSX3, manifested by decreased disease symptoms, inhibition of pathogen growth. Consistently, PR1a, PR1b, PR5, AOS2, PAL, and NH1, which have been found to act as positive regulators in rice immunity and generally used a marker genes in rice immunity [30,32], are found to be enhanced in M. oryzae challenged OsCBSX3 over-expressing transgenic rice plants. OsWRKY13, over-expression of which enhanced rice resistance to bacterial blight and fungal blast [35], is also found to be enhanced by the over-expression of OsCBSX3. All of these data suggest that OsCBSX3 acts as positive regulator in response of rice to M. oryzae attack.
Plant defense against pathogens form a comprehensive network of interacting signal transduction pathways, the signaling molecules salicylic acid (SA) and jasmonic acid (JA) play important roles in this network. Both synergistic and antagonistic interactions have been observed between SA- and JA-dependent defenses [37,38,39]. Our data showed that the expression of OsCBSX3 is transcriptionally induced by exogenous application of SA and MeJA. Consistently, SA-dependent PR1a and JA responsive PR1b are enhanced by the over-expression of OsCBSX3 in transgenic rice plants, suggesting that the defense reaction mediated by OsCBSX3 is SA and JA synergistically dependent. This speculation is consistent with the data that OsWRKY13 is triggered by the over-expression of OsCBSX3, and with previous study, OsWRKY13 was synergistically regulated by SA- and JA-dependent signaling pathways [30].
Interestingly, the immunity associated genes such as NH1 and PAL are only transcriptionally enhanced by over-expression of OsCBSX3 under the challenge of M. oryzae inoculation, but not in the M. oryzae un-challenged transgenic plants. It suggests that the transcriptional upregulation of these genes need other component that is activated by M. oryzae inoculation. Additionally, although the transcript level of OsCBSX3 in OsCBSX3-OE lines is lower than that in the wild type plants during M. oryzae infection, the OsCBSX3-OE lines exhibited significantly enhanced resistance to M. oryzae inoculation, suggesting that a high transcript level of OsCBSX3 prior to M. oryzae infection is important for rice resistance to M. oryzae.
Collectively, our data in the present study show that OsCBSX3 are upregulated transcriptionally by M. oryzae attack and acts as a positive regulator in rice resistance to M. oryzae.

4. Experimental Section

4.1. Plant Growth and Treatments

Rice (Oryza sativa L. japonica) Nipponbare and Nicotiana benthamiana seedlings were grown in a greenhouse at Fujian Agriculture and Forestry University (Fuzhou, China) under 25/27 °C (night/day). For inoculation of rice plants with the pathogen, three-week-old seedlings leaves were sprayed with a suspension of conidia (1 × 105 mL−1) of Magnaporthe oryzae strain guy11. For exogenous phytohormone treatment, SA (100 µM in 10% ethanol), or 100 µM MeJA (in 10% ethanol) was sprayed on the leaves. All experiments were performed independently three times, and the data from these experiments were subjected to statistical analysis using DPS software (Reifeng information technology Corporation, Hangzhou, China).

4.2. Cloning, Plasmid Construction and Rice Transformation

The OsCBSX3 gene (LOC_Os02g57280) cDNA was PCR amplified using cDNA library from rice (Oryza sativa L. japonica) Nipponbare leaves inoculated with guy11 as template with CBSX3F (5′-ATGGCCTGCATCAACACA-3′) and CBSX3R (5′-CTAAACCTCCAGCAGGGC-3′) primers, the amplified product was further cloned into the pMD18-T vector and sequenced. OsCBSX3 cDNA was amplified by PCR with Kpn I–Spel I linker primers using pMD18T-OsCBSX3 as the template, which was further cloned into the Kpn I and Spel I sites of the modified binary expression vector pCAMBIA1390 under the control of the maize ubiquitin promoter. The transgenic rice plants were obtained by Agrobacterium-mediated transformation [40] and confirmed by PCR with specific primer. The T0 transgenic rice plants were grown in the greenhouse and the seeds were harvested. The transgenic T1 seeds were selected with 50 mg/L hygromycin and grown in greenhouse for seeds of individual T2 lines, which was selected with hygromycin and grown to harvest for seeds of individual T3 lines.

4.3. RNA Isolation and Quantitative Real-Time PCR (qRT-PCR)

Total RNA from rice leaves was isolated using the TRIzol Reagent (Invitrogen, Carlsbad, CA, USA). Moloney Murine Leukemia Virus (M-MLV) Reverse Transcriptase (Invitrogen) was used for cDNA synthesis according to the manufacturer’s protocol. Real-time PCR using Mastercycler ep realplex (Eppendorf, Hamburg, Germany) was performed with SYBR® Premix Ex Taq™ II (TaKaRa, Dalian, China). Each reaction (25 μL) consisted of 12.5 μL SYBR Premix Ex Taq, 0.5 μL PCR forward/reverse gene specific primers (10 μM) 2.5 μL diluted cDNA and 9.5 μL water. qRT-PCR cycling conditions were as follows: 1 cycle of 30 s at 95 °C; 40 cycles of 5 s at 95 °C, 34 s at 60 °C; 1 cycle of 15 s at 95 °C, 1 min at 60 °C, 15 s at 95 °C, 15 s at 60 °C. For each gene, three experimental replicates were obtained using different cDNAs synthesized from at least three biological replicates. To normalization the variance in the RNA quality and cDNA input, rice Actin gene (X15865) was used as the internal control in each case. The relative expression levels were determined as described by Livak and Schmittgen [41].
Table
Table 1. Primers information for real-time PCR.
Table 1. Primers information for real-time PCR.
Gene NameForward Primer Sequence (5′–3′)Reverse Primer Sequence (5′–3′)
CBSX3GAGGAGGTTGAGTGCCACTTTGGCCGCATCCATTACTGTTTTGTC
PR1aCGTCTTCATCACCTGCAACTACTCCATGCATAAACACGTAGCATAGCA
PR1bGGCAACTTCGTCGGACAGACCGTGGACCTGTTTACATTTTCA
PR5CAACAGCAACTACCAAGTCGTCTTCAAGGTGTCGTTTTATTCATCAACTTT
NH1CACGCCTAAGCCTCGGATTATCAGTGAGCAGCATCCTGACTAG
WRKY13TCAGTGGAGAAGCGGGTGGTGGGGTGGTTGTGCTCGAAGGAG
AOS2CAATACGTGTACTGGTCGAATGGAAGGTGTCGTACCGGAGGAA
PALAGCACATCTTGGAGGGAAGCTGCGCGGATAACCTCAATTTG
ActinTGTATGCCAGTGGTCGTACCACCAGCAAGGTCGAGACGAA

4.4. Subcellular Locatization

OsCBSX3 cDNA without its stop codon was amplified and fused in frame to the N-terminus of the green fluorescent protein (GFP) gene to generate the CaMV35S:OsCBSX3-GFP construct by Gateway-mediated recombination into the vector pMDC83 [42]. The CaMV35S:GFP construct was used as the control. Both constructs were further transformed into Agrobacterium tumefaciens strain GV3101. Nicotiana benthamian leaves were infiltrated with Agrobacterium cultures. One day after agro-infiltration, Green fluorescent protein fluorescence was visualized using a fluorescence microscope (Olympus DP72, Olympus Corporation, Tokyo, Japan) with an excitation wavelength of 488 nm and a 505–530 nm bandpass emission filter.

4.5. Quantification of M. oryzae DNA in Rice Leaves

Infected rice leaves were detached at five days post-inoculation of Magnaporthe oryzae, rice and fungal DNA were extracted and quantified by real-time PCR according to the method of Qi and Yang [43]. A specific pair of DNA primers (5′-GGGATGATGGTGGTGGAGGAC-3′; 5′-GCCAGGTGCTTAGGACGAAAC-3′) were designed based on the 3′ non-coding region of a MPG1 gene in M. oryzae. The data were normalized to the amount of DNA of a rice actin gene (AK060893), which was quantified using the forward primer (5′-GAGTATGATGAGTCGGGTCCAG-3′) and reverse primer (5′-ACACCAACAATCCCAAACAGAG-3′).

5. Conclusions

A CBS domain containing protein gene, OsCBSX3, was identified and its involvement in rice resistance against M. oryzae was characterized. OsCBSX3 gene expression was up-regulated significantly by inoculation of M. oryzae and the exogenously applied salicylic acid (SA) and methyl jasmonate (MeJA). OsCBSX3 was exclusively localized to the plasma membrane. The transgenic plants of OsCBSX3 over-expression exhibited significant enhanced resistance to M. oryzae inoculation. Consistently, the over-expression of OsCBSX3 enhanced the transcript levels of immunity associated marker genes including PR1a, PR1b, PR5, AOS2, PAL, NH1, and OsWRKY13. These results suggested that OsCBSX3 acted as a positive regulator in rice resistance to M. oryzae. Our work will help us better understand the molecular mechanisms in rice resistance to M. oryzae.

Acknowledgments

We thank Xiaofeng Chen in Fungus Lab at Fujian Agriculture and Forestry University (Fuzhou, China) for kindly providing M. oryzae strain guy11. Furthermore, this research was supported by grants from the National Science Foundation of China (31301254 and 31372061), Fujian Natural Science Foundation (2014J01077) and Fujian Provincial Education Department Fund (JA13107).

Author Contributions

Conceived and designed the experiments: Shaoliang Mou and Shuilin He. Performed the experiments: Shaoliang Mou, Lanping Shi, Wei Lin, Yanyan Liu and Lei Shen. Analyzed the data: Shaoliang Mou, Lanping Shi, Wei Lin, Yanyan Liu, Lei Shen and Deyi Guan. Wrote the paper: Shaoliang Mou and Shuilin He. Provided guidance on the whole study: Shuilin He.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Ali, A.; Alexandersson, E.; Sandin, M.; Resjo, S.; Lenman, M.; Hedley, P.; Levander, F.; Andreasson, E. Quantitative proteomics and transcriptomics of potato in response to Phytophthora infestans in compatible and incompatible interactions. BMC Genomics 2014, 15, 497. [Google Scholar] [CrossRef] [PubMed]
  2. Rosli, H.G.; Zheng, Y.; Pombo, M.A.; Zhong, S.; Bombarely, A.; Fei, Z.; Collmer, A.; Martin, G.B. Transcriptomics-based screen for genes induced by flagellin and repressed by pathogen effectors identifies a cell wall-associated kinase involved in plant immunity. Genome Biol. 2013, 14, R139. [Google Scholar] [CrossRef] [PubMed]
  3. Mathioni, S.M.; Patel, N.; Riddick, B.; Sweigard, J.A.; Czymmek, K.J.; Caplan, J.L.; Kunjeti, S.G.; Kunjeti, S.; Raman, V.; Hillman, B.I.; et al. Transcriptomics of the rice blast fungus Magnaporthe oryzae in response to the bacterial antagonist Lysobacter enzymogenes reveals candidate fungal defense response genes. PLoS ONE 2013, 8, e76487. [Google Scholar] [CrossRef] [PubMed]
  4. Rudd, J.J.; Kanyuka, K.; Hassani-Pak, K.; Derbyshire, M.; Andongabo, A.; Devonshire, J.; Lysenko, A.; Saqi, M.; Desai, N.M.; Powers, S.J.; et al. Transcriptome and metabolite profiling of the infection cycle of Zymoseptoria tritici on wheat (Triticum aestivum) reveals a biphasic interaction with plant immunity involving differential pathogen chromosomal contributions and a variation on the hemibiotrophic lifestyle definition. Plant Physiol. 2015, 167, 1158–1185. [Google Scholar] [PubMed]
  5. Douchkov, D.; Luck, S.; Johrde, A.; Nowara, D.; Himmelbach, A.; Rajaraman, J.; Stein, N.; Sharma, R.; Kilian, B.; Schweizer, P. Discovery of genes affecting resistance of barley to adapted and non-adapted powdery mildew fungi. Genome Biol. 2014, 15, 518. [Google Scholar] [CrossRef] [PubMed]
  6. Dong, X.; Jiang, Z.; Peng, Y.L.; Zhang, Z. Revealing shared and distinct gene network organization in Arabidopsis immune responses by integrative analysis. Plant Physiol. 2015, 167, 1186–1203. [Google Scholar] [CrossRef] [PubMed]
  7. Azizi, P.; Rafii, M.Y.; Abdullah, S.N.; Nejat, N.; Maziah, M.; Hanafi, M.M.; Latif, M.A.; Sahebi, M. Toward understanding of rice innate immunity against Magnaporthe oryzae. Crit. Rev. Biotechnol. 2014, 1–10. [Google Scholar] [CrossRef] [PubMed]
  8. Tsuda, K.; Mine, A.; Bethke, G.; Igarashi, D.; Botanga, C.J.; Tsuda, Y.; Glazebrook, J.; Sato, M.; Katagiri, F. Dual regulation of gene expression mediated by extended MAPK activation and salicylic acid contributes to robust innate immunity in Arabidopsis thaliana. PLoS Genet. 2013, 9, e1004015. [Google Scholar] [CrossRef] [PubMed]
  9. Zhang, Z.; Wu, Y.; Gao, M.; Zhang, J.; Kong, Q.; Liu, Y.; Ba, H.; Zhou, J.; Zhang, Y. Disruption of PAMP-induced MAP kinase cascade by a Pseudomonas syringae effector activates plant immunity mediated by the NB-LRR protein SUMM2. Cell Host Microbe 2012, 11, 253–263. [Google Scholar] [CrossRef] [PubMed]
  10. Thomma, B.P.; Nurnberger, T.; Joosten, M.H. Of PAMPs and effectors: The blurred PTI-ETI dichotomy. Plant Cell 2011, 23, 4–15. [Google Scholar] [CrossRef] [PubMed]
  11. Hein, I.; Gilroy, E.M.; Armstrong, M.R.; Birch, P.R. The zig-zag-zig in oomycete–plant interactions. Mol. Plant Pathol. 2009, 10, 547–562. [Google Scholar] [CrossRef] [PubMed]
  12. Bateman, A. The structure of a domain common to archaebacteria and the homocystinuria disease protein. Trends Biochem. Sci. 1997, 22, 12–13. [Google Scholar] [CrossRef]
  13. Ignoul, S.; Eggermont, J. CBS domains: Structure, function, and pathology in human proteins. Am. J. Physiol. Cell Physiol. 2005, 289, C1369–C1378. [Google Scholar] [CrossRef] [PubMed]
  14. Kushwaha, H.R.; Singh, A.K.; Sopory, S.K.; Singla-Pareek, S.L.; Pareek, A. Genome wide expression analysis of CBS domain containing proteins in Arabidopsis thaliana (L.) Heynh and Oryza sativa L. reveals their developmental and stress regulation. BMC Genomics 2009, 10, 200. [Google Scholar] [CrossRef] [PubMed]
  15. Gissot, L.; Polge, C.; Jossier, M.; Girin, T.; Bouly, J.P.; Kreis, M.; Thomas, M. AKINβγ contributes to SnRK1 heterotrimeric complexes and interacts with two proteins implicated in plant pathogen resistance through its KIS/GBD sequence. Plant Physiol. 2006, 142, 931–944. [Google Scholar] [CrossRef] [PubMed]
  16. Yoo, K.S.; Ok, S.H.; Jeong, B.C.; Jung, K.W.; Cui, M.H.; Hyoung, S.; Lee, M.R.; Song, H.K.; Shin, J.S. Single cystathionine β-synthase domain-containing proteins modulate development by regulating the thioredoxin system in Arabidopsis. Plant Cell 2011, 23, 3577–3594. [Google Scholar] [CrossRef] [PubMed]
  17. Ramon, M.; Ruelens, P.; Li, Y.; Sheen, J.; Geuten, K.; Rolland, F. The hybrid four-CBS-domain KINβγ subunit functions as the canonical gamma subunit of the plant energy sensor SnRK1. Plant J. 2013, 75, 11–25. [Google Scholar] [CrossRef] [PubMed]
  18. Singh, A.K.; Kumar, R.; Pareek, A.; Sopory, S.K.; Singla-Pareek, S.L. Overexpression of rice CBS domain containing protein improves salinity, oxidative, and heavy metal tolerance in transgenic tobacco. Mol. Biotechnol. 2012, 52, 205–216. [Google Scholar] [CrossRef] [PubMed]
  19. Wang, X.L.; Ren, X.; Zhu, L.L.; He, G.C. OsBi1, a rice gene, encodes a novel protein with a CBS-like domain and its expression is induced in responses to herbivore feeding. Plant Sci. 2004, 166, 1581–1588. [Google Scholar] [CrossRef]
  20. Espinoza, C.; Medina, C.; Somerville, S.; Arce-Johnson, P. Senescence-associated genes induced during compatible viral interactions with grapevine and Arabidopsis. J. Exp. Bot. 2007, 58, 3197–3212. [Google Scholar] [CrossRef] [PubMed]
  21. Fabro, G.; di Rienzo, J.A.; Voigt, C.A.; Savchenko, T.; Dehesh, K.; Somerville, S.; Alvarez, M.E. Genome-wide expression profiling Arabidopsis at the stage of Golovinomyces cichoracearum haustorium formation. Plant Physiol. 2008, 146, 1421–1439. [Google Scholar] [CrossRef] [PubMed]
  22. Kumari, S.; Sabharwal, V.P.; Kushwaha, H.R.; Sopory, S.K.; Singla-Pareek, S.L.; Pareek, A. Transcriptome map for seedling stage specific salinity stress response indicates a specific set of genes as candidate for saline tolerance in Oryza sativa L. Funct. Integr. Genomics 2009, 9, 109–123. [Google Scholar] [CrossRef] [PubMed]
  23. Sahu, B.B.; Shaw, B.P. Isolation, identification and expression analysis of salt-induced genes in Suaeda maritima, a natural halophyte, using PCR-based suppression subtractive hybridization. BMC Plant Biol. 2009, 9, 69. [Google Scholar] [CrossRef] [PubMed]
  24. Wang, Q.; Lai, T.; Qin, G.; Tian, S. Response of jujube fruits to exogenous oxalic acid treatment based on proteomic analysis. Plant Cell Physiol. 2009, 50, 230–242. [Google Scholar] [CrossRef] [PubMed]
  25. Dean, R.A.; Talbot, N.J.; Ebbole, D.J.; Farman, M.L.; Mitchell, T.K.; Orbach, M.J.; Thon, M.; Kulkarni, R.; Xu, J.R.; Pan, H.; et al. The genome sequence of the rice blast fungus Magnaporthe grisea. Nature 2005, 434, 980–986. [Google Scholar] [CrossRef] [PubMed]
  26. Li, R.Y.; Wu, X.M.; Yin, X.H.; Liang, J.N.; Li, M. The natural product citral can cause significant damage to the hyphal cell walls of Magnaporthe grisea. Molecules 2014, 19, 10279–10290. [Google Scholar] [CrossRef] [PubMed]
  27. Ahn, I.P. Glufosinate ammonium-induced pathogen inhibition and defense responses culminate in disease protection in bar-transgenic rice. Plant Physiol. 2008, 146, 213–227. [Google Scholar] [CrossRef] [PubMed]
  28. Tao, Z.; Liu, H.; Qiu, D.; Zhou, Y.; Li, X.; Xu, C.; Wang, S. A pair of allelic WRKY genes play opposite roles in rice–bacteria interactions. Plant Physiol. 2009, 151, 936–948. [Google Scholar] [CrossRef] [PubMed]
  29. Mou, S.; Liu, Z.; Guan, D.; Qiu, A.; Lai, Y.; He, S. Functional analysis and expressional characterization of rice ankyrin repeat-containing protein, OsPIANK1, in basal defense against Magnaporthe oryzae attack. PLoS ONE 2013, 8, e59699. [Google Scholar] [CrossRef] [PubMed]
  30. Qiu, D.; Xiao, J.; Ding, X.; Xiong, M.; Cai, M.; Cao, Y.; Li, X.; Xu, C.; Wang, S. OsWRKY13 mediates rice disease resistance by regulating defense-related genes in salicylate- and jasmonate-dependent signaling. Mol. Plant Microbe Interact. 2007, 20, 492–499. [Google Scholar] [CrossRef] [PubMed]
  31. Xiao, W.F.; Liu, H.B.; Li, Y.; Li, X.H.; Xu, C.G.; Long, M.Y.; Wang, S.P. A rice gene of de novo origin negatively regulates pathogen-induced defense response. PLoS ONE 2009, 4, e4603. [Google Scholar] [CrossRef] [PubMed]
  32. Shen, X.; Liu, H.; Yuan, B.; Li, X.; Xu, C.; Wang, S. OsEDR1 negatively regulates rice bacterial resistance via activation of ethylene biosynthesis. Plant Cell Environ. 2011, 34, 179–191. [Google Scholar] [CrossRef] [PubMed]
  33. Qiu, D.; Xiao, J.; Xie, W.; Liu, H.; Li, X.; Xiong, L.; Wang, S. Rice gene network inferred from expression profiling of plants overexpressing OsWRKY13, a positive regulator of disease resistance. Mol. Plant 2008, 1, 538–551. [Google Scholar] [CrossRef] [PubMed]
  34. Mei, C.S.; Qi, M.; Sheng, G.Y.; Yang, Y.N. Inducible overexpression of a rice allene oxide synthase gene increases the endogenous jasmonic acid level, PR gene expression, and host resistance to fungal infection. Mol. Plant Microbe Interact. 2006, 19, 1127–1137. [Google Scholar] [CrossRef] [PubMed]
  35. Cecchini, N.M.; Jung, H.W.; Engle, N.; Tschaplinski, T.J.; Greenberg, J. ALD1 regulates basal immune components and early inducible defense responses in Arabidopsis. Mol. Plant Microbe Interact. 2015, 28, 455–466. [Google Scholar] [CrossRef] [PubMed]
  36. Djami-Tchatchou, A.T.; Maake, M.P.; Piater, L.A.; Dubery, I.A. Isonitrosoacetophenone drives transcriptional reprogramming in Nicotiana tabacum cells in support of innate immunity and defense. PLoS ONE 2015, 10, e0117377. [Google Scholar] [CrossRef] [PubMed]
  37. Beckers, G.J.; Spoel, S.H. Fine-tuning plant defence signalling: Salicylate versus jasmonate. Plant Biol. (Stuttg.) 2006, 8, 1–10. [Google Scholar] [CrossRef] [PubMed]
  38. Tsuda, K.; Sato, M.; Stoddard, T.; Glazebrook, J.; Katagiri, F. Network properties of robust immunity in plants. PLoS Genet. 2009, 5, e1000772. [Google Scholar] [CrossRef] [PubMed]
  39. Proietti, S.; Bertini, L.; Timperio, A.M.; Zolla, L.; Caporale, C.; Caruso, C. Crosstalk between salicylic acid and jasmonate in Arabidopsis investigated by an integrated proteomic and transcriptomic approach. Mol. Biosyst. 2013, 9, 1169–1187. [Google Scholar] [CrossRef] [PubMed]
  40. Toki, S.; Hara, N.; Ono, K.; Onodera, H.; Tagiri, A.; Oka, S.; Tanaka, H. Early infection of scutellum tissue with Agrobacterium allows high-speed transformation of rice. Plant J. 2006, 47, 969–976. [Google Scholar] [CrossRef] [PubMed]
  41. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  42. Curtis, M.D.; Grossniklaus, U. A gateway cloning vector set for high-throughput functional analysis of genes in planta. Plant Physiol. 2003, 133, 462–469. [Google Scholar] [CrossRef] [PubMed]
  43. Qi, M.; Yang, Y. Quantification of Magnaporthe grisea during infection of rice plants using real-time polymerase chain reaction and northern blot/phosphoimaging analyses. Phytopathology 2002, 92, 870–876. [Google Scholar] [CrossRef] [PubMed]

Share and Cite

MDPI and ACS Style

Mou, S.; Shi, L.; Lin, W.; Liu, Y.; Shen, L.; Guan, D.; He, S. Over-Expression of Rice CBS Domain Containing Protein, OsCBSX3, Confers Rice Resistance to Magnaporthe oryzae Inoculation. Int. J. Mol. Sci. 2015, 16, 15903-15917. https://doi.org/10.3390/ijms160715903

AMA Style

Mou S, Shi L, Lin W, Liu Y, Shen L, Guan D, He S. Over-Expression of Rice CBS Domain Containing Protein, OsCBSX3, Confers Rice Resistance to Magnaporthe oryzae Inoculation. International Journal of Molecular Sciences. 2015; 16(7):15903-15917. https://doi.org/10.3390/ijms160715903

Chicago/Turabian Style

Mou, Shaoliang, Lanping Shi, Wei Lin, Yanyan Liu, Lei Shen, Deyi Guan, and Shuilin He. 2015. "Over-Expression of Rice CBS Domain Containing Protein, OsCBSX3, Confers Rice Resistance to Magnaporthe oryzae Inoculation" International Journal of Molecular Sciences 16, no. 7: 15903-15917. https://doi.org/10.3390/ijms160715903

Article Metrics

Back to TopTop