Prenatal Exposure to Lipopolysaccharide Results in Myocardial Fibrosis in Rat Offspring
Abstract
:1. Introduction
2. Results
2.1. Histological Examination

2.2. Histopathological Observation of Mouse MF via Sirius Red and Masson Staining
2.3. Prenatal Exposure to LPS Influences Expression of the Matrix Metalloproteinases System Components TIMP-2 and MMP-2


2.4. Prenatal Exposure to LPS Increased TGFβ-1 and TGFβ-2 Protein Expression

2.5. RT-PCR Analysis of mRNAs Related to MF

3. Discussion
4. Experimental Section
4.1. Animals Groups
4.2. Histological Evaluation
4.3. Real-Time PCR
| Gene | Position | Primer Sequences |
|---|---|---|
| TIMP-2 | Up | 5'GAATATCTAATTGCAGGGAAGGC3' |
| Down | 5'TGGGTGATGCTAAGCGTGTC3' | |
| MMP-2 | Up | 5'AGCTGGCCCTGTTCTGACG3' |
| Down | 5'CACCCTCTTAAATCTGAAATCACC3' | |
| TGF-β1 | Up | 5'GGCGGTGCTAAGCGTGTC3' |
| Down | 5'TGTTGCGGTCCACCATTAGC3' | |
| TGF-β2 | Up | 5'TGTGAGAAGCCGCAGGAAGT3' |
| Down | 5'CAGAGTGAAGCCGCAGGAAGT3' |
4.4. Western Blot
4.5. Statistics Analysis
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Hundae, A.; Mccullough, P.A. Cardiac and renal fibrosis in chronic cardiorenal syndromes. Nephron Clin. Pract. 2014, 127, 106–112. [Google Scholar] [CrossRef] [PubMed]
- Pinney, J.R.; Du, K.T.; Ayala, P.; Fang, Q.; Sievers, R.E.; Chew, P.; Delrosario, L.; Lee, R.J.; Desai, T.A. Discrete microstructural cues for the attenuation of fibrosis following myocardial infarction. Biomaterials 2014, 35, 8820–8828. [Google Scholar] [CrossRef] [PubMed]
- Chan, W.; Duffy, S.J.; White, D.A.; Gao, X.M.; Du, X.J.; Ellims, A.H.; Dart, A.M.; Taylor, A.J. Acute left ventricular remodeling following myocardial infarction: Coupling of regional healing with remote extracellular matrix expansion. J. Am. Coll. Cardiol. Imaging 2012, 5, 884–893. [Google Scholar] [CrossRef]
- Rosin, N.L.; Falkenham, A.; Sopel, M.J.; Lee, T.D.; Legare, J.F. Regulation and role of connective tissue growth factor in AngII-induced myocardial fibrosis. Am. J. Pathol. 2013, 182, 714–726. [Google Scholar] [CrossRef] [PubMed]
- Schelbert, E.B.; Fonarow, G.C.; Bonow, R.O.; Butler, J.; Gheorghiade, M. Therapeutic targets in heart failure: Refocusing on the myocardial interstitium. J. Am. Coll. Cardiol. 2014, 63, 2188–2198. [Google Scholar] [CrossRef] [PubMed]
- Polyakova, V.; Richter, M.; Ganceva, N.; Lautze, H.-J.; Kamata, S.; Pöling, J.; Beiras-Fernandez, A.; Hein, S.; Szalay, Z.; Braun, T.; et al. Distinct structural and molecular features of the myocardial extracellular matrix remodeling in compensated and decompensated cardiac hypertrophy due to aortic stenosis. IJC Heart Vessels 2014, 4, 145–160. [Google Scholar] [CrossRef]
- Jellis, C.; Martin, J.; Narula, J.; Marwick, T.H. Assessment of nonischemic myocardial fibrosis. J. Am. Coll. Cardiol. 2010, 56, 89–97. [Google Scholar] [CrossRef] [PubMed]
- Van Nieuwenhoven, F.A.; Turner, N.A. The role of cardiac fibroblasts in the transition from inflammation to fibrosis following myocardial infarction. Vascul. Pharmacol. 2013, 58, 182–188. [Google Scholar] [CrossRef] [PubMed]
- Chalikias, G.K.; Tziakas, D.N. Biomarkers of the extracellular matrix and of collagen fragments. Clin. Chim. Acta 2014, 443, 39–47. [Google Scholar] [CrossRef] [PubMed]
- Mansel, A.; Margaret Worrall, D.; O’Neilla, L.A.J. The serine protease inhibitor antithrombin III inhibits LPS-mediated NF-κB activation by TLR-4. FEBS Lett. 2001, 508, 313–317. [Google Scholar] [CrossRef] [PubMed]
- Hao, L.Y.; Hao, X.Q.; Li, S.H.; Li, X.H. Prenatal exposure to lipopolysaccharide results in cognitive deficits in age-increasing offspring rats. Neuroscience 2010, 166, 763–770. [Google Scholar] [CrossRef] [PubMed]
- Wei, Y.L.; Du, W.H.; Xiong, X.Q.; He, X.Y.; Yi, P.; Deng, Y.C.; Chen, D.F.; Li, X.H. Prenatal exposure to lipopolysaccharide results in myocardial remodelling in adult murine offspring. J. Inflamm. 2013, 10, 1476–9255. [Google Scholar] [CrossRef]
- McCourt, F.; O’Neill, B.; Logan, I.; Abbott, J.; Plant, B.; McCrum-Gardner, E.; McKeown, S.; Stuart Elborn, J.; Bradley, J.M. Indicators of pulmonary exacerbation in cystic fibrosis: A Delphi survey of patients and health professionals. J. Cyst. Fibros. 2015, 14, 90–96. [Google Scholar] [CrossRef] [PubMed]
- Del Corral, T.; Percegona, J.; Seborga, M.; Rabinovich, R.A.; Vilaro, J. Physiological response during activity programs using Wii-based video games in patients with cystic fibrosis (CF). J. Cyst. Fibros. 2014, 13, 706–711. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.Y.; Liu, Y.C.; Wu, C.; Armstrong, A.; Volpe, G.J.; van der Geest, R.J.; Liu, Y.; Hundley, W.G.; Gomes, A.S.; Liu, S.; et al. Evaluation of age-related interstitial myocardial fibrosis with cardiac magnetic resonance contrast-enhanced T1 mapping: MESA (Multi-Ethnic Study of Atherosclerosis). J. Am. Coll. Cardiol. 2013, 62, 1280–1287. [Google Scholar] [CrossRef] [PubMed]
- Bostick, B.; Habibi, J.; Ma, L.; Aroor, A.; Rehmer, N.; Hayden, M.R.; Sowers, J.R. Dipeptidyl peptidase inhibition prevents diastolic dysfunction and reduces myocardial fibrosis in a mouse model of Western diet induced obesity. Metabolism 2014, 63, 1000–1011. [Google Scholar] [CrossRef] [PubMed]
- Mandal, M.; Donnelly, R.; Elkabes, S.; Zhang, P.; Davini, D.; David, B.T.; Ponzio, N.M. Maternal immune stimulation during pregnancy shapes the immunological phenotype of offspring. Brain Behav. Immun. 2013, 33, 33–45. [Google Scholar] [CrossRef] [PubMed]
- Lin, Y.L.; Wang, S. Prenatal lipopolysaccharide exposure increases depression-like behaviors and reduces hippocampal neurogenesis in adult rats. Behav. Brain Res. 2014, 259, 24–34. [Google Scholar] [CrossRef] [PubMed]
- Bayomy, A.F.; Bauer, M.; Qiu, Y.; Liao, R. Regeneration in heart disease-Is ECM the key? Life Sci. 2012, 91, 823–827. [Google Scholar] [CrossRef] [PubMed]
- Dobaczewski, M.; Chen, W.; Frangogiannis, N.G. Transforming growth factor (TGF)-β signaling in cardiac remodeling. J. Mol. Cell. Cardiol. 2011, 51, 600–606. [Google Scholar] [CrossRef] [PubMed]
- Lukaszewicz-Zajac, M.; Mroczko, B.; Guzinska-Ustymowicz, K.; Pryczynicz, A.; Gryko, M.; Kemona, A.; Kedra, B.; Szmitkowski, M. Matrix metalloproteinase 2 (MMP-2) and their tissue inhibitor 2 (TIMP-2) in gastric cancer patients. Adv. Med. Sci. 2013, 58, 235–243. [Google Scholar] [CrossRef] [PubMed]
- Kwon, J.S.; Kim, Y.S.; Cho, A.S.; Cho, H.H.; Kim, J.S.; Hong, M.H.; Jeong, H.Y.; Kang, W.S.; Hwang, K.K.; Bae, J.W.; et al. Regulation of MMP/TIMP by HUVEC transplantation attenuates ventricular remodeling in response to myocardial infarction. Life Sci. 2014, 101, 15–26. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Shao, L.; Ma, A.; Guan, G.; Wang, J.; Wang, Y.; Tian, G. Telmisartan delays myocardial fibrosis in rats with hypertensive left ventricular hypertrophy by TGF-β1/Smad signal pathway. Hypertens. Res. 2014, 37, 43–49. [Google Scholar] [CrossRef] [PubMed]
- Kai, H.; Kuwahara, F.; Tokuda, K.; Imaizumi, T. Diastolic dysfunction in hypertensive hearts roles of perivascular inflammation and reactive myocardial fibrosis. Hypertens. Res. 2005, 28, 483–490. [Google Scholar] [CrossRef] [PubMed]
- Chen, R.; Xue, J.; Xie, M. Puerarin prevents isoprenaline-induced myocardial fibrosis in mice by reduction of myocardial TGF-β1 expression. J. Nutr. Biochem. 2012, 23, 1080–1085. [Google Scholar] [CrossRef] [PubMed]
© 2015 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, X.; Tang, Y.; Gao, M.; Qin, S.; Zhou, J.; Li, X. Prenatal Exposure to Lipopolysaccharide Results in Myocardial Fibrosis in Rat Offspring. Int. J. Mol. Sci. 2015, 16, 10986-10996. https://doi.org/10.3390/ijms160510986
Chen X, Tang Y, Gao M, Qin S, Zhou J, Li X. Prenatal Exposure to Lipopolysaccharide Results in Myocardial Fibrosis in Rat Offspring. International Journal of Molecular Sciences. 2015; 16(5):10986-10996. https://doi.org/10.3390/ijms160510986
Chicago/Turabian StyleChen, Xin, Yujie Tang, Meng Gao, Shugang Qin, Jianzhi Zhou, and Xiaohui Li. 2015. "Prenatal Exposure to Lipopolysaccharide Results in Myocardial Fibrosis in Rat Offspring" International Journal of Molecular Sciences 16, no. 5: 10986-10996. https://doi.org/10.3390/ijms160510986
APA StyleChen, X., Tang, Y., Gao, M., Qin, S., Zhou, J., & Li, X. (2015). Prenatal Exposure to Lipopolysaccharide Results in Myocardial Fibrosis in Rat Offspring. International Journal of Molecular Sciences, 16(5), 10986-10996. https://doi.org/10.3390/ijms160510986
