Sub-Inhibitory Concentrations of Trans-Cinnamaldehyde Attenuate Virulence in Cronobacter sakazakii in Vitro
Abstract
:1. Introduction
2. Results and Discussion
2.1. Results
2.1.1. Sub-Inhibitory Concentrations of TC (Trans-Cinnamaldehyde)
2.1.2. TC Suppresses C. sakazakii Motility
2.1.3. TC Suppresses C. sakazakii Adhesion and Invasion of Host Cells
2.1.4. TC Suppresses Cell Death in Rat Intestinal Cells
2.1.5. TC Reduces Endotoxin Production in C. sakazakii
2.1.6. TC Downregulates C. sakazakii Virulence Genes
2.2. Discussion
3. Experimental Section
3.1. Bacterial Strains and Growth Conditions
3.2. Determination of Sub-Inhibitory Concentrations of TC
3.3. Motility Assay
3.4. Cell Culture
3.5. Effect of SICs of TC on Binding and Internalization of C. sakazakii in Host Cells
3.6. Macrophage Cultivation and Invasion Assay
3.7. Evaluation of Cell Death in IEC-6 Cells Infected with C. sakazakii
3.8. Transfection of IEC-6 Cells with siRNA and Determination of Nitric Oxide (NO) Production
3.9. C. sakazakii Endotoxin Assay
3.10. Quantification of C. sakazakii Virulence Gene Expression Using RT-qPCR
3.11. Statistical Analysis
4. Conclusions
Conflicts of Interest
- Author ContributionsKumar Venkitanarayanan and Mary Anne Roshni Amalaradjou conceived the idea, designed the experiments and wrote the manuscript. Mary Anne Roshni Amalaradjou performed the experiments and analyzed the data. Kwang Sik Kim provided the human brain microvascular endothelial cells used in this study.
References
- Holý, O.; Forsythe, S. Cronobacter spp. as emerging causes of healthcare-associated infection. J. Hosp. Infect 2014, 86, 169–177. [Google Scholar]
- Lai, K.K. Enterobacter sakazakii infections among neonates, infants, children, and adults: Case reports and a review of the literature. Medicine 2001, 80, 113–122. [Google Scholar]
- Hunter, C.J.; Bean, J.F. Cronobacter: An emerging opportunistic pathogen associated with neonatal meningitis, sepsis and necrotizing enterocolitis. J. Perinatol 2013, 33, 581–585. [Google Scholar]
- Van Acker, J.; de Smet, F.; Muyldermans, G.; Bougatef, A.; Naessens, A.; Lauwers, S. Outbreak of necrotizing enterocolitis associated with Enterobacter sakazakii in powdered milk formula. J. Clin. Microbiol 2001, 39, 293–297. [Google Scholar]
- Nazarowec-White, M.; Farber, J.M. Enterobacter sakazakii: A review. Int. J. Food Microbiol 1997, 34, 103–113. [Google Scholar]
- Forsythe, S.J. Enterobacter sakazakii and other bacteria in powdered infant formula. Matern. Child Nutr 2005, 1, 44–50. [Google Scholar]
- Townsend, S.M.; Hurrell, E.; Gonzalez-Gomez, I.; Lowe, J.; Frye, J.G.; Forsythe, S.; Badger, I.L. Enterobacter sakazakii invades brain capillary endothelial cells, persists in human macrophages influencing cytokine secretion and induces severe brain pathology in the neonatal rat. Microbiologe 2007, 153, 3538–3547. [Google Scholar]
- Centers for Disease Control and Prevention. Enterobacter sakazakii infections associated with the use of powdered infant formula—Tennessee, 2001. MMWR Morb. Mortal. Wkly. Rep 2002, 51, 297–300.
- Mange, J.P.; Stephan, R.; Borel, N.; Wild, P.; Kim, K.S.; Pospischil, A.; Lehner, A. Adhesive properties of Enterobacter sakazakii to human epithelial and brain microvascular endothelial cells. BMC Microbiol 2006, 6. [Google Scholar] [CrossRef] [Green Version]
- Nair, M.K.; Venkitanarayanan, K. Role of bacterial OmpA and host cytoskeleton in the invasion of human intestinal epithelial cells by Enterobacter sakazakii. Pediatr. Res 2007, 62, 664–669. [Google Scholar]
- Nair, M.K.; Venkitanarayanan, K.; Silbart, L.K.; Kim, K.S. Outer membrane protein A (OmpA) of Cronobacter sakazakii binds fibronectin and contributes to invasion of human brain microvascular endothelial cells. Foodborne Pathog. Dis 2009, 6, 495–501. [Google Scholar]
- Rhoades, E.R.; Ullrich, H.J. How to establish a lasting relationship with your host: Lessons learned from Mycobacterium spp. Immunol. Cell Biol 2000, 78, 301–310. [Google Scholar]
- Adams, T.B.; Cohen, S.M.; Doull, J.; Feron, V.J.; Goodman, J.I.; Marnett, L.J.; Munro, I.C.; Portoghese, P.S.; Smith, R.L.; Waddell, W.J.; et al. The FEMA GRAS assessment of cinnamyl derivatives used as flavor ingredients. Food Chem. Toxicol 2004, 42, 157–185. [Google Scholar]
- Amalaradjou, M.A.; Venkitanarayanan, K. Effect of trans-cinnamaldehyde on inhibition and inactivation of Cronobacter sakazakii biofilm on abiotic surfaces. J. Food Prot 2011, 74, 200–208. [Google Scholar]
- Amalaradjou, M.A.; Venkitanarayanan, K. Proteomic analysis of the mode of antibacterial action of trans-cinnamaldehyde against Cronobacter sakazakii 415. Foodborne Pathog. Dis 2011, 8, 1095–1102. [Google Scholar]
- Hunter, C.J.; William, M.; Petrosyan, M.; Guner, Y.; Mittal, R.; Mock, D.; Upperman, J.S.; Ford, H.R.; Prasadarao, N.V. Lactobacillus bulgaricus prevents intestinal epithelial cell injury caused by Enterobacter sakazakii-induced nitric oxide both in vitro and in the newborn rat model of necrotizing enterocolitis. Infect. Immun 2009, 77, 1031–1043. [Google Scholar]
- Hunter, C.J.; Singamsetty, V.K.; Chokshi, N.K.; Boyle, P.; Camerini, V.; Grishin, A.V.; Upperman, J.S.; Ford, H.R.; Prasadarao, N.V. Enterobacter sakazakii enhances epithelial cell injury by inducing apoptosis in a rat model of necrotizing enterocolitis. J. Infect. Dis 2008, 198, 586–593. [Google Scholar]
- Al-Nabulsi, A.A.; Osaili, T.M.; Elabedeen, N.A.; Jaradat, Z.W.; Shaker, R.R.; Kheirallah, K.A.; Tarazi, Y.H.; Holley, R.A. Impact of environmental stress desiccation, acidity, alkalinity, heat or cold on antibiotic susceptibility of Cronobacter sakazakii. Int. J. Food Microbiol 2011, 146, 137–143. [Google Scholar]
- Girlich, D.; Poirel, L.; Leelaporn, A.; Karim, A.; Tribuddharat, C.; Fennewald, M.; Nordmann, P. Molecular epidemiology of the integron-located VEB-1 extended-spectrum beta-lactamase in nosocomial enterobacterial isolates in Bangkok, Thailand. J. Clin. Microbiol 2001, 39, 175–182. [Google Scholar]
- See, K.C.; Than, H.A.; Tang, T. Enterobacter sakazakii bacteraemia with multiple splenic abscesses in a 75-year-old woman: A case report. Age Ageing 2007, 36, 595–596. [Google Scholar]
- Goh, E.B.; Yim, G.; Tsui, W.; McClure, J.; Surette, M.G.; Davies, J. Transcriptional modulation of bacterial gene expression by subinhibitory concentrations of antibiotics. Proc. Natl. Acad. Sci. USA 2002, 99, 17025–17030. [Google Scholar]
- Fonseca, A.P.; Extremina, C.; Fonseca, A.F.; Souza, J.C. Effect of subinhibitory concentration of piperacillin/tazobactam on Pseudomonas aeruginosa. J. Med. Microbiol 2004, 53, 903–910. [Google Scholar]
- Herren, C.D.; Mitra, A.; Palaniyandi, S.K.; Coleman, A.; Elankumaran, S.; Mukhopadhyay, S. The BarA-UvrY two-component system regulates virulence in avian pathogenic Escherichia coli O78:K80:H9. Infect. Immun 2006, 74, 4900–4909. [Google Scholar]
- Kim, K.; Kim, K.P.; Choi, J.; Lim, J.A.; Lee, J.; Hwang, S.; Kim, S.R. Outer membrane protein A (OmpA) and X (OmpX) are essential for basolateral invasion of Cronobacter sakazakii. Appl. Environ. Microbiol 2010, 76, 5188–5198. [Google Scholar]
- Singamsetty, V.K.; Wang, Y.; Shimada, H.; Prasadarao, N.V. Outer membrane protein A expression in Enterobacter sakazakii is required to induce microtubule condensation in human brain microvascular endothelial cells for invasion. Microb. Pathog 2008, 45, 181–191. [Google Scholar]
- Hazelbauer, G.L.; Berg, H.C.; Matsumura, P. Bacterial motility and signal transduction. Cell 1993, 73, 15–22. [Google Scholar]
- Josenhans, C.; Suerbaum, S. The role of motility as a virulence factor in bacteria. Int. J. Med. Microbiol 2002, 291, 605–614. [Google Scholar]
- Van Asten, F.J.; Hendriks, H.G.; Koninkx, J.F.; van der Zeijst, B.A.; Gaastra, W. Inactivation of the flagellin gene of Salmonella enterica serotype Enteritidis strongly reduces invasion into differentiated Caco-2 cells. FEMS Microbiol. Lett 2000, 185, 175–179. [Google Scholar]
- Guerry, P. Campylobacter flagella: Not just for motility. Trends Microbiol 2007, 15, 456–461. [Google Scholar]
- Hartmann, I.; Carranza, P.; Lehner, A.; Stephan, R.; Eberl, L.; Riedel, K. Genes involved in Cronobacter sakazakii biofilm formation. Appl. Environ. Microbiol 2010, 76, 2251–2261. [Google Scholar]
- Grant, C.C.; Konkel, M.E.; Cieplak, W.; Tompkins, L.S. Role of flagella in adherence, internalization, and translocation of Campylobacter jejuni in nonpolarized and polarized epithelial cell cultures. Infect. Immun 1993, 61, 1764–1771. [Google Scholar]
- Heinzelmann, M.; Polk, H.C.; Chernobelsky, A.; Stites, T.P.; Gordon, L.E. Endotoxin and muramyl dipeptide modulate surface receptor expression on human mononuclear cells. Immunopharmacology 2000, 48, 117–128. [Google Scholar]
- Deitch, E.A.; Berg, R.; Specian, R. Endotoxin promotes the translocation of bacteria from the gut. Arch. Surg 1987, 122, 185–190. [Google Scholar]
- Raetz, C.R.; Reynolds, C.M.; Trent, M.S.; Bishop, R.E. Lipid A modification systems in Gram-negative bacteria. Annu. Rev. Biochem 2007, 76, 295–329. [Google Scholar]
- Mittal, R.; Gonzalez-Gomez, I.; Goth, K.A.; Prasadarao, N.V. Inhibition of inducible nitric oxide controls pathogen load and brain damage by enhancing phagocytosis of Escherichia coli K1 in neonatal meningitis. Am. J. Pathol 2010, 176, 1292–1305. [Google Scholar]
- Johny, A.K.; Hoagland, T.; Venkitanarayanan, K. Effect of subinhibitory concentrations of plant-derived molecules in increasing the sensitivity of multidrug-resistant Salmonella enterica serovar Typhimurium DT104 to antibiotics. Foodborne Pathog. Dis 2010, 7, 1165–1170. [Google Scholar]
- Niu, C.; Gilbert, E.S. Colorimetric method for identifying plant essential oil components that affect biofilm formation and structure. Appl. Environ. Microbiol 2004, 70, 6951–6956. [Google Scholar]
- Townsend, S.M.; Pollack, H.A.; Gonzalez-Gomez, I.; Shimada, H.; Badger, J.L. Citrobacter koseri brain abscess in the neonatal rat: Survival and replication within human and rat macrophages. Infect. Immun 2003, 71, 5871–5880. [Google Scholar]
- Sobral, R.G.; Jones, A.E.; Des Etages, S.G.; Dougherty, T.J.; Peitzsch, R.M.; Gaasterland, T.; Ludovice, A.M.; de Lencastre, H.; Tomasz, A. Extensive and genome-wide changes in the transcription profile of Staphylococcus aureus induced by modulating the transcription of the cell wall synthesis gene murF. J. Bacteriol 2007, 189, 2376–2391. [Google Scholar]
Primer | Sequence (5′ to 3′) | Probe (5′ to 3′) | Target |
---|---|---|---|
16F | CCAGGGCTACACACGTGCTA | AATGGCGCATACAAA | ESA_04030 |
16R | TCTCGCGAGGTCGCTTCT | ||
LF | GCACGACACTTTCCGTAAACTG | ATCAGCAGATCCGC | lpxB |
LR | CGCCTGTTCATCGGCATT | ||
OAF | GGCCGCATGCCGTATAAA | ||
OAR | GCTGTACGCCCTGAGCTTTG | CACTGTAAACGGCGCTT | ompA |
OXF | GTCTTTCAGCACTGGCTTGTGT | CTGGCCGTTTCCGCAG | ompX |
OXR | GGTGCCAGCAACAGCAGAA | ||
Fl1F | CGATGTTTCGCCTGGGAAT | AGCGAAGAGATGGC | flhD |
Fl1R | AGAGTCAGGTCGCCCAGTGT | ||
Fl2F | AAAACCGCAACATGGAATTCA | CCTCGGTCAGCAGCA | fliD |
Fl2R | CCGCAAACGCGGTATTG | ||
Fl3F | GACGGCGGGCAAAGG | TTAGGCCTCGCTGACATG | flgJ |
Fl3R | GCCGCCCATCTGTTTGAC | ||
M1F | GGTGTGGGTGCGTTTATCGT | CAACGGGAAAGCC | motA |
M1R | GCCTTCAGCGTGCCTTTG | ||
M2F | ACGGCTCGTGGAAAATCG | TTACGCCGACTTTATG | motB |
M2R | CCAGGAAGAAGGCCATCATG | ||
SF | CGAATCTGCCGGTTGAAGA | ||
SR | CTTGTCCGCCGGAACCT | CTGATCACCAAACTGGAT | Sod |
UF | GCGAGGACGCCATCAAAT | TGTCGCATTCACCC | uvrY |
UR | ATCCATCAGCACCACATCCA | ATTGCTGGGCTTAATG | wzx |
WF | TGCTTGGGCAGGTACAAAGTG | ||
WR | CCCTACGGGTGCAGTCACA |
© 2014 by the authors; licensee MDPI, Basel, Switzerland This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Amalaradjou, M.A.R.; Kim, K.S.; Venkitanarayanan, K. Sub-Inhibitory Concentrations of Trans-Cinnamaldehyde Attenuate Virulence in Cronobacter sakazakii in Vitro. Int. J. Mol. Sci. 2014, 15, 8639-8655. https://doi.org/10.3390/ijms15058639
Amalaradjou MAR, Kim KS, Venkitanarayanan K. Sub-Inhibitory Concentrations of Trans-Cinnamaldehyde Attenuate Virulence in Cronobacter sakazakii in Vitro. International Journal of Molecular Sciences. 2014; 15(5):8639-8655. https://doi.org/10.3390/ijms15058639
Chicago/Turabian StyleAmalaradjou, Mary Anne Roshni, Kwang Sik Kim, and Kumar Venkitanarayanan. 2014. "Sub-Inhibitory Concentrations of Trans-Cinnamaldehyde Attenuate Virulence in Cronobacter sakazakii in Vitro" International Journal of Molecular Sciences 15, no. 5: 8639-8655. https://doi.org/10.3390/ijms15058639