A Microdeletion of Chromosome 9q33.3 Encompasses the Entire LMX1B Gene in a Chinese Family with Nail Patella Syndrome
Abstract
:1. Introduction
2. Results
2.1. Clinical Manifestations
2.2. Genetic Analysis
3. Discussion
Deletion | Size | Phenotype | Reference |
---|---|---|---|
Entire LMX1B | ~0.66 Mb | NPS | Present study |
Entire LMX1B | ~82 Kb | NPS | Family A [25] |
Entire LMX1B | ~0.44 Mb | NPS | Family B [25] |
Partial LMX1B (exon 3–8) | ~5.4 Kb | NPS | Family C [25] |
Entire LMX1B | ~2 Mb | NPS, facial anomalies, club feet, mental retardation, genital anomalies | NPS4 [22] |
Entire LMX1B | ~3.07 Mb | NPS, facial anomalies, club feet, mental retardation, genital anomalies | Patient 1 [32] |
4. Experimental Section
4.1. Subjects and Clinical Evaluation
4.2. Sequencing of Genomic DNA
Exon | Sense Primer | Antisense Primer | Product Size (bp) | Reference |
---|---|---|---|---|
1 | TGACAAGCAGGTGACAGAGGA | CTGGCGATCACTCCAGGAGT | 558 | [5] |
2 | CCGAGGACTGGGACGGACTA | CTCTCGGAACCCTTGGAGCT | 513 | [5] |
3 | GGCAGGAGTGGCCTCTG | TCCAGGACACCCCAGCAAC | 359 | [6] |
4 + 5 + 6 | CCACGGCAGGTGTCAACAGA | GATGGCCTTGGTGGAAGGCT | 1005 | [5] |
7 + 8 | CTGAGCCTGGAGGAGGAGCT | GGGCACCGTATGGCTGT | 1115 | [5,7] |
4.3. Multiplex Ligation-Dependent Probe Amplification (MLPA) Analysis
4.4. Whole Genome Copy Number Analysis
5. Conclusions
Supplementary Files
Supplementary File 1Acknowledgments
Author Contributions
Conflicts of Interest
References
- McIntosh, I.; Dunston, J.A.; Liu, L.; Hoover-Fong, J.E.; Sweeney, E. Nail patella syndrome revisited: 50 years after linkage. Ann. Hum. Genet. 2005, 69, 349–363. [Google Scholar] [CrossRef]
- Hawkins, C.F.; Smith, O.E. Renal dysplasia in a family with multiple hereditary abnormalities including iliac horns. Lancet 1950, 1, 803–808. [Google Scholar] [CrossRef] [PubMed]
- Mimiwati, Z.; Mackey, D.A.; Craig, J.E.; Mackinnon, J.R.; Rait, J.L.; Liebelt, J.E.; Ayala-Lugo, R.; Vollrath, D.; Richards, J.E. Nail patella syndrome and its association with glaucoma: A review of eight families. Br. J. Ophthalmol. 2006, 90, 1505–1509. [Google Scholar] [CrossRef] [PubMed]
- Milla, E.; Hernan, I.; Gamundi, M.J.; Martinez-Gimeno, M.; Carballo, M. Novel LMX1B mutation in familial Nail patella syndrome with variable expression of open angle glaucoma. Mol. Vis. 2007, 13, 639–648. [Google Scholar] [PubMed]
- Lee, B.H.; Cho, T.J.; Choi, H.J.; Kang, H.K.; Lim, I.S.; Park, Y.H.; Ha, I.S.; Choi, Y.; Cheong, H.I. Clinico-genetic study of nail patella syndrome. J. Korean Med. Sci. 2009, 24, S82–S86. [Google Scholar]
- Romero, P.; Sanhueza, F.; Lopez, P.; Reyes, L.; Herrera, L. c.194 A>C (Q65P) mutation in the LMX1B gene in patients with nail patella syndrome associated with glaucoma. Mol. Vis. 2011, 17, 1929–1939. [Google Scholar] [PubMed]
- Dreyer, S.D.; Zhou, G.; Baldini, A.; Winterpacht, A.; Zabel, B.; Cole, W.; Johnson, R.L.; Lee, B. Mutations in LMX1B cause abnormal skeletal patterning and renal dysplasia in nail patella syndrome. Nat. Genet. 1998, 19, 47–50. [Google Scholar] [CrossRef] [PubMed]
- Vollrath, D.; Jaramillo-Babb, V.L.; Clough, M.V.; McIntosh, I.; Scott, K.M.; Lichter, P.R.; Richards, J.E. Loss-of-function mutations in the LIM-homeodomain gene, LMX1B, in nail patella syndrome. Hum. Mol. Genet. 1998, 7, 1091–1098. [Google Scholar] [CrossRef] [PubMed]
- McIntosh, I.; Dreyer, S.D.; Clough, M.V.; Dunston, J.A.; Eyaid, W.; Roig, C.M.; Montgomery, T.; Ala-Mello, S.; Kaitila, I.; Winterpacht, A.; et al. Mutation analysis of LMX1B gene in nail patella syndrome patients. Am. J. Hum. Genet. 1998, 63, 1651–1658. [Google Scholar]
- Iannotti, C.A.; Inoue, H.; Bernal, E.; Aoki, M.; Liu, L.; Donis-Keller, H.; German, M.S.; Permutt, M.A. Identification of a human LMX1 (LMX1.1)-related gene, LMX1.2: Tissue-specific expression and linkage mapping on chromosome 9. Genomics 1997, 46, 520–524. [Google Scholar]
- Curtiss, J.; Heilig, J.S. DeLIMiting development. Bioessays 1998, 20, 58–69. [Google Scholar] [CrossRef] [PubMed]
- Song, N.N.; Xiu, J.B.; Huang, Y.; Chen, J.Y.; Zhang, L.; Gutknecht, L.; Lesch, K.P.; Li, H.; Ding, Y.Q. Adult raphe-specific deletion of LMX1b leads to central serotonin deficiency. PLoS One 2011, 6, e15998. [Google Scholar]
- Vogel, A.; Rodriguez, C.; Warnken, W.; Izpisua, B.J. Dorsal cell fate specified by chick Lmx1 during vertebrate limb development. Nature 1995, 378, 716–720. [Google Scholar] [CrossRef] [PubMed]
- Ding, Y.Q.; Yin, J.; Kania, A.; Zhao, Z.Q.; Johnson, R.L.; Chen, Z.F. LMX1b controls the differentiation and migration of the superficial dorsal horn neurons of the spinal cord. Development 2004, 131, 3693–3703. [Google Scholar] [CrossRef] [PubMed]
- Rohr, C.; Prestel, J.; Heidet, L.; Hosser, H.; Kriz, W.; Johnson, R.L.; Antignac, C.; Witzgall, R. The LIM-homeodomain transcription factor LMX1b plays a crucial role in podocytes. J. Clin. Investig. 2002, 109, 1073–1082. [Google Scholar] [CrossRef] [PubMed]
- Xiang, C.; Zhang, K.H.; Yin, J.; Arends, J.J.; Erzurumlu, R.S.; Jacquin, M.F.; Chen, Z.F. The transcription factor, LMX1b, is necessary for the development of the principal trigeminal nucleus-based lemniscal pathway. Mol. Cell. Neurosci. 2010, 44, 394–403. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.; Lun, Y.; Ovchinnikov, D.; Kokubo, H.; Oberg, K.C.; Pepicelli, C.V.; Gan, L.; Lee, B.; Johnson, R.L. Limb and kidney defects in LMX1b mutant mice suggest an involvement of LMX1B in human nail patella syndrome. Nat. Genet. 1998, 19, 51–55. [Google Scholar] [CrossRef] [PubMed]
- Endele, S.; Klein, S.; Richter, S.; Molter, T.; Amann, K.; Klanke, B.; Witzgall, R.; Johnson, R.L.; Hilgers, K.F.; Winterpacht, A. Renal phenotype in heterozygous LMX1b knockout mice (LMX1b+/−) after unilateral nephrectomy. Transgen. Res. 2007, 16, 723–729. [Google Scholar] [CrossRef]
- Sweeney, E.; Fryer, A.; Mountford, R.; Green, A.; McIntosh, I. Nail patella syndrome: A review of the phenotype aided by developmental biology. J. Med. Genet. 2003, 40, 153–162. [Google Scholar] [CrossRef] [PubMed]
- Clough, M.V.; Hamlington, J.D.; McIntosh, I. Restricted distribution of loss-of-function mutations within the LMX1B genes of nail patella syndrome patients. Hum. Mutat. 1999, 14, 459–465. [Google Scholar] [CrossRef] [PubMed]
- Oshimo, T.; Fukai, K.; Higashi, N.; Kitano, T.; Imai, Y.; Shintaku, H.; Ishii, M. A novel LMX1B nonsense mutation in a family with nail patella syndrome. J. Dermatol. Sci. 2008, 52, 57–60. [Google Scholar] [PubMed]
- Marini, M.; Bocciardi, R.; Gimelli, S.; di Duca, M.; Divizia, M.T.; Baban, A.; Gaspar, H.; Mammi, I.; Garavelli, L.; Cerone, R.; et al. A spectrum of LMX1B mutations in nail patella syndrome: New point mutations, deletion, and evidence of mosaicism in unaffected parents. Genet. Med. 2010, 12, 431–439. [Google Scholar]
- Ham, J.H.; Shin, S.J.; Joo, K.R.; Park, S.M.; Sung, H.Y.; Kim, J.S.; Choi, J.S.; Choi, Y.J.; Song, H.C.; Choi, E.J. A synonymous genetic alteration of LMX1B in a family with nail patella syndrome. Korean J. Intern. Med. 2009, 24, 274–278. [Google Scholar] [CrossRef] [PubMed]
- Bongers, E.M.; Huysmans, F.T.; Levtchenko, E.; de Rooy, J.W.; Blickman, J.G.; Admiraal, R.J.; Huygen, P.L.; Cruysberg, J.R.; Toolens, P.A.; Prins, J.B.; et al. Genotype-phenotype studies in nail patella syndrome show that LMX1B mutation location is involved in the risk of developing nephropathy. Eur. J. Hum. Genet. 2005, 13, 935–946. [Google Scholar]
- Bongers, E.M.; de Wijs, I.J.; Marcelis, C.; Hoefsloot, L.H.; Knoers, N.V. Identification of entire LMX1B gene deletions in nail patella syndrome: Evidence for haploinsufficiency as the main pathogenic mechanism underlying dominant inheritance in man. Eur. J. Hum. Genet. 2008, 16, 1240–1244. [Google Scholar] [CrossRef] [PubMed]
- Seri, M.; Melchionda, S.; Dreyer, S.; Marini, M.; Carella, M.; Cusano, R.; Piemontese, M.R.; Caroli, F.; Silengo, M.; Zelante, L.; et al. Identification of LMX1B gene point mutations in Italian patients affected with nail patella syndrome. Int. J. Mol. Med. 1999, 4, 285–290. [Google Scholar]
- Bongers, E.M.; Gubler, M.C.; Knoers, N.V. Nail patella syndrome. Overview on clinical and molecular findings. Pediatr. Nephrol. 2002, 17, 703–712. [Google Scholar]
- Knoers, N.V.; Bongers, E.M.; van Beersum, S.E.; Lommen, E.J.; van Bokhoven, H.; Hol, F.A. Nail patella syndrome: Identification of mutations in the LMX1B gene in Dutch families. J. Am. Soc. Nephrol. 2000, 11, 1762–1766. [Google Scholar] [PubMed]
- Hamlington, J.D.; Jones, C.; McIntosh, I. Twenty-two novel LMX1B mutations identified in nail patella syndrome (NPS) patients. Hum. Mutat. 2001, 18, 458. [Google Scholar] [CrossRef]
- Lin, Y.; Zhao, J.; Chen, S.; Zeng, X.; Du, Q.; Yang, Y.; Lu, F.; Pu, Y.; Yang, Z. A novel mutation in LMX1B gene causes nail patella syndrome in a large Chinese family. Bone 2008, 43, 591–595. [Google Scholar] [CrossRef] [PubMed]
- UCSC Genome Browser on Human Feb. 2009 (GRCh37/hg19) Assembly. Available online: http://genome.ucsc.edu (accessed on 1 April 2014).
- Schlaubitz, S.; Yatsenko, S.A.; Smith, L.D.; Keller, K.L.; Vissers, L.E.; Scott, D.A.; Cai, W.W.; Reardon, W.; Abdul-Rahman, O.A.; Lammer, E.J.; et al. Ovotestes and XY sex reversal in a female with an interstitial 9q33.3–q34.1 deletion encompassing NR5A1 and LMX1B causing features of Genitopatellar syndrome. Am. J. Med. Genet. A 2007, 143, 1071–1081. [Google Scholar]
- Lichter, P.R.; Richards, J.E.; Downs, C.A.; Stringham, H.M.; Boehnke, M.; Farley, F.A. Cosegregation of open-angle glaucoma and the nail patella syndrome. Am. J. Ophthalmol. 1997, 124, 506–515. [Google Scholar] [CrossRef] [PubMed]
- Lopez-Arvizu, C.; Sparrow, E.P.; Strube, M.J.; Slavin, C.; de Oleo, C.; James, J.; Hoover-Fong, J.; McIntosh, I.; Tierney, E. Increased symptoms of attention deficit hyperactivity disorder and major depressive disorder symptoms in nail patella syndrome: Potential association with LMX1B loss-of-function. Am. J. Med. Genet. B 2011, 156B, 59–66. [Google Scholar] [CrossRef]
- Sato, U.; Kitanaka, S.; Sekine, T.; Takahashi, S.; Ashida, A.; Igarashi, T. Functional characterization of LMX1B mutations associated with nail patella syndrome. Pediatr. Res. 2005, 57, 783–788. [Google Scholar] [CrossRef] [PubMed]
- Isojima, T.; Harita, Y.; Furuyama, M.; Sugawara, N.; Ishizuka, K.; Horita, S.; Kajiho, Y.; Miura, K.; Igarashi, T.; Hattori, M.; et al. LMX1B mutation with residual transcriptional activity as a cause of isolated glomerulopathy. Nephrol. Dial. Transplant. 2014, 29, 81–88. [Google Scholar]
© 2014 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jiang, S.; Zhang, J.; Huang, D.; Zhang, Y.; Liu, X.; Wang, Y.; He, R.; Zhao, Y. A Microdeletion of Chromosome 9q33.3 Encompasses the Entire LMX1B Gene in a Chinese Family with Nail Patella Syndrome. Int. J. Mol. Sci. 2014, 15, 20158-20168. https://doi.org/10.3390/ijms151120158
Jiang S, Zhang J, Huang D, Zhang Y, Liu X, Wang Y, He R, Zhao Y. A Microdeletion of Chromosome 9q33.3 Encompasses the Entire LMX1B Gene in a Chinese Family with Nail Patella Syndrome. International Journal of Molecular Sciences. 2014; 15(11):20158-20168. https://doi.org/10.3390/ijms151120158
Chicago/Turabian StyleJiang, Shujuan, Jiubin Zhang, Dan Huang, Yuanyuan Zhang, Xiaoliang Liu, Yinzhao Wang, Rong He, and Yanyan Zhao. 2014. "A Microdeletion of Chromosome 9q33.3 Encompasses the Entire LMX1B Gene in a Chinese Family with Nail Patella Syndrome" International Journal of Molecular Sciences 15, no. 11: 20158-20168. https://doi.org/10.3390/ijms151120158
APA StyleJiang, S., Zhang, J., Huang, D., Zhang, Y., Liu, X., Wang, Y., He, R., & Zhao, Y. (2014). A Microdeletion of Chromosome 9q33.3 Encompasses the Entire LMX1B Gene in a Chinese Family with Nail Patella Syndrome. International Journal of Molecular Sciences, 15(11), 20158-20168. https://doi.org/10.3390/ijms151120158