A Simple Strategy for Development of Single Nucleotide Polymorphisms from Non-Model Species and Its Application in Panax
Abstract
:1. Introduction
2. Results and Discussion
2.1. Development of SNPs from SCNG Library
2.2. Nucleotide Diversity in P. ginseng and P. quinquefolium
3. Experimental Section
3.1. Samples and DNA Extraction
3.2. SCNG Library Construction and Primer Design
3.3. PCR, Sequencing and Gene Function Prediction
3.4. SNP Genotyping and Data Analyses
4. Conclusions
Acknowledgments
Conflicts of Interest
References
- Agarwal, M.; Shrivastava, N.; Padh, H. Advances in molecular marker techniques and their applications in plant sciences. Plant Cell Report 2008, 27, 617–631. [Google Scholar]
- Botstein, D.; White, R.L.; Skolnick, M.; Davis, R.W. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet 1980, 32, 314–333. [Google Scholar]
- Williams, J.G.K.; Kubelik, A.R.; Livak, K.J.; Rafalski, J.A.; Tingey, S.V. DNA polymorphisms amplified by arbitrary primers areusefll as genetic markers. Nucleic Acids Res 1991, 18, 6531–6535. [Google Scholar]
- Vos, P.; Hogers, R.; Bleeker, M.; Reijans, M.; van de Lee, T.; Hornes, M.; Frijters, A.; Pot, J.; Peleman, J.; Kuiper, M.; Zabeau, M. AFLP: A new technique for DNA fingerprinting. Nucleic Acids Res 1995, 23, 4407–4414. [Google Scholar]
- Dong, Z.; Wang, H.; Dong, Y.; Wang, Y.; Liu, W.; Miao, G.J.; Lin, X.Y.; Wang, D.Q.; Liu, B. Extensive Microsatellite Variation in Rice Induced by Introgression from Wild Rice (Zizania latifolia Griseb.). PLoS One 2013, 8, e62317. [Google Scholar]
- Kalia, R.K.; Rai, M.K.; Kalia, S.; Singh, R.; Dhawan, A.K. Microsatellite markers: An overview of the recent progress in plants. Euphytica 2011, 177, 309–334. [Google Scholar]
- Varshney, R.K.; Graner, A.; Sorrells, M.E. Genic microsatellite markers in plants: Features and applications. Trends Biotechnol 2005, 23, 48–55. [Google Scholar]
- Clemento, A.J.; Abadia-Cardoso, A.; Starks, H.A.; Garza, J.C. Discovery and characterization of single nucleotide polymorphisms in Chinook salmon Oncorhynchus tshawytscha. Mol. Ecol. Resources 2011, 11, 50–66. [Google Scholar]
- Helyar, S.J.; Hemmer-Hansen, J.; Bekkevold, D.; Taylor, M.I.; Ogden, R.; Limborg, M.T.; Cariani, A.; Maes, G.E.; Diopere, E.; Carvalho, G.R.; et al. Application of SNPs for population genetics of nonmodel organisms: New opportunities and challenges. Mol. Ecol. Resources 2011, 11, 123–136. [Google Scholar]
- Geraldes, A.; Pang, J.; Thiessen, N.; Cezard, T.; Moore, R.; Zhao, Y.; Tam, A.; Wang, S.; Friedmann, I.; Seeb, J.E.; et al. SNP discovery in black cottonwood (Populus trichocarpa) by population transcriptome resequencing. Mol. Ecol. Resources 2011, 11, 81–92. [Google Scholar]
- Howe, G.T.; Yu, J.; Knaus, B.; Cronn, R.; Kolpak, S.; Dolan, P.; Lorenz, W.W.; Dean, J.F. A SNP resource for Douglas-fir: De novo transcriptome assembly and SNP detection and validation. BMC Genomics 2013, 14, 137. [Google Scholar]
- Wen, J.; Zimmer, E.A. Phylogeny and biogeography of Panax L. (the ginseng genus, Araliaceae): Inferences from ITS sequences of nuclear ribosomal DNA. Mol. Phylogenet. Evol 1996, 6, 167–177. [Google Scholar]
- Lee, C.; Wen, J. Phylogeny of Panax using chloroplast trnC–trnD intergenic region and the utility of trnC–trnD in interspecific studies of plants. Mol. Phylogenet. Evol 2004, 31, 894–903. [Google Scholar]
- Reunova, G.D.; Kats, I.L.; Muzarok, T.I.; Zhuravlev, Y.N. Polymorphism of RAPD, I.S.S.R. and AFLP markers of the Panax ginseng C.A. Meyer (Araliaceae) genome. Russ. J. Genet 2010, 46, 938–947. [Google Scholar]
- Zhuravlev, Y.N.; Reunova, G.D.; Kats, I.L.; Muzarok, T.I.; Bondar, A.A. Molecular variation of wild Panax ginseng C.A. Meyer (Araliaceae) by AFLP markers. Chin. Med 2010, 5, 21. [Google Scholar]
- Song, C.S.; Xu, R.Z.; Zhang, Q.H. Rare and Endangered Plants in China; China Forestry Press: Beijing, China, 1989. (In Chinese) [Google Scholar]
- Sun, J.; Chen, P. Differentiation of Panax quinquefolius grown in the USA and China using LC/MS-based chromatographic fingerprinting and chemometric approaches. Anal. Bioanal. Chem 2011, 399, 1877–1889. [Google Scholar]
- Benson, D.A.; Karsch-Mizrachi, I.; Lipman, D.J.; Ostell, J.; Sayers, E.W. GenBand. Nucleic Acids Res 2010, 38, D46–D51. [Google Scholar]
- Arai-Kichise, Y.; Shiwa, Y.; Nagasaki, H.; Ebana, K.; Yoshikawa, H.; Yano, M.; Wakasa, K. Discovery of genome-wide DNA polymorphisms in a landrace cultivar of japonica rice by whole-genome sequencing. Plant Cell Physiol 2011, 52, 274–282. [Google Scholar]
- Cao, J.; Schneeberger, K.; Ossowski, S.; Günther, T.; Bender, S.; Fitz, J.; Koenig, D.; Lanz, C.; Stegle, O.; Lippert, C.; et al. Whole-genome sequencing of multiple Arabidopsis thaliana populations. Nat. Genet 2011, 43, 956–963. [Google Scholar]
- Stölting, K.N.; Nipper, R.; Lindtke, D.; Caseys, C.; Waeber, S.; Castiglione, S.; Lexer, C. Genomic scan for single nucleotide polymorphisms reveals patterns of divergence and gene flow between ecologically divergent species. Mol. Ecol 2013, 22, 842–855. [Google Scholar]
- Subbaiyan, G.K.; Waters, D.L.; Katiyar, S.K.; Sadananda, A.R.; Vaddadi, S.; Henry, R.J. Genome-wide DNA polymorphisms in elite indica rice inbreds discovered by whole genome sequencing. Plant Biotechnol. J 2012, 10, 623–634. [Google Scholar]
- Seeb, J.E.; Carvalho, G.; Hauser, L.; Naish, K.; Roberts, S.; Seeb, L.W. Single-nucleotide polymorphism (SNP) discovery and applications of SNP genotyping in nonmodel organisms. Mol. Ecol. Resources 2011, 11, 1–8. [Google Scholar]
- Ekblom, R.; Galindo, J. Applications of next generation sequencing in molecular ecology of non-model organisms. Heredity 2010, 107, 1–15. [Google Scholar]
- O’Neil, S.; Dzurisin, J.D.; Carmichael, R.D.; Lobo, N.F.; Emrich, S.J.; Hellmann, J.J. Population-level transcriptome sequencing of nonmodel organisms Erynnis propertius and Papilio zelicaon. BMC Genomics 2011, 11, 310. [Google Scholar]
- Parchman, T.; Geist, K.; Grahnen, J.; Benkman, C.; Buerkle, C.A. Transcriptome sequencing in an ecologically important tree species: Assembly, annotation, and marker discovery. BMC Genomics 2011, 11, 180. [Google Scholar]
- Sánchez, C.; Smith, T.; Wiedmann, R.; Vallejo, R.; Salem, M.; Yao, J.; Rexroad, C. Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library. BMC Genomics 2009, 10, 559. [Google Scholar]
- Mammadov, J.; Chen, W.; Mingus, J.; Thompson, S.; Kumpatla, S. Development of versatile gene-based SNP assays in maize (Zea mays L.). Mol. Breeding 2012, 29, 779–790. [Google Scholar]
- Koren, O.G.; Potenko, V.V.; Zhuravlev, Y.N. Inheritance and variation of allozymes in Panax ginseng CA Meyer (Araliaceae). Int. J. Plant Sci 2003, 164, 189–195. [Google Scholar]
- Haudry, A.; Cenci, A.; Ravel, C.; Bataillon, T.; Brunel, D.; Poncet, C.; Hochu, I.; Poirier, S.; Santoni, S.; Glémin, S.; et al. Grinding up wheat: A massive loss of nucleotide diversity since domestication. Mol. Biol. Evol 2007, 24, 1506–1517. [Google Scholar]
- Wright, S.I.; Bi, I.V.; Schroeder, S.G.; Yamasaki, M.; Doebley, J.F.; McMullen, M.D.; Gaut, B.S. The Effects of Artificial Selection on the Maize Genome. Science 2005, 308, 1310–1314. [Google Scholar]
- Kilian, B.; Özkan, H.; Kohl, J.; Haeseler, A.; Barale, F.; Deusch, O.; Brandolini, A.; Yucel, C.; Martin, W.; Salamini, F. Haplotype structure at seven barley genes: Relevance to gene pool bottlenecks, phylogeny of ear type and site of barley domestication. Mol. Genet. Genomics 2006, 276, 230–241. [Google Scholar]
- Wang, H.; Sun, W.; Kwon, W.S.; Jin, H.; Yang, D.C. A PCR-based SNP marker for specific authentication of Korean ginseng (Panax ginseng) cultivar “Chunpoong”. Mol. Biol. Reports 2010, 37, 1053–1057. [Google Scholar]
- Duarte, J.M.; Wall, P.K.; Edger, P.P.; Landherr, L.L.; Ma, H.; Pires, J.C.; Leebens-Mack, J. Identification of shared single copy nuclear genes in Arabidopsis, Populus, Vitis and Oryza and their phylogenetic utility across various taxonomic levels. BMC Evol. Biol 2010, 10, 61. [Google Scholar]
- Altschul, S.F.; Madden, T.L.; Schäffer, A.A.; Zhang, J.; Zhang, Z.; Miller, W.; Lipman, D.J. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res 1997, 25, 3389–3402. [Google Scholar]
- Hu, S. Biological and Cytological Foundation for Better Ginseng to More People. Proceedings of the 3rd International Ginseng Symposium, Seoul, Korea, 8–10 September 1980; p. 171.
- Grushvitskii, I.V. Zhenshen: Voprosy Biologii (Ginseng: Problems in Biology); Leningrad; Akad, Nauk SSSR, 1961. [Google Scholar]
- Bulgakov, V.P.; Lauve, L.S.; Tchernoded, G.K.; Khodakovskaya, M.V.; Zhuravlev, Y.N. Chromosome Variation in Ginseng Cells Transformed with the rolC Plant Oncogene. Russ. J. Genet 2000, 36, 150–156. [Google Scholar]
- Thompson, J.D.; Gibson, T.J.; Plewniak, F.; Heanmougin, F.; Higgins, D.G. The CLUSTAL_X windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 1997, 25, 4876–4882. [Google Scholar]
- Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser 1999, 41, 95–98. [Google Scholar]
- Rozas, J.; Sánchez-Delbarrio, J.C.; Messeguer, X.; Rozas, R. DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics 2003, 19, 2496–2497. [Google Scholar]
- Tajima, F. Evolutionary relationship of DNA sequences in finite populations. Genetics 1983, 105, 437–460. [Google Scholar]
| Locus | Primer sequences (5′-3′) | Alignment (bp) | Ta (°C) | S | h | Hd | πT | πNon | Function annotation | |
|---|---|---|---|---|---|---|---|---|---|---|
| exon | intron | |||||||||
| PGN7 | F: CCCAATGCCCCCAGAGTTTT R: AGCGAGGTGCTGCTTGAAGT | 441 | 336 | 54 | 21 | 6 | 0.779 | 0.011 | 0.003 | beta-amyrin synthase |
| PW2 | F: AGCACAAGCTCAAGCGTCTC R: CAGTTGGCTGGCATAACACC | 63 | 269 | 48 | 5 | 12 | 0.947 | 0.007 | 0.015 | 40S ribosomal protein S27 |
| PW8 | F: ATAGCTCGTGTAACTGATGG R: TTGAGTGCGGGTGTCTGAAT | 119 | 555 | 64 | 30 | 10 | 0.926 | 0.000 | 0.000 | vesicle transport protein |
| PW16 | F: ATTGGTGGAGGGAAGGAACT R: GAGTGGCATGAGCAGTATGT | 170 | 278 | 52 | 7 | 9 | 0.905 | 0.009 | 0.004 | prolyl-tRNA synthetase |
| PW21 | F: AAAAGGTTGGCTACGAGTGG R: TACATGATGGGTGGAGGAGA | 146 | 140 | 64 | 2 | 3 | 0.658 | 0.003 | 0.000 | photosystem I reaction center subunit N |
| PW28 | F: GGGGTGGGAATTTGGAAGTA R: TGAAGGAGCATCGGAACCAT | 155 | 205 | 60 | 15 | 2 | 0.526 | 0.022 | 0.017 | photosystem I reaction center subunit H-2 |
| PZ7 | F: ACCTGGTTCGCTGCTATTCC R: CAAGCATTGGTTCCCTCTGG | 97 | 304 | 52 | 2 | 3 | 0.468 | 0.001 | 0.000 | PGR5-like protein 1A |
| PZ12 | F: GAGCGTTCTCAAATGCGGTAG R: CTTAGCCTCAAACTGGTCGG | 118 | 830 | 54 | 1 | 2 | 0.100 | 0.001 | 0.000 | 60S ribosomal protein |
| PZ15 | F: TGAACAGGCATTATTACTCG R: ACTCATCCTCCTCTTGAACG | 105 | 653 | 48 | 0 | 1 | 0.000 | 0.000 | 0.000 | 26S proteasome non-ATPase |
| PZ14 | F: CTTTGTTTCTCCTCCTCCAG R: GGATTTCCAGAGCAACCTTT | 178 | 667 | 54 | 11 | 4 | 0.621 | 0.007 | 0.000 | diacylglycerol kinase 1 |
| PZ10 | F: CTATGATGGGGTCTGGAGGG R: AGCAGTGATGGTGGATGAGG | 305 | 445 | 62 | 32 | 8 | 0.853 | 0.023 | 0.013 | glycine decarboxylase |
| PZ13 | F: AGCAGCCGAGTATGAAACCC R: CCTCAGGTAAACGATAACCG | 174 | 845 | 56 | 0 | 1 | 0.000 | 0.000 | 0.000 | signal peptidase complex subunit 3B |
| PZ1 | F: CACTACCCCGTTCTTTTCCG R: CCTTTTGTTCCTCAACCACC | 372 | 967 | 60 | 25 | 6 | 0.768 | 0.010 | 0.009 | glycine decarboxylase P-protein |
| PZ4 | F: TGTTGACCATCTACTCACCCAG R: CCTTCACGCATTCCCACAAT | 207 | 426 | 48 | 7 | 8 | 0.895 | 0.006 | 0.000 | hypothetical protein |
| PZ5 | F: TGACGGACTTGACCTAACAT R: CTTCAGATACAGCCCACAGC | 171 | 707 | 56 | 12 | 4 | 0.621 | 0.007 | 0.000 | ABC transporter F family member 3-like |
| PZ8 | F: GGGAAGGAAAAGTTGCTCTG R: TATTCGTGTTGGGGCATCTG | 196 | 545 | 60 | 7 | 4 | 0.779 | 0.005 | 0.000 | hypothetical protein |
| Locus | Alignment (bp) | Ta (°C) | S | h | Hd | πT | πNon | |
|---|---|---|---|---|---|---|---|---|
| exon | intron | |||||||
| PGN7 | 441 | 338 | 54 | 23 | 7 | 0.964 | 0.010 | 0.001 |
| PW2 | 60 | 266 | 48 | 15 | 8 | 0.956 | 0.027 | 0.079 |
| PW16 | 153 | 290 | 40 | 27 | 9 | 0.978 | 0.035 | 0.033 |
| PW21 | 152 | 134 | 60 | 16 | 2 | 0.556 | 0.031 | 0.047 |
| PZ7 | 98 | 290 | 52 | 11 | 4 | 0.733 | 0.016 | 0.015 |
| PZ15 | 96 | 665 | 48 | 0 | 1 | 0.000 | 0.000 | 0.000 |
| PZ14 | 178 | 675 | 49 | 9 | 5 | 0.800 | 0.005 | 0.004 |
| PZ10 | 302 | 445 | 60 | 26 | 2 | 0.556 | 0.019 | 0.021 |
| PZ5 | 204 | 516 | 46 | 26 | 7 | 0.911 | 0.020 | 0.040 |
| PZ8 | 138 | 477 | 60 | 7 | 4 | 0.822 | 0.006 | 0.000 |
| Species name | Locality | Country | Latitude/longitude | Elevation (meter) | Number of individuals | Sampling date | Voucher specimens |
|---|---|---|---|---|---|---|---|
| P. ginseng | TQL | China | 43°36′129″N 129°35′807″E | 469 | 2 | 9/2011 | NENU20110902001 |
| WHL | China | 43°30′181″N 127°54′193″E | 551 | 2 | 9/2011 | NENU20110903001 | |
| FS | China | 42°24′216″N 127°12′186″E | 589 | 2 | 7/2011 | NENU20110720001 | |
| JY | China | 42°23′197″N 126°48′490″E | 612 | 2 | 7/2011 | NENU20110713001 | |
| XJD | China | 42°20′870″N 128°44′449″E | 845 | 2 | 9/2011 | NENU20110902002 | |
| CB | China | 41°39′442″N 127°35′229″E | 936 | 2 | 9/2011 | NENU20110802001 | |
| LJ | China | 41°48′432″N 126°55′530″E | 663 | 2 | 8/2011 | NENU20110801001 | |
| BT | China | 41°18′492″N 125°49′954″E | 369 | 2 | 7/2011 | NENU20110718006 | |
| SZ | China | 40°45′595″N 125°20′863″E | 375 | 2 | 7/2011 | NENU20110718001 | |
| GL | China | 41°25′121″N 128°12′296″E | 765 | 2 | 9/2012 | NENU20130929001 | |
| P. quinquefolium | WS | USA | n.a. | n.a. | 5 | 9/2012 | n.a |
| JY | China | 42°23′197″N 126°48′490″E | 612 | 5 | 7/2011 | NENU20110713009 | |
© 2013 by the authors; licensee MDPI, Basel, Switzerland This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Li, M.R.; Wang, X.F.; Zhang, C.; Wang, H.Y.; Shi, F.X.; Xiao, H.X.; Li, L.F. A Simple Strategy for Development of Single Nucleotide Polymorphisms from Non-Model Species and Its Application in Panax. Int. J. Mol. Sci. 2013, 14, 24581-24591. https://doi.org/10.3390/ijms141224581
Li MR, Wang XF, Zhang C, Wang HY, Shi FX, Xiao HX, Li LF. A Simple Strategy for Development of Single Nucleotide Polymorphisms from Non-Model Species and Its Application in Panax. International Journal of Molecular Sciences. 2013; 14(12):24581-24591. https://doi.org/10.3390/ijms141224581
Chicago/Turabian StyleLi, Ming Rui, Xin Feng Wang, Cui Zhang, Hua Ying Wang, Feng Xue Shi, Hong Xing Xiao, and Lin Feng Li. 2013. "A Simple Strategy for Development of Single Nucleotide Polymorphisms from Non-Model Species and Its Application in Panax" International Journal of Molecular Sciences 14, no. 12: 24581-24591. https://doi.org/10.3390/ijms141224581
APA StyleLi, M. R., Wang, X. F., Zhang, C., Wang, H. Y., Shi, F. X., Xiao, H. X., & Li, L. F. (2013). A Simple Strategy for Development of Single Nucleotide Polymorphisms from Non-Model Species and Its Application in Panax. International Journal of Molecular Sciences, 14(12), 24581-24591. https://doi.org/10.3390/ijms141224581
