Development of Eighteen Microsatellite Markers in Anemone amurensis (Ranunculaceae) and Cross-Amplification in Congeneric Species
Abstract
:1. Introduction
2. Results and Discussion
3. Experimental Section
3.1. Isolation of Microsatellite Markers
3.2. Detection of Polymorphism and Data Analysis
4. Conclusions
Acknowledgments
References
- Wood, T.E.; Takebayashi, N.; Barker, M.S.; Mayrose, I.; Greenspoon, P.B.; Rieseberg, L.H. The frequency of polyploid speciation in vascular plants. Proc. Natl. Acad. Sci. USA 2009, 106, 13875–13879. [Google Scholar]
- Adams, K.L.; Wendel, J.F. Polyploidy and genome evolution in plants. Curr. Opin. Plant Biol 2005, 8, 135–141. [Google Scholar]
- Soltis, D.E.; Albert, V.A.; Leebens-Mack, J.; Bell, C.D.; Paterson, A.H.; Zheng, C.; Sankoff, D.; de Pamphilis, C.W.; Wall, P.K.; Soltis, P.S. Polyploidy and angiosperm diversification. Am. J. Bot 2009, 96, 336–348. [Google Scholar]
- Jiao, Y.; Wickett, N.J.; Ayyampalayam, S.; Chanderbali, A.S.; Landherr, L.; Ralph, P.E.; Tomsho, L.P.; Hu, Y.; Liang, H.; Soltis, P.S.; et al. Ancestral polyploidy in seed plants and angiosperms. Nature 2011, 473, 97–100. [Google Scholar]
- Gregory, W.C. Phylogenetic and cytological studies in the Ranunculaceae Juss. Trans. Amer. Phil. Soc 1941, 31, 443–521. [Google Scholar]
- Hoot, S.B.; Jeffrey, A.A.R.; Palmer, D. Phylogenetic relationships in Anemone (Ranunculaceae) based on morphology and chloroplast DNA. Syst. Bot 1994, 19, 169–200. [Google Scholar]
- Heimburger, M. Cytotaxonomic studies in the genus Anemone. Can. J. Bot 1959, 37, 587–612. [Google Scholar]
- Heimburger, M. Comparison of chromosome size in species of anemone and their hybrids. Chromosoma 1962, 13, 328–340. [Google Scholar]
- Zane, L.; Bargelloni, L.; Patarnello, T. Strategies for microsatellite isolation: A review. Mol. Ecol 2002, 11, 1–16. [Google Scholar]
- Vos, P.; Hogers, R.; Bleeker, M.; Reijans, M.; Lee, T.; Hornes, M.; Friters, A.; Pot, J.; Paleman, J.; Kuiper, M.; Zabeau, M. AFLP: A new technique for DNA fingerprinting. Nucleic Acids Res 1995, 23, 4407–4414. [Google Scholar]
- Li, L.F.; Pang, D.; Liao, Q.L.; Xiao, H.X. Genomic and EST microsatellite markers for Aquilegia flabellata and cross-amplification in A. oxysepala (Ranunculaceae). Am. J. Bot 2011, 98, e213–e215. [Google Scholar]
- Botstein, D.; White, D.L.; Skolnick, M.; Davis, R.W. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Amer. J. Hum. Genet 1980, 32, 314–331. [Google Scholar]
- Meirmans, P.G.; van Tienderen, P.H. Genotype and genodive: Two programs for the analysis of genetic diversity of asexual organisms. Mol. Ecol. Notes 2004, 4, 792–794. [Google Scholar]
- Saltonstall, K. Microsatellite variation within and among North American lineages of Phragmites australis. Mol. Ecol 2003, 12, 1689–1702. [Google Scholar]
- Raymond, M.; Rousset, F. GENEPOP (version 1.2): Population genetics software for exact tests and ecumenicism. J. Hered 1995, 86, 248–249. [Google Scholar]
Primer | Primer sequences (5′-3′) | Repeat | Size (bp) | Ta | NA | NGD | PIC | GenBank |
---|---|---|---|---|---|---|---|---|
BH84 | F: TTGCCATGGACCAATACTCG R:GTCAGTGCAAGAAAGTAGCTGC | (TG)9 | 172 | 48 | 6 | 0.91 | 0.59 | JQ518375 |
BH86 | F: CAACCTTGCAAACCCCCTCA R: CAAAAGTCGTCGTCACCTCC | (TG)16 | 209 | 48 | 4 | 0.82 | 0.71 | JQ518376 |
BH112 | F: GCATAAGGAGTAGTCATTTCA R: CCGCAAAGGTATATATATGTG | (AC)21 | 218 | 52 | 1 | 0.00 | 0.00 | JQ518377 |
BH206 | F: TGTTGTTTCCCTTACTTGCC R: CATCTTATGTCACACTTGGG | (GT)22A (TG)14 | 157 | 48 | 6 | 0.50 | 0.36 | JQ518378 |
BH235 | F: CATGGCCATTGGTATCAAAC R: TTGGTGGAACAACTTAGCCC | (GT)5A (TG)16 | 156 | 48 | 7 | 0.84 | 0.69 | JQ518379 |
HS27 | F: GGAAGCATCATCTCACCTAC R: TTCTAGTTTTGACTGGGAGG | (AC)7 | 182 | 50 | 4 | 0.66 | 0.71 | JQ518380 |
HS37 | F: ACACAGATTCCACTCACCAC R: ACCATATTAGGCATCTCGGG | (TC)7 (AC)10 | 198 | 50 | 8 | 0.87 | 0.57 | JQ518381 |
HS47 | F: CACACGCAAACAGAAACACA R: GCTTGAGGTTTCATGATACAG | (TG)22 | 309 | 50 | 1 | 0.00 | 0.00 | JQ518382 |
HS60 | F: CATCATGTGCATTGGTGTCT R: GATGCTAGGAGACCAGTCTA | (GT)18 | 154 | 50 | 1 | 0.00 | 0.00 | JQ518383 |
HS117 | F: GAACACATCATTCATAGAGC R: TCCGATACAGTTTGACACTT | (GT)6 | 284 | 50 | 1 | 0.00 | 0.00 | JQ518384 |
HS177 | F: GAAAATGTGACCGTCCCTAC R: TGTCATTGGCTCACCACCTT | (AC)7 | 194 | 48 | 3 | 0.52 | 0.61 | JQ518385 |
HS191 | F: GGAGAGTGGTGTAATACCCG R: ACACTGATGTGGGCAAGGTC | (TG)21 | 272 | 48 | 1 | 0.00 | 0.00 | JQ518386 |
HS199 | F: GAGTGGAAGATCTGTGCAGG R: AGTGTGGGGTGAAACTCCTA | (CA)8 | 199 | 50 | 7 | 0.86 * | 0.70 | JQ518387 |
HS256 | F: CTGTTCCTCCGATGGCGTTT R: ACCTTACCCTTCCCCTCTTC | (TG)7 | 211 | 50 | 5 | 0.76 | 0.50 | JQ518388 |
HS263 | F: ACCAACTCACACACCAAATA R: GATCGTGATGACAAGGAGAA | (TG)7 | 299 | 50 | 1 | 0.00 | 0.00 | JQ518389 |
HS283 | F: ATGAGATGGGGATTTATGCC R: CCTTTCGGGCTTTACAACCT | (GT)6 | 183 | 50 | 1 | 0.00 | 0.00 | JQ518390 |
HS316 | F: ACTTGGGAGGTTGTTTTTGG R: CAAACTTGACTCGACACCTC | (TG)6 | 189 | 50 | 4 | 0.74 | 0.54 | JQ518391 |
HS321 | F: TGTGGAGGAAGAAGATGGTC R: GAGTGCCGCAAGATTGACAT | (CA)8 | 321 | 52 | 4 | 0.90 | 0.61 | JQ518392 |
Locus | Kuandian (N = 15) | Langxiang (N = 20) | Dunhua (N = 17) | ||||||
---|---|---|---|---|---|---|---|---|---|
NA | NGD | PIC | NA | NGD | PIC | NA | NGD | PIC | |
BH84 | 5 | 0.87 | 0.71 | 6 | 0.84 | 0.67 | 5 | 0.94 | 0.57 |
BH86 | 4 | 0.41 | 0.65 | 4 | 0.86 | 0.71 | 4 | 0.70 | 0.68 |
BH112 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 |
BH206 | 6 | 0.52 | 0.83 | 6 | 0.00 | 0.83 | 6 | 0.54 | 0.84 |
BH235 | 5 | 0.00 | 0.25 | 6 | 0.93 | 0.64 | 7 | 0.81 | 0.75 |
HS27 | 4 | 0.85 | 0.73 | 3 | 0.23 | 0.66 | 4 | 0.67 | 0.70 |
HS37 | 7 | 0.90 | 0.68 | 5 | 0.87 | 0.46 | 4 | 0.78 | 0.55 |
HS47 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 |
HS60 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 |
HS117 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 |
HS177 | 2 | 0.17 | 0.50 | 3 | 0.66 | 0.54 | 3 | 0.00 | 0.65 |
HS191 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 |
HS199 | 4 | 0.80 | 0.73 | 5 | 0.91 | 0.76 | 4 | 0.77 | 0.50 |
HS256 | 3 | 0.95 | 0.45 | 5 | 0.67 | 0.50 | 4 | 0.81 | 0.53 |
HS263 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 |
HS283 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 |
HS316 | 3 | 0.69 | 0.48 | 3 | 0.79 | 0.66 | 4 | 0.67 | 0.47 |
HS321 | 3 | 0.67 | 0.49 | 4 | 0.71 | 0.38 | 4 | 0.88 | 0.66 |
Locus | A. raddeana (N = 4) | A. silvestris (N = 4) | A. umbrosa (N = 4) | A. reflexa (N = 4) | A. cathayensis (N = 4) |
---|---|---|---|---|---|
BH84 | P (3) | P (3) | P (2) | P (2) | P (3) |
BH86 | - | - | - | - | - |
BH112 | M | M | M | M | M |
BH206 | - | P (4) | P (4) | P (2) | P (5) |
BH235 | P (4) | P (4) | P (4) | P (5) | - |
HS27 | - | M | M | M | - |
HS37 | - | - | M | P (2) | P (2) |
HS47 | - | - | P (2) | M | M |
HS60 | - | - | M | M | - |
HS117 | M | M | M | M | M |
HS177 | - | - | P (2) | P (2) | P (2) |
HS191 | M | M | M | M | M |
HS199 | - | - | - | P (2) | M |
HS256 | P (5) | - | - | P (2) | P (3) |
HS263 | P (2) | M | P (2) | P (2) | P (2) |
HS283 | M | - | M | M | M |
HS316 | - | - | - | P (2) | - |
HS321 | P (2) | - | P (2) | P (2) | P (3) |
© 2012 by the authors; licensee Molecular Diversity Preservation International, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Sun, M.; Yin, X.; Shi, F.; Li, L.; Li, M.; Li, L.; Xiao, H. Development of Eighteen Microsatellite Markers in Anemone amurensis (Ranunculaceae) and Cross-Amplification in Congeneric Species. Int. J. Mol. Sci. 2012, 13, 4889-4895. https://doi.org/10.3390/ijms13044889
Sun M, Yin X, Shi F, Li L, Li M, Li L, Xiao H. Development of Eighteen Microsatellite Markers in Anemone amurensis (Ranunculaceae) and Cross-Amplification in Congeneric Species. International Journal of Molecular Sciences. 2012; 13(4):4889-4895. https://doi.org/10.3390/ijms13044889
Chicago/Turabian StyleSun, Mingzhou, Xiao Yin, Fengxue Shi, Lin Li, Mingrui Li, Linfeng Li, and Hongxing Xiao. 2012. "Development of Eighteen Microsatellite Markers in Anemone amurensis (Ranunculaceae) and Cross-Amplification in Congeneric Species" International Journal of Molecular Sciences 13, no. 4: 4889-4895. https://doi.org/10.3390/ijms13044889