Isolation and Characterization of New Microsatellite Markers for the Invasive Softshell Clam, Mya arenaria (L.) (Bivalvia: Myidae)
Abstract
:1. Introduction
2. Results and Discussion
3. Experimental Section
4. Conclusions
Acknowledgments
References
- Abraham, B.J.; Dillon, P.L. Species Profiles: Life Histories and Environmental Requirements of Coastal Fishes and Invertebrates (Mid-Atlantic). Softshell clam. Biol. Rep 1986, 82, 1–18. [Google Scholar]
- Strasser, M. Mya arenaria—an ancient invader of the North Sea coast. Helgol. Meer 1999, 52, 309–324. [Google Scholar]
- Petersen, K.S.; Rasmussen, K.L.; Heinemeier, J.; Rud, N. Clams before Columbus? Nature 1992, 359, 679. [Google Scholar]
- Geist, J.; Rottmann, O.; Schröder, W.; Kühn, R. Development of microsatellite markers for the endangered freshwater pearl mussel Margaritifera margaritifera L. (Bivalvia: Unionoidea). Mol. Ecol. Notes 2003, 3, 444–446. [Google Scholar]
- Lasota, R.; Hummel, H.; Wolowicz, M. Genetic diversity of European populations of the invasive soft-shell clam Mya arenaria (Bivalvia). J. Mar. Biol. Assoc. UK 2004, 84, 1051–1056. [Google Scholar]
- Strasser, C.A.; Barber, P.H. Limited genetic variation and structure in softshell clams (Mya arenaria) across their native and introduced range. Conserv. Genet 2009, 10, 803–814. [Google Scholar]
- Barker, F.K.; Bell, J.J.; Bogdanowicz, S.M.; Bonatto, S.L.; Cezilly, F.; Collins, S.M.; Dubreuil, C.; Dufort, M.J.; Eraud, C.; Fuseya, R.; et al. Permanent genetic resources added to molecular ecology resources database 1 June 2011–31 July 2011. Mol. Ecol. Resour 2011, 11, 1124–1126. [Google Scholar]
- Koskinen, M.T.; Hirvonen, H.; Landry, P.-A.; Primmer, C.R. The benefits of increasing the number of microsatellites utilized in genetic population studies: An empirical perspective. Hereditas 2004, 141, 61–67. [Google Scholar]
- Hedgecock, D.; Li, G.; Hubert, S.; Bucklin, K.; Ribes, V. Widespread null alleles and poor cross-species amplification of microsatellite DNA loci cloned from the Pacific oyster Crassostrea gigas. J. Shellfish Res 2004, 23, 379–385. [Google Scholar]
- Imo, M.; Seitz, A.; Johannesen, J. Distribution and invasion genetics of the quagga mussel (Dreissena rostriformis bugensis) in German rivers. Aquat. Ecol 2010, 44, 731–740. [Google Scholar]
- Geist, J.; Geismar, J.; Kuehn, R. Isolation and characterization of the first microsatellite markers for the endangered swan mussel Anodonta cygnea L. (Bivalvia: Unionoidea). Conserv. Genet 2010, 11, 1103–1106. [Google Scholar]
- Sokolov, E.P. An improved method for DNA isolation from mucopolysaccharide-rich molluscan tissue. J. Moll. Stud 2000, 66, 573–575. [Google Scholar]
- Popa, O.P.; Iorgu, E.I.; Krapal, A.M.; Kelemen, S.B.; Murariu, D.; Popa, L.O. Isolation and characterization of the first microsatellite markers for the endangered relict mussel Hypanis colorata (Mollusca: Bivalvia: Cardiidae). Int. J. Mol. Sci 2011, 12, 456–461. [Google Scholar]
- Popa, O.P.; Popa, L.O.; Krapal, A.M.; Murariu, D.; Costache, M.; Iorgu, E.I. Sinanodonta woodiana (Mollusca: Bivalvia: Unionidae): Isolation and characterization of the first microsatellite markers. Int. J. Mol. Sci 2011, 12, 5255–5260. [Google Scholar]
- Rozen, S.; Skaletsky, H. Primer3 on the WWW for General Users and for Biologist Programmers. In Bioinformatics Methods and Protocols; Krawetz, S., Misener, S., Eds.; Humana Press: Totowa, NJ USA, 2000; pp. 365–386. [Google Scholar]
- Peakall, R.; Smouse, P.E. GENALEX 6: Genetic analysis in Excel. Population genetic software for teaching and research. Mol. Ecol. Notes 2006, 6, 288–295. [Google Scholar]
- Van Oosterhout, C.; Hutchinson, W.F.; Wills, D.P.M.; Shipley, P. Micro-checker: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar]
- Rousset, F. Genepop'007: A complete reimplementation of the Genepop software for Windows and Linux. Mol. Ecol. Resour 2008, 8, 103–106. [Google Scholar]
- Raymond, M.; Rousset, F. GENEPOP (version 1.2): Population genetics software for exact tests and ecumenicism. J. Heredity 1995, 86, 248–249. [Google Scholar]
Marker | GeneBank accession no. | Repeat motif | Primer sequence | Size range | Ta | NA | HO | HE | PHW | ||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
CT | MG | CT | MG | CT | MG | CT | MG | ||||||
Ma02 | JN850609.1 | (CT)14(CT)2(CT)2 | F: ggccctatatacccagcac | 204–246 | 52 | ||||||||
R: tgctgtctgagaagcctgtg | 9 | 9 | 0,552 | 0,683 | 0,801 | 0,720 | 0,000 * | 0,092 | |||||
Ma06 | JN850610.1 | (TC)25 | F: cctgacgggaataaaaacca | 148–212 | 50 | ||||||||
R: gactgacactggtaaacatttcg | 6 | 7 | 0,655 | 0,417 | 0,721 | 0,644 | 0,383 | 0,918 | |||||
Ma11 | JN850612.1 | (GA)6(GA)25 | F: tttggctcagaccatgtcaa | 158–198 | 52 | ||||||||
R: cggcgagcacactgtactat | 7 | 8 | 0,813 | 0,951 | 0,773 | 0,775 | 0,165 | 0,000 * | |||||
Ma12 | JN850613.1 | (CT)25 | F: gacatggctgtagaagaaattagaa | 198–376 | 50 | ||||||||
R: ttgcaacctctttggaaaatg | 14 | 13 | 0,765 | 0,711 | 0,895 | 0,838 | 0,900 | 0,258 | |||||
Ma14 | JN850614.1 | (GA)17(GA)6 | F: agcgtgctaagaatggccta | 184–254 | 53 | ||||||||
R: gcaatttttgaaagtccagagc | 6 | 7 | 0,567 | 0,725 | 0,643 | 0,674 | 0,212 | 0,149 | |||||
Ma15 | JN850615.1 | (GA)26 | F: aagggagggagtgacatgaa | 241–321 | 52 | ||||||||
R: taccaaatcccacggtcatt | 13 | 7 | 0,818 | 0,902 | 0,880 | 0,733 | 0,000 * | 0,058 | |||||
Ma26 | JN850617.1 | (GA)6(GA)3(GA)16(GA)3 | F: gtgcttggttatggcgagtt R: gcacacattttattacgagtgtatga | 224–306 | 53 | ||||||||
(GA)5(GA)3(GA)4(GA)11 | |||||||||||||
(GA)3(GA)7 | 9 | 9 | 0,697 | 0,771 | 0,787 | 0,804 | 0,007 * | 0,001 * |
© 2012 by the authors; licensee Molecular Diversity Preservation International, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Krapal, A.-M.; Popa, O.P.; Iorgu, E.I.; Costache, M.; Popa, L.O. Isolation and Characterization of New Microsatellite Markers for the Invasive Softshell Clam, Mya arenaria (L.) (Bivalvia: Myidae). Int. J. Mol. Sci. 2012, 13, 2515-2520. https://doi.org/10.3390/ijms13022515
Krapal A-M, Popa OP, Iorgu EI, Costache M, Popa LO. Isolation and Characterization of New Microsatellite Markers for the Invasive Softshell Clam, Mya arenaria (L.) (Bivalvia: Myidae). International Journal of Molecular Sciences. 2012; 13(2):2515-2520. https://doi.org/10.3390/ijms13022515
Chicago/Turabian StyleKrapal, Ana-Maria, Oana Paula Popa, Elena Iulia Iorgu, Marieta Costache, and Luis Ovidiu Popa. 2012. "Isolation and Characterization of New Microsatellite Markers for the Invasive Softshell Clam, Mya arenaria (L.) (Bivalvia: Myidae)" International Journal of Molecular Sciences 13, no. 2: 2515-2520. https://doi.org/10.3390/ijms13022515
APA StyleKrapal, A.-M., Popa, O. P., Iorgu, E. I., Costache, M., & Popa, L. O. (2012). Isolation and Characterization of New Microsatellite Markers for the Invasive Softshell Clam, Mya arenaria (L.) (Bivalvia: Myidae). International Journal of Molecular Sciences, 13(2), 2515-2520. https://doi.org/10.3390/ijms13022515