Nuclear Microsatellite Primers for the Endangered Relict Fir, Abies pinsapo (Pinaceae) and Cross-Amplification in Related Mediterranean Species
Abstract
:1. Introduction
2. Results and Discussion
2.1. Primers for Abies pinsapo
2.2. Cross-Amplification in Other Mediterranean Abies Species
3. Experimental Section
3.1. DNA Extraction, 454 Sequencing and Microsatellite Discovery
3.2. Primer Amplification and Quality Test
3.3. Genotyping and Cross-Amplification
3.4. Genetic Analyses
4. Conclusions
Supplementary Information
ijms-13-14243-s001.pdfAcknowledgments
References
- Arista, M.; Herrera, J.; Talavera, S. Biología del pinsapo (In Spanish); Junta de Andalucía, Consejería de Medio Ambiente: Andalusia, Spain, 1997. [Google Scholar]
- Frankham, R.; Ballou, J.D.; Briscoe, D.A. Introduction to Conservation Genetics; Cambridge University Press: New York, NY, USA, 2002; pp. 1–22. [Google Scholar]
- Martín, M.A.; Álvarez, J.B.; Martín, L.M. Genetic diversity of Spanish fir (Abies pinsapo Boiss.) populations by means of megagametophyte storage proteins. Anna. For. Sci 2010, 67, 1–7. [Google Scholar]
- Terrab, A.; Talavera, S.; Arista, M.; Paun, O.; Stuessy, T.F.; Tremetsberger, K. Genetic diversity at chloroplast microsatellites (cpSSRs) and geographic structure in endangered West Mediterranean firs (Abies spp., Pinaceae). Taxon 2007, 56, 409–416. [Google Scholar]
- García, F.J.; Pascual, L.; Perfectti, F. Diferenciación a Nivel Subespecífico de las Poblaciones Marroquíes de Abies pinsapo Boiss. Mediante un Estudio Enzimático (In Spanish). Proceedings of Evaluación de los Recursos Genéticos, Pontevedra, Spain; 1993; pp. 195–199. [Google Scholar]
- Pascual, L.; Garcia, F.J.; Perfectti, F. Estudio de la Variabilidad Genética en Poblaciones de Pinsapo (Abies pinsapo Boiss.) (In Spanish). Proceedings of Evaluación de los Recursos Genéticos, Pontevedra, Spain; 1993; pp. 201–205. [Google Scholar]
- Lefort, F.; Echt, C.; Streiff, R.; Vendramin, G.G. Microsatellite sequences: A new generation of molecular markers for forest genetics. For. Genet 1999, 6, 15–20. [Google Scholar]
- Hansen, O.; Vendramin, G.; Sebastiani, F.; Edwards, K. Development of microsatellite markers in Abies nordmanniana (Stev.) Spach and cross-species amplification in the Abies genus. Mol. Ecol. Notes 2005, 5, 784–787. [Google Scholar]
- Cremer, E.; Liepelt, S.; Sebastiani, F.; Buonamici, A.; Mychalczyk, I.M.; Ziegenhagen, B.; Vendramin, G. Identification and characterization of nuclear microsatellite loci in Abies alba Mill. Mol. Ecol. Notes 2006, 6, 374–376. [Google Scholar]
- Kimberly, A.S.; Toonen, R.J. Microsatellites for ecologists: A practical guide to using and evaluating microsatellite markers. Ecol. Lett 2006, 9, 615–629. [Google Scholar]
- Glenn, T.C.; Schable, N.A. Isolating microsatellite DNA loci. Methods Enzymol 2005, 395, 202–222. [Google Scholar]
- Abdelkrim, J.; Roberston, B.C.; Stanton, J.L.; Gemmell, N.J. Fast and cost-effective development of species-specific microsatellite markers by genomic sequencing. BioTechniques 2009, 46, 185–192. [Google Scholar]
- Lance, S.L.; Light, J.E.; Jones, K.L.; Hagen, C.; Hafner, J.C. Isolation and characterization of 17 polymorphic microsatellite loci in the kangaroo mouse, genus Microdipodops (Rodentia: Heteromyidae). Conserv. Genet. Resour 2010, 2, 139–141. [Google Scholar]
- Gardner, M.G.; Fitch, A.J.; Bertozzi, T.; Lowe, A.J. Rise of the machines—Recommendations for ecologists when using next generation sequencing for microsatellite development. Mol. Ecol. Res 2011, 11, 1093–1101. [Google Scholar]
- Huang, X.; Madan, A. CAP3: A DNA sequence assembly program. Genome Res 1999, 9, 868–877. [Google Scholar]
- Faircloth, B.C. Msatcommander: Detection of microsatellite repeat arrays and automated, locus-specific primer design. Mol. Ecol. Res 2008, 8, 92–94. [Google Scholar]
- Rozen, S.; Skaletsky, H.J. Primer3 on the WWW for General Users and for Biologist Programmers. In Bioinformatics Methods and Protocols: Methods in Molecular Biology; Krawetz, S., Misener, S., Eds.; Humana Press: Totowa, NJ, USA, 2000; Volume 132, pp. 365–386. [Google Scholar]
- Schuelke, M. An economic method for the fluorescent labeling of PCR fragments. Nat. Biotechnol 2000, 18, 233–234. [Google Scholar]
- Boutin-Ganache, I.; Raposo, M.; Raymond, M.; Deschepper, C.F. M13-tailed primers improve the readability and usability of microsatellite analyses performed with two different allele-sizing methods. Biotechniques 2001, 31, 24–28. [Google Scholar]
- Brownstein, M.J.; Carpten, J.D.; Smith, J.R. Modulation of non-templated nucleotide addition by Taq DNA polymerase: Primer modifications that facilitate genotyping. Biotechniques 1996, 20, 1004–1010. [Google Scholar]
- Kalinowski, S.T.; Taper, M.L.; Marshall, T.C. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Mol. Ecol 2007, 16, 1099–1106. [Google Scholar]
- Rousset, F. Genepop’007: A complete re-implementation of the GENEPOP software for Windows and Linux. Mol. Ecol. Res 2008, 8, 103–106. [Google Scholar]
| Locus | Primer sequences (5′-3′) a | Repeat motif | Size (bp) | Ta (°C) | Na | GenBank Accession No. |
|---|---|---|---|---|---|---|
| Pin8 | F: ‡TGATTTATCCTTCGGTCTTG R: *AAAGGGCTATGTTTGAATTG | (CTT)11 | 258 | 50 | 3 | JX473825 |
| Pin14 | F: ‡CAAATGTTGCAATGTAGGAC R: *CCGAATATCTTGCTAGTTGTC | (AGA)8 | 249 | 50 | 1 | JX473826 |
| Pin17 | F: ‡TCCGATCCAATAGAAGATTC R: *AAAGGTTGAATCAATGATCC | (ATTC)8 | 428 | 50 | 2 | JX473827 |
| Pin20 | F: ‡ATACAGTTATTGGCGACTCC R:*GTGAGGCGTGTGTACAATC | (CATA)8 | 296 | 50 | 4 | JX473828 |
| Pin22 | F: *GAGTCACATGCTTTGGTGAG R: ‡TTACCACTCAAGGCCATTAC | (CAT)7 | 108 | 50 | 1 | JX473829 |
| Pin25 | F: ‡CCCTAATTCAATGCAATTATC R: *GCATCCTGTAGAGCAACTTG | (TATG)8 | 167 | 50 | 1 | JX473830 |
| Pin29 | F: ‡TGATTTATCCTTCGGTCTTG R: *AAAGGGCTATGTTTGAATTG | (CTT)11 | 257 | 50 | 2 | JX473831 |
| Pin32 | F: ‡CAGCCCAAATAATTCTCTTC R: *TAGCCTTTCTTGATGGAGAG | (CAT)7 | 254 | 50 | 2 | JX473832 |
| Pin44 | F: *GAACGATACCATTGCATCTC R: †ACATGCTTTCTATTTCCAATC | (AC)11 | 138 | 50 | 2 | JX473833 |
| Pin48 | F: *CCATGGACTTCGGTAATATC R: ‡TCATGACAACAAGCGAGAAC | (GT)10 | 189 | 50 | 5 | JX473834 |
| Pin49 | F: †AAGCTGGATAATGAAAGGAC R: *GCAAATTGGTCTTTAACTCC | (AG)10 | 173 | 50 | 2 | JX473835 |
| Pin52 | F: ‡AACACCAGGCATTCACATC R: *ACTAGCTAAGCAACCACCTC | (CA)11 | 274 | 50 | 2 | JX473836 |
| Sierra de las Nieves (N = 10) | Grazalema (N = 10) | Sierra Bermeja (N = 10) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Locus | A | Ho | He | HWE | An | A | Ho | He | HWE | An | A | Ho | He | HWE | An |
| Pin8 | 2 | 0.400 | 0.442 | 0.880 | 0.024 | 2 | 0.100 | 0.479 | 0.014 | 0.640 | 3 | 0.500 | 0.416 | 0.774 | 0.000 |
| Pin14 | 1 | 0.000 | 0.000 | - | - | 1 | 0.000 | 0.000 | - | - | 1 | 0.000 | 0.000 | - | - |
| Pin17 | 1 | 0.000 | 0.000 | - | - | 1 | 0.000 | 0.000 | - | - | 2 | 0.100 | 0.100 | 0.868 | 0.000 |
| Pin20 | 3 | 0.300 | 0.416 | 0.667 | 0.128 | 2 | 0.000 | 0.189 | 0.002 | 0.907 | 1 | 0.000 | 0.000 | - | - |
| Pin22 | 1 | 0.000 | 0.000 | - | - | 1 | 0.000 | 0.000 | - | - | 1 | 0.000 | 0.000 | - | - |
| Pin25 | 1 | 0.000 | 0.000 | - | - | 1 | 0.000 | 0.000 | - | - | 1 | 0.000 | 0.000 | - | - |
| Pin29 | 2 | 0.400 | 0.442 | 0.880 | 0.024 | 2 | 0.100 | 0.479 | 0.014 | 0.640 | 2 | 0.500 | 0.395 | 0.292 | 0.000 |
| Pin32 | 1 | 0.000 | 0.000 | - | - | 1 | 0.000 | 0.000 | - | - | 2 | 0.200 | 0.442 | 0.098 | 0.355 |
| Pin44 | 2 | 0.600 | 0.505 | 0.429 | 0.000 | 2 | 0.400 | 0.337 | 0.429 | 0.000 | 2 | 0.400 | 0.526 | 0.527 | 0.111 |
| Pin48 | 4 | 0.400 | 0.600 | 0.640 | 0.192 | 3 | 0.500 | 0.542 | 0.179 | 0.000 | 4 | 0.500 | 0.432 | 0.981 | 0.000 |
| Pin49 | 2 | 0.300 | 0.479 | 0.281 | 0.205 | 2 | 0.500 | 0.521 | 0.975 | 0.000 | 2 | 0.400 | 0.337 | 0.429 | 0.000 |
| Pin52 | 2 | 0.100 | 0.100 | 0.868 | 0.000 | 2 | 0.200 | 0.189 | 0.725 | 0.000 | 2 | 0.200 | 0.442 | 0.098 | 0.355 |
| Species | Pin14 | Pin17 | Pin20 | Pin22 | Pin25 | Pin29 | Pin32 | Pin44 | Pin48 | Pin49 | Pin52 | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| P | A | P | A | P | A | P | A | P | A | P | A | P | A | P | A | P | A | P | A | P | A | |
| A. alba | (0/5) | - | (5/5) | 1 | (5/5) | 1 | (5/5) | 5 | (5/5) | 2 | (5/5) | 1 | (5/5) | 2 | (5/5) | 3 | (5/5) | 3 | (5/5) | 3 | (5/5) | 1 |
| A. boisii-regis | (5/5) | 1 | (5/5) | 3 | (5/5) | 5 | (5/5) | 2 | (5/5) | 8 | (5/5) | 5 | (5/5) | 5 | (5/5) | 4 | (5/5) | 6 | (5/5) | 2 | (5/5) | 5 |
| A. bornmuelleriana | (0/5) | - | (0/5) | - | (5/5) | 2 | (1/5) | 1 | (5/5) | 1 | (5/5) | 2 | (1/5) | 1 | (5/5) | 2 | (5/5) | 6 | (5/5) | 1 | (5/5) | 4 |
| A. cephalonica | (0/5) | - | (0/5) | - | (5/5) | 3 | (4/5) | 5 | (5/5) | 7 | (5/5) | 3 | (0/5) | - | (5/5) | 5 | (5/5) | 5 | (5/5) | 3 | (4/5) | 4 |
| A. cilicica | (0/5) | - | (1/5) | 1 | (5/5) | 1 | (0/5) | - | (5/5) | 3 | (5/5) | 2 | (0/5) | - | (5/5) | 1 | (5/5) | 7 | (5/5) | 1 | (5/5) | 4 |
| A. equi-trojani | (0/5) | - | (1/5) | 1 | (5/5) | 3 | (5/5) | 3 | (5/5) | 2 | (4/5) | 3 | (0/5) | - | (5/5) | 2 | (5/5) | 4 | (5/5) | 1 | (5/5) | 5 |
| A. marocana | (4/5) | 2 | (1/5) | 1 | (5/5) | 3 | (3/5) | 4 | (5/5) | 1 | (5/5) | 3 | (5/5) | 2 | (5/5) | 2 | (5/5) | 4 | (5/5) | 1 | (5/5) | 2 |
| A. nebrodensis | (0/3) | - | (0/3) | - | (3/3) | 1 | (1/3) | 1 | (3/3) | 2 | (3/3) | 2 | (3/3) | 3 | (3/3) | 2 | (3/3) | 1 | (3/3) | 2 | (3/3) | 3 |
| A. nordmanniana | (0/5) | - | (0/5) | - | (5/5) | 2 | (0/5) | - | (5/5) | 4 | (4/5) | 3 | (0/5) | - | (5/5) | 3 | (5/5) | 6 | (5/5) | 2 | (5/5) | 5 |
| A. numidica | (4/5) | 1 | (4/5) | 2 | (3/5) | 3 | (0/5) | - | (5/5) | 3 | (1/5) | 1 | (4/5) | 1 | (5/5) | 2 | (5/5) | 4 | (5/5) | 2 | (3/5) | 2 |
© 2012 by the authors; licensee Molecular Diversity Preservation International, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Sánchez-Robles, J.M.; Balao, F.; García-Castaño, J.L.; Terrab, A.; Navarro-Sampedro, L.; Talavera, S. Nuclear Microsatellite Primers for the Endangered Relict Fir, Abies pinsapo (Pinaceae) and Cross-Amplification in Related Mediterranean Species. Int. J. Mol. Sci. 2012, 13, 14243-14250. https://doi.org/10.3390/ijms131114243
Sánchez-Robles JM, Balao F, García-Castaño JL, Terrab A, Navarro-Sampedro L, Talavera S. Nuclear Microsatellite Primers for the Endangered Relict Fir, Abies pinsapo (Pinaceae) and Cross-Amplification in Related Mediterranean Species. International Journal of Molecular Sciences. 2012; 13(11):14243-14250. https://doi.org/10.3390/ijms131114243
Chicago/Turabian StyleSánchez-Robles, Jose M., Francisco Balao, Juan L. García-Castaño, Anass Terrab, Laura Navarro-Sampedro, and Salvador Talavera. 2012. "Nuclear Microsatellite Primers for the Endangered Relict Fir, Abies pinsapo (Pinaceae) and Cross-Amplification in Related Mediterranean Species" International Journal of Molecular Sciences 13, no. 11: 14243-14250. https://doi.org/10.3390/ijms131114243
APA StyleSánchez-Robles, J. M., Balao, F., García-Castaño, J. L., Terrab, A., Navarro-Sampedro, L., & Talavera, S. (2012). Nuclear Microsatellite Primers for the Endangered Relict Fir, Abies pinsapo (Pinaceae) and Cross-Amplification in Related Mediterranean Species. International Journal of Molecular Sciences, 13(11), 14243-14250. https://doi.org/10.3390/ijms131114243
