Sinanodonta woodiana (Mollusca: Bivalvia: Unionidae): Isolation and Characterization of the First Microsatellite Markers
Abstract
:1. Introduction
2. Results and Discussion
3. Experimental Section
4. Conclusions
Acknowledgments
References
- Watters, TG. A synthesis and review of the expanding range of the Asian freshwater mussel Anodonta woodiana (Lea, 1834) (Bivalvia:Unionidae). Veliger 1997, 40, 152–156. [Google Scholar]
- Wachtler, K; Dreher-Mansur, MC; Richter, T. Larval Types and Early Postlarval Biology in Naiads (Unionoida). In Ecology and Ecolution of Freshwater Mussels Unionoida; Bauer, G, Wachtler, K, Eds.; Springer: Berlin, German, 2001; pp. 93–125. [Google Scholar]
- Barnhart, MC; Haag, WR; Roston, WN. Adaptation to host infection and larval parasitism in Unionida. J. N. Am. Benthol. Soc 2008, 27, 370–394. [Google Scholar]
- Petro, E. The occurance of Anodonta woodiana woodiana in Hungary. Állaltani Közl 1984, 71, 189–191. [Google Scholar]
- Sarkany-Kiss, A. Anodonta woodiana (Lea, 1834) a new species in Romania (Bivalvia, Unionacea). Trav Mus Hist Nat Grigore Antipa 1986, XXVIII, 15–17. [Google Scholar]
- Corsi, I; Pastore, AM; Lodde, A; Palmerini, E; Castagnolo, L; Focardi, S. Potential role of cholinesterases in the invasive capacity of the freshwater bivalve, Anodonta woodiana (Bivalvia:Unionacea): a comparative study with the indigenous species of the genus Anodonta sp. Comp. Biochem. Phys. C 2007, 145, 413–419. [Google Scholar]
- Popa, O-P; Kelemen, SB; Murariu, D; Popa, LO. New records of Sinanodonta woodiana (Lea, 1834) (Mollusca: Bivalvia) from Eastern Romania. Aquat. Invasions 2007, 2, 155–157. [Google Scholar]
- Paunovic, M; Csanyi, B; Simic, V; Stojanovic, B; Predrag, C. Distribution of Anodonta (Sinanodonta) woodiana (Lea, 1834) in inland waters of Serbia. Aquat. Invasions 2006, 1, 154–160. [Google Scholar]
- Cappelletti, C; Cianfanelli, S; Beltrami, ME; Ciutti, F. Sinanodonta woodiana (Lea, 1834) (Bivalvia:Unionidae): a new non-indigenous species in Lake Garda (Italy). Aquat. Invasions 2009, 4, 685–688. [Google Scholar]
- Djajasasmita, M. The occurrence of Anodonta woodiana Lea, 1837 in Indonesia (Pelecypoda, Unionidae). Veliger 1982, 25, 175. [Google Scholar]
- Benson, AJ. Sinanodonta woodiana. Available online: http://nas.er.usgs.gov/queries/FactSheet.aspx?speciesID=2824 (accessed on 28 June 2011).
- Popa, OP; Popa, LO. Sinanodonta woodiana (Lea, 1834), Corbicula fluminea (O.F.Muller, 1774) and Dreissena bugensis (Andrusov, 1897) (Mollusca:Bivalvia): Alien invasive species in Romanian Fauna. Trav. Mus. Hist. Nat. Grigore Antipa 2006, 49, 7–12. [Google Scholar]
- Soroka, M. Genetic variability among freshwater mussel Anodonta woodiana (Lea, 1834) (Bivalvia:Unionidae) populations recently introduced in Poland. Zool. Sci 2005, 22, 1137–1144. [Google Scholar]
- Bloor, PA; Barker, FS; Watts, PC; Noyes, HA; Kemp, SJ. Microsatellite Libraries by Enrichment. Available online: http://www.genomics.liv.ac.uk/animal/research/microsatellite.pdf (accessed on 28 June 2011).
- Carleton, KL; Streelman, JT; Lee, BY; Garnhart, N; Kidd, M; Kocher, TD. Rapid isolation of CA microsatellites from the tilapia genome. Anim. Genet 2002, 33, 140–144. [Google Scholar]
- Popa, OP; Iorgu, EI; Krapal, AM; Kelemen, SB; Murariu, D; Popa, LO. Isolation and Characterization of the First Microsatellite Markers for the Endangered Relict Mussel Hypanis colorata (Mollusca: Bivalvia: Cardiidae). Int. J. Mol. Sci 2011, 12, 456–461. [Google Scholar]
- Rozen, S; Skaletsky, H. Primer3 on the WWW for General Users and for Biologist Programmers. In Bioinformatics Methods and Protocols; Krawetz, S, Misener, S, Eds.; Humana Press: Totowa, NJ, USA, 2000; pp. 365–386. [Google Scholar]
- Peakall, R; Smouse, PE. GENALEX 6: Genetic analysis in Excel. Population genetic software for teaching and research. Mol. Ecol. Notes 2006, 6, 288–295. [Google Scholar]
- Van Oosterhout, C; Hutchinson, WF; Wills, DPM; Shipley, P. Micro-checker: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar]
- Excoffier, L; Laval, G; Schneider, S. Arlequin ver. 3.0: An integrated software package for population genetics data analysis. Evol. Bioinforma. Online 2005, 1, 47–50. [Google Scholar]
Marker | Genebank Accession number | Repeat motif | Primer sequence | Ta | [MgCl2] | Size |
---|---|---|---|---|---|---|
SW2 | JN180655 | CA | F: caaaaatgaaccggacacct | 51 | 2.5 | 152–194 |
R: cccaaactcgttttcattgg | ||||||
SW3 | JN180656 | AT | F: tgaaactggtgtccaatcca | 53 | 2.5 | 154–184 |
R: ctcccgaaagagcacaacat | ||||||
SW4 | JN180657 | TG | F: agcgcaattaccagtggttt | 51 | 2.5 | 215–229 |
R: ttgattgcgatgactggaaa | ||||||
SW7 | JN180658 | CA | F: ctgccacactgcagatattgt | 51 | 2.5 | 213–233 |
R: aacacgttcgaaatccgagt | ||||||
SW13 | JN180659 | AC | F: cgccatgtcaaaaatcaaag | 55 | 2.5 | 237–283 |
R: gccacaagcatgagatgtgt | ||||||
SW14 | JN180660 | TG | F: cccgtgttgtcaaaggaaat | 53 | 2.5 | 178–222 |
R: tttttctggcgactttccac | ||||||
SW15 | JN180661 | CA | F: aaccgacaagtccttgcaata | 53 | 2.5 | 307–345 |
R:cagctgagtcgattaggacaga | ||||||
SW18 | JN180662 | GTTT | F: gtaacgtctcgtcgggtcat | 53 | 2.5 | 142–220 |
R: gcctcggtgctagacatcac |
Marker | Na | Hobs | Hexp | HWE-p |
---|---|---|---|---|
SW2 | 14 | 0.950 | 0.874 | 0.245 |
SW3 | 8 | 0.650 | 0.710 | 0.338 |
SW4 | 7 | 0.700 | 0.765 | 0.104 |
SW7 | 8 | 0.750 | 0.791 | 0.523 |
SW13 | 11 | 0.800 | 0.841 | 0.248 |
SW14 | 11 | 0.900 | 0.864 | 0.810 |
SW15 | 10 | 0.900 | 0.859 | 0.273 |
SW18 | 9 | 0.950 | 0.849 | 0.176 |
© 2011 by the authors; licensee MDPI, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Popa, O.P.; Popa, L.O.; Krapal, A.-M.; Murariu, D.; Iorgu, E.I.; Costache, M. Sinanodonta woodiana (Mollusca: Bivalvia: Unionidae): Isolation and Characterization of the First Microsatellite Markers. Int. J. Mol. Sci. 2011, 12, 5255-5260. https://doi.org/10.3390/ijms12085255
Popa OP, Popa LO, Krapal A-M, Murariu D, Iorgu EI, Costache M. Sinanodonta woodiana (Mollusca: Bivalvia: Unionidae): Isolation and Characterization of the First Microsatellite Markers. International Journal of Molecular Sciences. 2011; 12(8):5255-5260. https://doi.org/10.3390/ijms12085255
Chicago/Turabian StylePopa, Oana Paula, Luis Ovidiu Popa, Ana-Maria Krapal, Dumitru Murariu, Elena Iulia Iorgu, and Marieta Costache. 2011. "Sinanodonta woodiana (Mollusca: Bivalvia: Unionidae): Isolation and Characterization of the First Microsatellite Markers" International Journal of Molecular Sciences 12, no. 8: 5255-5260. https://doi.org/10.3390/ijms12085255