Proteomic Profiles of Mesenchymal Stem Cells Induced by a Liver Differentiation Protocol
Abstract
:1. Introduction
2. Results
2.1. Induction of MSCs Using the Liver Differentiation Protocol
2.2. Protein Expression Changed in Differentiated MSCs
3. Discussion
4. Experimental Section
4.1. Isolation and Culture of MSCs
4.2. Liver Differentiation Protocol
4.3. Western Blot Analyses
4.4. Periodic Acid-Schiff
4.5. Urea Production Assay
4.6. Two-Dimensional Gel Electrophoresis (2D-GE), Gel Scanning and Image Analysis
4.7. Tryptic in-Gel Digestion of 2-DE Spots and MALDI-TOF MS
4.8. Database Search for Protein Identification
4.9. RNA Extraction and RT-PCR
4.10. Statistical Analysis
5. Conclusions
Acknowledgments
References
- Timper, K; Seboek, D; Eberhardt, M; Linscheid, P; Christ-Crain, M; Keller, U; Muller, B; Zulewski, H. Human adipose tissue-derived mesenchymal stem cells differentiate into insulin, somatostatin, and glucagon expressing cells. Biochem. Biophys. Res. Commun 2006, 341, 1135–1140. [Google Scholar]
- Karnieli, O; Izhar-Prato, Y; Bulvik, S; Efrat, S. Generation of Insulin-Producing Cells from Human Bone Marrow Mesenchymal Stem Cells by Genetic Manipulation. Stem Cells 2007, 25, 2837–2844. [Google Scholar]
- Zemel, R; Bachmetov, L; Ad-El, D; Abraham, A; Tur-Kaspa, R. Expression of liver-specific markers in naïve adipose-derived mesenchymal stem cells. Liver Int 2009, 29, 1326–1337. [Google Scholar]
- Saulnier, N; Lattanzi, W; Puglisi, MA; Pani, G; Barba, M; Piscaglia, AC; Giachelia, M; Alfieri, S; Neri, G; Gasbarrini, G; Gasbarrini, A. Mesenchymal stromal cells multipotency and plasticity: Induction toward the hepatic lineage. Eur. Rev. Med. Pharmacol. Sci 2009, 13, 71–78. [Google Scholar]
- Giusta, MS; Andrade, H; Santos, AV; Castanheira, P; Lamana, L; Pimenta, AM; Goes, AM. Proteomic analysis of human mesenchymal stromal cells derived from adipose tissue undergoing osteoblast differentiation. Cytotherapy 2010, 12, 478–490. [Google Scholar]
- Disthabanchong, S; Niticharoenpong, K; Radinahamed, P; Stitchantrakul, W; Ongphiphadhanakul, B; Hongeng, S. Metabolic acidosis lowers circulating adiponectin through inhibition of adiponectin gene transcription. Nephrol Dial Transplant 2010. [Google Scholar] [CrossRef]
- Sadan, O; Melamed, E; Offen, D. Bone-marrow-derived mesenchymal stem cell therapy for neurodegenerative diseases. Expert Opin. Biol. Ther 2009, 9, 1487–1497. [Google Scholar]
- Cui, F; Wang, Y; Wang, J; Wei, K; Hu, J; Liu, F; Wang, H; Zhao, X; Zhang, X; Yang, X. The up-regulation of proteasome subunits and lysosomal proteases in hepatocellular carcinomas of the HBx gene knockin transgenic mice. Proteomics 2006, 6, 498–504. [Google Scholar]
- Tan, Y; Peng, X; Wang, F; You, Z; Dong, Y; Wang, S. Effects of Tumor Necrosis Factor-Alpha on the 26S Proteasome and 19S Regulator in Skeletal Muscle of Severely Scalded Mice. J. Burn Care Res 2006, 27, 226–233. [Google Scholar]
- Ni, M; Lee, AS. ER chaperones in mammalian development and human diseases. FEBS Lett 2007, 581, 3641–3651. [Google Scholar]
- Koivunen, P; Horelli-Kuitunen, N; Helaakoski, T; Karvonen, P; Jaakkola, M; Palotie, A; Kivirikko, KI. Structures of the Human Gene for the Protein Disulfide Isomerase-Related Polypeptide ERp60 and a Processed Gene and Assignment of These Genes to 15q15 and 1q21. Genomics 1997, 42, 397–404. [Google Scholar]
- Corazzari, M; Lovat, PE; Armstrong, JL; Fimia, GM; Hill, DS; Birch-Machin, M; Redfern, CP; Piacentini, M. Targeting homeostatic mechanisms of endoplasmic reticulum stress to increase susceptibility of cancer cells to fenretinide-induced apoptosis: The role of stress proteins ERdj5 and ERp57. Br. J. Cancer 2007, 96, 1062–1071. [Google Scholar]
- Ventura-Holman, T; Seldin, MF; Li, W; Maher, JF. The MurineFem1Gene Family: Homologs of the Caenorhabditis elegans Sex-Determination Protein FEM-1. Genomics 1998, 54, 221–230. [Google Scholar]
- Ventura-Holman, T; Maher, JF. Sequence, Organization, and Expression of the Human FEM1B Gene. Biochem. Biophys. Res. Commun 2000, 267, 317–230. [Google Scholar]
- Lu, D; Ventura-Holman, T; Li, J; McMurray, RW; Subauste, JS; Maher, JF. Abnormal Glucose Homeostasis and Pancreatic Islet Function in Mice with Inactivation of the Fem1b Gene. Mol. Cell Biol 2005, 25, 6570–6577. [Google Scholar]
- Leelawat, K; Narong, S; Udomchaiprasertkul, W; Leelawat, S; Tungpradubkul, S. Inhibition of PI3K increases oxaliplatin sensitivity in cholangiocarcinoma cells. Cancer Cell Int 2009, 9, 3. [Google Scholar]





| Primer | Forward | Reverse | Length |
|---|---|---|---|
| FEM1B | ACATTACCGGGTGCAGACTC | TTGTTGGCAATGCTGATGTT | 255 bp |
| PSMC2 | GGCAGATCAAGCAAGTTGAAG | TATTTTGGGTCCTCCGAATC | 205 bp |
| PDIA3 | CGAGCGCAAGCAGCGGGTTA | TGTCCACACCAGGGGGCGAA | 271 bp |
| GAPDH | GAAGGTGAAGGTCGGAG | GAAGATGGTGATGGGATTTC | 226 bp |
© 2010 by the authors; licensee MDPI, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Leelawat, K.; Narong, S.; Chaijan, S.; Sa-ngiamsuntorn, K.; Disthabanchong, S.; Wongkajornsilp, A.; Hongeng, S. Proteomic Profiles of Mesenchymal Stem Cells Induced by a Liver Differentiation Protocol. Int. J. Mol. Sci. 2010, 11, 4905-4915. https://doi.org/10.3390/ijms11124905
Leelawat K, Narong S, Chaijan S, Sa-ngiamsuntorn K, Disthabanchong S, Wongkajornsilp A, Hongeng S. Proteomic Profiles of Mesenchymal Stem Cells Induced by a Liver Differentiation Protocol. International Journal of Molecular Sciences. 2010; 11(12):4905-4915. https://doi.org/10.3390/ijms11124905
Chicago/Turabian StyleLeelawat, Kawin, Siriluck Narong, Suthidarak Chaijan, Khanit Sa-ngiamsuntorn, Sinee Disthabanchong, Adisak Wongkajornsilp, and Suradej Hongeng. 2010. "Proteomic Profiles of Mesenchymal Stem Cells Induced by a Liver Differentiation Protocol" International Journal of Molecular Sciences 11, no. 12: 4905-4915. https://doi.org/10.3390/ijms11124905
APA StyleLeelawat, K., Narong, S., Chaijan, S., Sa-ngiamsuntorn, K., Disthabanchong, S., Wongkajornsilp, A., & Hongeng, S. (2010). Proteomic Profiles of Mesenchymal Stem Cells Induced by a Liver Differentiation Protocol. International Journal of Molecular Sciences, 11(12), 4905-4915. https://doi.org/10.3390/ijms11124905
