A Facile and Promising Delivery Platform for siRNA to Solid Tumors
Abstract
1. Introduction
2. Results
2.1. In Vitro Transfection
2.2. The Polymerized Carrier, H2K-P, of siRNA Efficiently Silenced a Tumor Marker In Vivo
2.3. Brief Sonication Significantly Improved Silencing Activity of siRNA Polyplex In Vivo
2.4. NRP-1 Dependent H2K-P siLuc Polyplexes
2.5. Screening and Discovering Increasingly Effective Carriers of siRNA
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. Cell Lines
4.3. Polymers
4.4. siRNA
4.5. In Vitro HK siRNA Polyplex Formation for Luciferase Silencing
4.6. In Vivo HK siRNA Polyplex Preparations
4.7. Gel Retardation Assay
4.8. Particle Size and Surface Charge
4.9. In Vivo Bioluminescence Experiments
4.10. Quantitative PCR for Raf-1
4.11. Immunohistochemical Staining for Raf-1 of Tumors
4.12. NRP-1 Dependent Silencing of Luciferase Expression by Tumors
4.13. Statistics
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Couzin, J. Small RNAs Make Big Splash. Science 2002, 298, 2296–2297. [Google Scholar] [CrossRef] [PubMed]
- The Nobel Prize in Physiology or Medicine 2006. Available online: https://www.nobelprize.org/prizes/medicine/2006/summary/ (accessed on 11 June 2024).
- Carthew, R.W.; Sontheimer, E.J. Origins and Mechanisms of miRNAs and siRNAs. Cell 2009, 136, 642–655. [Google Scholar] [CrossRef] [PubMed]
- Guo, Q.; Liu, Q.; Smith, N.A.; Liang, G.; Wang, M.B. RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops. Curr. Genom. 2016, 17, 476–489. [Google Scholar] [CrossRef] [PubMed]
- Traber, G.M.; Yu, A.M. RNAi-Based Therapeutics and Novel RNA Bioengineering Technologies. J. Pharmacol. Exp. Ther. 2023, 384, 133–154. [Google Scholar] [CrossRef] [PubMed]
- Khvorova, A. siRNAs-A New Class of Medicines. JAMA 2023, 329, 2185–2186. [Google Scholar] [CrossRef]
- Raal, F.J.; Kallend, D.; Ray, K.K.; Turner, T.; Koenig, W.; Wright, R.S.; Wijngaard, P.L.J.; Curcio, D.; Jaros, M.J.; Leiter, L.A.; et al. Inclisiran for the Treatment of Heterozygous Familial Hypercholesterolemia. N. Engl. J. Med. 2020, 382, 1520–1530. [Google Scholar] [CrossRef]
- Ebenezer, O.; Comoglio, P.; Wong, G.K.; Tuszynski, J.A. Development of Novel siRNA Therapeutics: A Review with a Focus on Inclisiran for the Treatment of Hypercholesterolemia. Int. J. Mol. Sci. 2023, 24, 4019. [Google Scholar] [CrossRef]
- Wilkinson, M.J.; Bajaj, A.; Brousseau, M.E.; Taub, P.R. Harnessing RNA Interference for Cholesterol Lowering: The Bench-to-Bedside Story of Inclisiran. J. Am. Heart Assoc. 2024, 13, e032031. [Google Scholar] [CrossRef]
- Sehgal, I.; Eells, K.; Hudson, I. A Comparison of Currently Approved Small Interfering RNA (siRNA) Medications to Alternative Treatments by Costs, Indications, and Medicaid Coverage. Pharmacy 2024, 12, 58. [Google Scholar] [CrossRef]
- Springer, A.D.; Dowdy, S.F. GalNAc-siRNA Conjugates: Leading the Way for Delivery of RNAi Therapeutics. Nucleic Acid Ther. 2018, 28, 109–118. [Google Scholar] [CrossRef]
- Hu, B.; Zhong, L.; Weng, Y.; Peng, L.; Huang, Y.; Zhao, Y.; Liang, X.J. Therapeutic siRNA: State of the art. Signal Transduct. Target. Ther. 2020, 5, 101. [Google Scholar] [CrossRef] [PubMed]
- Corydon, I.J.; Fabian-Jessing, B.K.; Jakobsen, T.S.; Jørgensen, A.C.; Jensen, E.G.; Askou, A.L.; Aagaard, L.; Corydon, T.J. 25 years of maturation: A systematic review of RNAi in the clinic. Mol. Ther. Nucleic Acids 2023, 33, 469–482. [Google Scholar] [CrossRef] [PubMed]
- Li, G.; Gao, Y.; Gong, C.; Han, Z.; Qiang, L.; Tai, Z.; Tian, J.; Gao, S. Dual-Blockade Immune Checkpoint for Breast Cancer Treatment Based on a Tumor-Penetrating Peptide Assembling Nanoparticle. ACS Appl. Mater. Interfaces 2019, 11, 39513–39524. [Google Scholar] [CrossRef] [PubMed]
- Shi, Y.; van der Meel, R.; Chen, X.; Lammers, T. The EPR effect and beyond: Strategies to improve tumor targeting and cancer nanomedicine treatment efficacy. Theranostics 2020, 10, 7921–7924. [Google Scholar] [CrossRef]
- Sharifi, M.; Cho, W.C.; Ansariesfahani, A.; Tarharoudi, R.; Malekisarvar, H.; Sari, S.; Bloukh, S.H.; Edis, Z.; Amin, M.; Gleghorn, J.P.; et al. An Updated Review on EPR-Based Solid Tumor Targeting Nanocarriers for Cancer Treatment. Cancers 2022, 14, 2868. [Google Scholar] [CrossRef]
- Leng, Q.; Imtiyaz, Z.; Woodle, M.C.; Mixson, A.J. Delivery of Chemotherapy Agents and Nucleic Acids with pH-Dependent Nanoparticles. Pharmaceutics 2023, 15, 1482. [Google Scholar] [CrossRef]
- Rahman, A.M.; Yusuf, S.W.; Ewer, M.S. Anthracycline-induced cardiotoxicity and the cardiac-sparing effect of liposomal formulation. Int. J. Nanomed. 2007, 2, 567–583. [Google Scholar]
- Wainberg, Z.A.; Bekaii-Saab, T.; Boland, P.M.; Dayyani, F.; Macarulla, T.; Mody, K.; Belanger, B.; Maxwell, F.; Moore, Y.; Thiagalingam, A.; et al. First-line liposomal irinotecan with oxaliplatin, 5-fluorouracil and leucovorin (NALIRIFOX) in pancreatic ductal adenocarcinoma: A phase I/II study. Eur. J. Cancer 2021, 151, 14–24. [Google Scholar] [CrossRef]
- Imtiyaz, Z.; He, J.; Leng, Q.; Agrawal, A.K.; Mixson, A.J. pH-Sensitive Targeting of Tumors with Chemotherapy-Laden Nanoparticles: Progress and Challenges. Pharmaceutics 2022, 14, 2427. [Google Scholar] [CrossRef]
- Chou, S.T.; Leng, Q.; Scaria, P.; Woodle, M.; Mixson, A.J. Selective modification of HK peptides enhances siRNA silencing of tumor targets in vivo. Cancer Gene Ther. 2011, 18, 707–716. [Google Scholar] [CrossRef]
- Agrawal, A.; Leng, Q.; Imtiyaz, Z.; Mixson, A.J. Exploring the outer limits of polyplexes. Biochem. Biophys. Res. Commun. 2023, 678, 33–38. [Google Scholar] [CrossRef] [PubMed]
- Teesalu, T.; Sugahara, K.N.; Ruoslahti, E. Tumor-penetrating peptides. Front. Oncol. 2013, 3, 216. [Google Scholar] [CrossRef] [PubMed]
- Banerjee, S.; Sengupta, K.; Dhar, K.; Mehta, S.; D’Amore, P.A.; Dhar, G.; Banerjee, S.K. Breast cancer cells secreted platelet-derived growth factor-induced motility of vascular smooth muscle cells is mediated through neuropilin-1. Mol. Carcinog. 2006, 45, 871–880. [Google Scholar] [CrossRef]
- Berger, S.; Krhač Levačić, A.; Hörterer, E.; Wilk, U.; Benli-Hoppe, T.; Wang, Y.; Öztürk, Ö.; Luo, J.; Wagner, E. Optimizing pDNA Lipo-polyplexes: A Balancing Act between Stability and Cargo Release. Biomacromolecules 2021, 22, 1282–1296. [Google Scholar] [CrossRef] [PubMed]
- Thalmayr, S.; Grau, M.; Peng, L.; Pohmerer, J.; Wilk, U.; Folda, P.; Yazdi, M.; Weidinger, E.; Burghardt, T.; Hohn, M.; et al. Molecular Chameleon Carriers for Nucleic Acid Delivery: The Sweet Spot between Lipoplexes and Polyplexes. Adv. Mater. 2023, 35, e2211105. [Google Scholar] [CrossRef]
- Leng, Q.; Anand, A.; Mixson, A.J. pH modification of gel mobility shift improves polyplex selection In Vivo. Biochem. Biophys. Res. Commun. 2024, 738, 150566. [Google Scholar] [CrossRef] [PubMed]
- Chou, S.T.; Leng, Q.; Scaria, P.; Kahn, J.D.; Tricoli, L.J.; Woodle, M.; Mixson, A.J. Surface-modified HK:siRNA nanoplexes with enhanced pharmacokinetics and tumor growth inhibition. Biomacromolecules 2013, 14, 752–760. [Google Scholar] [CrossRef]
- Suk, J.S.; Xu, Q.; Kim, N.; Hanes, J.; Ensign, L.M. PEGylation as a strategy for improving nanoparticle-based drug and gene delivery. Adv. Drug Deliv. Rev. 2016, 99, 28–51. [Google Scholar] [CrossRef]
- Lee, D.-J.; He, D.; Kessel, E.; Padari, K.; Kempter, S.; Lächelt, U.; Rädler, J.O.; Pooga, M.; Wagner, E. Tumoral gene silencing by receptor-targeted combinatorial siRNA polyplexes. J. Control. Release 2016, 244, 280–291. [Google Scholar] [CrossRef]
- Bieber, T.; Elsässer, H.-P. Preparation of a Low Molecular Weight Polyethylenimine for Efficient Cell Transfection. BioTechniques 2001, 30, 74–81. [Google Scholar] [CrossRef]
- Teesalu, T.; Sugahara, K.N.; Kotamraju, V.R.; Ruoslahti, E. C-end rule peptides mediate neuropilin-1-dependent cell, vascular, and tissue penetration. Proc. Natl. Acad. Sci. USA 2009, 106, 16157–16162. [Google Scholar] [CrossRef] [PubMed]
- Sugahara, K.N.; Teesalu, T.; Karmali, P.P.; Kotamraju, V.R.; Agemy, L.; Girard, O.M.; Hanahan, D.; Mattrey, R.F.; Ruoslahti, E. Tissue-penetrating delivery of compounds and nanoparticles into tumors. Cancer Cell 2009, 16, 510–520. [Google Scholar] [CrossRef]
- Page, R.E.; Klein-Szanto, A.J.; Litwin, S.; Nicolas, E.; Al-Jumaily, R.; Alexander, P.; Godwin, A.K.; Ross, E.A.; Schilder, R.J.; Bassi, D.E. Increased expression of the pro-protein convertase furin predicts decreased survival in ovarian cancer. Cell Oncol. 2007, 29, 289–299. [Google Scholar] [CrossRef] [PubMed]
- Netzel-Arnett, S.; Hooper, J.D.; Szabo, R.; Madison, E.L.; Quigley, J.P.; Bugge, T.H.; Antalis, T.M. Membrane anchored serine proteases: A rapidly expanding group of cell surface proteolytic enzymes with potential roles in cancer. Cancer Metastasis Rev. 2003, 22, 237–258. [Google Scholar] [CrossRef]
- Seidah, N.G.; Prat, A. The biology and therapeutic targeting of the proprotein convertases. Nat. Rev. Drug Discov. 2012, 11, 367–383. [Google Scholar] [CrossRef]
- Leng, Q.; Mixson, A.J. The neuropilin-1 receptor mediates enhanced tumor delivery of H2K polyplexes. J. Gene Med. 2016, 18, 134–144. [Google Scholar] [CrossRef] [PubMed]
- Tang, Y.H.; Rockstroh, A.; Sokolowski, K.A.; Lynam, L.-R.; Lehman, M.; Thompson, E.W.; Gregory, P.A.; Nelson, C.C.; Volpert, M.; Hollier, B.G. Neuropilin-1 is over-expressed in claudin-low breast cancer and promotes tumor progression through acquisition of stem cell characteristics and RAS/MAPK pathway activation. Breast Cancer Res. 2022, 24, 8. [Google Scholar] [CrossRef]
- Akashi, Y.; Oda, T.; Ohara, Y.; Miyamoto, R.; Kurokawa, T.; Hashimoto, S.; Enomoto, T.; Yamada, K.; Satake, M.; Ohkohchi, N. Anticancer effects of gemcitabine are enhanced by co-administered iRGD peptide in murine pancreatic cancer models that overexpressed neuropilin-1. Br. J. Cancer 2014, 110, 1481–1487. [Google Scholar] [CrossRef]
- Sugahara, K.N.; Teesalu, T.; Karmali, P.P.; Kotamraju, V.R.; Agemy, L.; Greenwald, D.R.; Ruoslahti, E. Coadministration of a tumor-penetrating peptide enhances the efficacy of cancer drugs. Science 2014, 328, 1031–1035. [Google Scholar] [CrossRef]
- Pang, H.-B.; Braun, G.B.; Friman, T.; Aza-Blanc, P.; Ruidiaz, M.E.; Sugahara, K.N.; Teesalu, T.E.R. The CendR pathway: A novel cell penetration and transcytosis pathway regulated by nutrient availability. In Proceedings of the 105th Annual Meeting of the American Association for Cancer Research, San Diego, CA, USA, 5–9 April 2014. Abstract nr 5406. [Google Scholar]
- Pang, H.-B.; Braun, G.B.; Friman, T.; Aza-Blanc, P.; Ruidiaz, M.E.; Sugahara, K.N.; Teesalu, T.; Ruoslahti, E. An endocytosis pathway initiated through neuropilin-1 and regulated by nutrient availability. Nat. Commun. 2014, 5, 4904. [Google Scholar] [CrossRef]
- Cabral, H.; Matsumoto, Y.; Mizuno, K.; Chen, Q.; Murakami, M.; Kimura, M.; Terada, Y.; Kano, M.R.; Miyazono, K.; Uesaka, M.; et al. Accumulation of sub-100 nm polymeric micelles in poorly permeable tumours depends on size. Nat. Nanotechnol. 2011, 6, 815–823. [Google Scholar] [CrossRef] [PubMed]
- Tomizawa, M.; Shinozaki, F.; Motoyoshi, Y.; Sugiyama, T.; Yamamoto, S.; Sueishi, M. Sonoporation: Gene transfer using ultrasound. World J. Methodol. 2013, 3, 39–44. [Google Scholar] [CrossRef]
- Deshpande, M.C.; Prausnitz, M.R. Synergistic effect of ultrasound and PEI on DNA transfection in vitro. J. Control. Release 2007, 118, 126–135. [Google Scholar] [CrossRef]
- Bennett, M.J.; Aberle, A.M.; Balasubramaniam, R.P.; Malone, J.G.; Nantz, M.H.; Malone, R.W. Considerations for the Design of Improved Cationic Amphiphile-Based Transfection Reagents. J. Liposome Res. 1996, 6, 545–565. [Google Scholar] [CrossRef]
- Mixson, A.J.; Leng, Q.; Chou, S.T.; Woodle, M.C. Targeting Cancer with Peptide RNAi Nanoplexes. Methods Mol. Biol. 2019, 1974, 161–180. [Google Scholar] [CrossRef] [PubMed]
- Leng, Q.; Scaria, P.; Lu, P.; Woodle, M.C.; Mixson, A.J. Systemic delivery of HK Raf-1 siRNA polyplexes inhibits MDA-MB-435 xenografts. Cancer Gene Ther. 2008, 15, 485–495. [Google Scholar] [CrossRef]
- Leng, Q.; Kahn, J.; Zhu, J.; Scaria, P.; Mixson, J. Needle-like morphology of H2K4b polyplexes associated with increases in transfection in vitro. Cancer Ther. 2007, 5B, 193–202. [Google Scholar]
- Leng, Q.; Scaria, P.; Zhu, J.; Ambulos, N.; Campbell, P.; Mixson, A.J. Highly branched HK peptides are effective carriers of siRNA. J. Gene Med. 2005, 7, 977–986. [Google Scholar] [CrossRef] [PubMed]
- Tang, S.; Hang, Y.; Ding, L.; Tang, W.; Yu, A.; Zhang, C.; Sil, D.; Xie, Y.; Oupický, D. Intraperitoneal siRNA Nanoparticles for Augmentation of Gemcitabine Efficacy in the Treatment of Pancreatic Cancer. Mol. Pharm. 2021, 18, 4448–4458. [Google Scholar] [CrossRef]
- Alavi, A.; Hood, J.D.; Frausto, R.; Stupack, D.G.; Cheresh, D.A. Role of Raf in vascular protection from distinct apoptotic stimuli. Science 2003, 301, 94–96. [Google Scholar] [CrossRef]
- Matejuk, A.; Leng, Q.; Chou, S.T.; Mixson, A.J. Vaccines targeting the neovasculature of tumors. Vasc. Cell. 2011, 3, 7. [Google Scholar] [CrossRef] [PubMed]
- Wang, N.H.; Lei, Z.; Yang, H.N.; Tang, Z.; Yang, M.Q.; Wang, Y.; Sui, J.D.; Wu, Y.Z. Radiation-induced PD-L1 expression in tumor and its microenvironment facilitates cancer-immune escape: A narrative review. Ann. Transl. Med. 2022, 10, 1406. [Google Scholar] [CrossRef] [PubMed]
- Lau, J.; Cheung, J.; Navarro, A.; Lianoglou, S.; Haley, B.; Totpal, K.; Sanders, L.; Koeppen, H.; Caplazi, P.; McBride, J.; et al. Tumour and host cell PD-L1 is required to mediate suppression of anti-tumour immunity in mice. Nat. Commun. 2017, 8, 14572. [Google Scholar] [CrossRef] [PubMed]
HK Polymers | Sequences | Number and Content of a.a. in Linear or Terminal Branches 1 |
---|---|---|
H2K | K-H-K-H-H-K-H-H-K-H-H-K-H-H-K-H-H-K-H-K 2 | 20-mer (8K, 12H) |
H2K-CO2H | K-H-K-H-H-K-H-H-K-H-H-K-H-H-K-H-H-K-H-H-K-CO2H | 21-mer (8K, 13H) |
H3K-33 | K-H-K-H-H-K-H-H-K-H-H-H-K-H-H-H-K-H-H-H- K-H-H-H-K-H-H-K-H-H-K-H-K | 33-mer (11K, 22H) |
H2K-P 3 | [C-K-H-K-H-H-K-H-H-K-H-H-K-H-H-K-H-H-K-H-K-C]X | N.A. (8K, 12H, 2C) |
H3K(+H)4b 4 | [K-H-H-H-K-H-H-H-K-H-H-H-H-K-H-H-H-K]4LYS | 18-mer (5K, 13H) |
H2K4b-14 | [K-H-H-K-H-H-K-H-H-K-H-H-H-K]4LYS | 14-mer (5K, 9H) |
Polyplexes * | Inhibition |
---|---|
H2K-P (n = 8) | 49.6 ± 12.8 |
H3K(+H)4b (n = 4) | 13.8 ± 8.5 |
H2K (n = 3) | 16.4 ± 9.4 |
H2K-PS ** (n = 8) | 69.3 ± 5.8 |
H3K-33 ** (n = 3) | 25.7 ± 7.3 |
H3K-33 (85%)/H2K-CO2H ** (n = 3) | 78.8 ± 7.1 |
H3K-33 (75%)/H2K-CO2H ** (n = 3) | 81.6 ± 5.0 |
H2K4b-14 ** (n = 3) | 54.0 ± 15.9 |
Primer | Length | Sequence (5′-3′) |
---|---|---|
Raf-1-F | 20 | GTCCCAGCACTACCTTCTTT |
Raf-1-R | 22 | AAGGCGTGAGGTGTAGAATATC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Leng, Q.; Anand, A.; Mixson, A.J. A Facile and Promising Delivery Platform for siRNA to Solid Tumors. Molecules 2024, 29, 5541. https://doi.org/10.3390/molecules29235541
Leng Q, Anand A, Mixson AJ. A Facile and Promising Delivery Platform for siRNA to Solid Tumors. Molecules. 2024; 29(23):5541. https://doi.org/10.3390/molecules29235541
Chicago/Turabian StyleLeng, Qixin, Aishwarya Anand, and A. James Mixson. 2024. "A Facile and Promising Delivery Platform for siRNA to Solid Tumors" Molecules 29, no. 23: 5541. https://doi.org/10.3390/molecules29235541
APA StyleLeng, Q., Anand, A., & Mixson, A. J. (2024). A Facile and Promising Delivery Platform for siRNA to Solid Tumors. Molecules, 29(23), 5541. https://doi.org/10.3390/molecules29235541