Next Article in Journal
Antioxidant Activity of Natural Phenols and Derived Hydroxylated Biphenyls
Previous Article in Journal
Virtual Screening of Novel 24-Dehydroxysterol Reductase (DHCR24) Inhibitors and the Biological Evaluation of Irbesartan in Cholesterol-Lowering Effect
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

MYB24 Negatively Regulates the Biosynthesis of Lignin and Capsaicin by Affecting the Expression of Key Genes in the Phenylpropanoid Metabolism Pathway in Capsicum chinense

1
Sanya Nanfan Research Institute, Hainan University, Sanya 572025, China
2
College of Horticulture, Hainan University, Haikou 570228, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Molecules 2023, 28(6), 2644; https://doi.org/10.3390/molecules28062644
Submission received: 15 January 2023 / Revised: 10 March 2023 / Accepted: 10 March 2023 / Published: 14 March 2023

Abstract

The wide application of pepper is mostly related to the content of capsaicin, and phenylpropanoid metabolism and its branch pathways may play an important role in the biosynthesis of capsaicin. The expression level of MYB24, a transcription factor screened from the transcriptome data of the pepper fruit development stage, was closely related to the spicy taste. In this experiment, CcMYB24 was cloned from Hainan Huangdenglong pepper, a hot aromatic pepper variety popular in the world for processing, and its function was confirmed by tissue expression characteristics, heterologous transformation in Arabidopsis thaliana, and VIGS technology. The results showed that the relative expression level of CcMYB24 was stable in the early stage of pepper fruit development, and increased significantly from 30 to 50 days after flowering. Heterologous expression led to a significant increase in the expression of CcMYB24 and decrease in lignin content in transgenic Arabidopsis thaliana plants. CcMYB24 silencing led to a significant increase in the expression of phenylpropanoid metabolism pathway genes PAL, 4CL, and pAMT; lignin branch CCR1 and CAD; and capsaicin pathway CS, AT3, and COMT genes in the placenta of pepper, with capsaicin content increased by more than 31.72% and lignin content increased by 20.78%. However, the expression of PAL, pAMT, AT3, COMT, etc., in the corresponding pericarps did not change significantly. Although CS, CCR1, and CAD increased significantly, the relative expression amount was smaller than that in placental tissue, and the lignin content did not change significantly. As indicated above, CcMYB24 may negatively regulate the formation of capsaicin and lignin by regulating the expression of genes from phenylpropanoid metabolism and its branch pathways.

1. Introduction

Pepper is an annual or perennial plant of the genus Capsicum of Solanaceae. Because of its unique spicy flavor, the pepper is used in food [1], medical treatment [2], industry [3], environmental protection [4,5], military security [6], and other fields. Capsaicin, the main spice ingredient, is mainly synthesized in the placenta tissue of pepper fruit and accumulated in vacuoles of placenta epidermal cells. Its synthesis mainly involves, in phenylpropanoid metabolism, the capsaicin branch pathway (CBP) and branched chain fatty acid metabolism pathway [7,8].
As a ubiquitous and essential secondary metabolic pathway in plants, the phenylpropanoid metabolism pathway leads to the synthesis of downstream branch secondary metabolites such as capsaicin, lignin, flavonoids, and anthocyanins. Phenylalanine was used as the starting substance to form the CoA ester of phenylpropanoid acid under the catalysis of PAL, C4H, 4CL, etc., and to form capsaicin, lignin, flavonoids, anthocyanins, and other precursors in different catalytic pathways [9,10]. Capsaicin was synthesized from vanillylamine from the phenylpropanoid metabolic pathway and 8-methyl-6-quillenoic acid CoA formed by the branched-chain fatty acid pathway under CS catalysis. In addition to the primary metabolic pathway, it was found that the metabolism of glutamic acid, alanine, lignin, etc., may be related to spicy metabolism [11]. About 50 genes, including the PAL, C4H, and 4CL genes involved in phenylpropanoid metabolism, BCAT, KAS, and ACS, participated in the branched-chain fatty acid pathway; essential genes pAMT and AT for capsaicin biosynthesis, and lignin branch rate-limiting genes CCR, CAD, etc., were thought to be related to the formation of hot taste [12,13,14]. RNA analysis showed that the expression levels of most genes of the phenylpropanoid metabolism pathway in the pepper placenta were higher than those in other parts. The expression levels of PAL, C4H, pAMT, AT, KAS, and other genes in high-spicy peppers were much higher than those in low-spicy or non-spicy peppers, and the expression levels peaked at 20 to 40 days after the flowering and pollination of pepper or at the green ripening of pepper fruits [15,16,17]. High-throughput RNA-Seq found that PAL, C4H, COMT, C3H, BCAT, FatA, ACL, pAMT, and AT genes were up-regulated or expressed explicitly in pepper placenta tissues [9]. The silencing and expression levels of AT3, COMT, pAMT, KAS, KR1, and other genes significantly reduced the synthesis of capsaicin [18,19]. The lignin content in the pericarp and placenta of CcCCR2 silenced pepper decreased by 18.8% and 22.8%, respectively, while the capsaicin content increased by 16.2% and 19.1%, respectively [20]. It was suggested that differences in the temporal and spatial expression of phenylpropanoid, capsaicin, lignin, and branched chain fatty acid pathway genes might be the reason for the variation of the complex trait capsaicin content.
In plants, the temporal and spatial expression of genes related to quality and resistance is often regulated by transcription factors, especially MYB, which is the most important regulator of phenylpropanoid and branch pathway metabolism. AtMYB11, AtMYB12, and AtMYB111 activated the expression of CHS, CHI, and F3H, which promoted the flavonoid biosynthesis, and AtMYB3, AtMYB4, AtMYB7, and AtMYB32 could inhibit the expression of PAL, C4H, 4CL, and CCR genes, thereby reducing lignin biosynthesis [21,22]. In the capsaicin synthesis pathway, the expression level of structural genes was correlated with the degree of spiciness and was regulated cooperatively [23,24]. CaMYB31, CaMYB108, and CaMYB48 have been proven to be involved in the regulation of capsaicin biosynthesis [25]. CaMYB48 was found to directly control the expression of acyltransferases and ketoacyl-ACP synthetases and the accumulation of capsaicin-like compounds [26,27]. ZmMYB111 and ZmMYB148 in maize activated the activity of PAL, thus regulating the synthesis of phenylpropanoid derivatives [28]. In tomatoes, the SlMYB12 gene was proved to regulate the biosynthesis of flavonol substances [29]. The strawberry FvMYB24 gene was related to plant salt resistance. Moreover, after overexpression of the FvMYB24 gene, the expression of significant genes in the SOS pathway, such as AtSOS1, AtSOS2, and AtSOS3, significantly increased [30]. The R2R3-MYB transcription factor MdMYB24-like in apples participated in MeJA-induced anthocyanin biosynthesis [31].
Based on the type diversity and complex transcriptional regulation mechanism, more MYB studies are conducive to revealing the regulation mechanism of phenylpropanoid metabolism and the lignin, capsaicin, and other branch pathways. In previous transcriptome sequencing, we found that the expression of CcMYB24 in pepper fruits showed a similar increasing trend with the change in capsaicin content. In this study, CcMYB24 was cloned from the Hainan Huangdenglong pepper. It was indicated that it might regulate capsaicin and lignin biosynthesis by affecting phenylpropanoid metabolism and the expression of branch genes.

2. Results

2.1. Cloning and Sequence Analysis of CcMYB24 Transcription Factors

The sequenced results showed that the full length ORF of the CcMYB24 r gene was 864 bp, encoding 287 aa. By analyzing the physicochemical properties of CcMYB24 protein, we found that it has the following essential characteristics: the molecular formula was C2666H4470N864O1100S126; the molecular weight was 70,267.51 Da; the theoretical isoelectric point pI was 5.18; it does not contain a signal peptide and was a non-secretory protein; there was no transmembrane structure; and it was theoretically localized in the nucleus, indicating that this transcription factor may regulate gene transcription. In addition, the conserved structural domain was viewed using NCBI CDD and was found to be a typical R2R3-MYB structural domain. The evolutionary analysis revealed that the homologs of CcMYB24 were mainly CaMYB-like and CaMYB24 in Capsicum annuum and CbMYB24 in Capsicum baccatum (Figure 1A). Conserved motifs and gene structure maps of the MEME predicted analysis proteins are shown in Figure 1B,C.

2.2. Differential Expression of CcMYB24 in Different Growth and Development Stages of Pepper

The qRT-PCR analysis of Huangdenglong pepper fruit showed that the expression level of CcMYB24 was generally stable 10 to 30 days after flowering (Figure 2), but increased rapidly after 30 days. Compared with 30 days, the relative expression increased by about four times at 50 days after flowering. The relative expression level of CcMYB24 in placenta tissue was significantly higher than that in the pericarp. Because capsaicin is mostly synthesized in placenta tissue, it is believed that this difference in expression is related to the formation of spicy taste.

2.3. Heterologous Expression of the CcMYB24 Gene in A. thaliana

The seeds of infected A. thaliana were harvested and then transformed into the plates to screen the T2-generation positive seedlings (Figure 3C). Then, the RNA of T2-generation transgenic plants were extracted, and the cDNA was synthesized by reverse transcription PCR. Using pB-CcMYB24-R/F as primers, the actual length of the amplified fragment was about 2044 bp (since the M13 site was located on both sides of the insertion point of the target segment, the actual band length was 1180 bp + 864 bp) in transgenic A. thaliana plants, while the target band was not amplified from wild-type A. thaliana (Figure 3A). At the same time, the PCR reaction was performed using A. thaliana cDNA as a template, and the expected bands could be observed by gel electrophoresis (Figure 3B), which indicates that the CcMYB24 gene has been transferred into the A. thaliana genome and transcription has occurred, allowing the next step of the experiment. The relative expression of CcMYB24 in wild-type and transgenic A. thaliana showed that CcMYB24 had been overexpressed in transgenic plants (Figure 3D). Lignin content determination of the stems of T2-generation transgenic A. thaliana and wild-type A. thaliana plants showed that the lignin content was reduced by 29.47% in CcMYB24 transgenic A. thaliana compared with wild-type A. thaliana (Figure 3E).
It is speculated that the CcMYB24 inhibits phenylpropanoid lignin branching metabolism after being transferred into A. thaliana, so CcMYB24 may also play an inhibitory role in the lignin synthesis stage of pepper.

2.4. VIGS Identification of CcMYB24 in Hainan Huangdenglong Pepper

The analysis of qRT-PCR showed that the expression level of CcMYB24 decreased by 43.62% and 64.71% in the pericarp and placenta of infected pepper compared with the uninfected plants, respectively (Figure 4A). Further detection showed that the relative expression of PAL, 4CL, pAMT, BCAT, and KAS genes in the pericarp of the silenced plant fruit decreased by 28.73%, 83.87%, 2.01%, 63.93%, and 33.86%, respectively, while the relative expression of CS, AT3, COMT, CCR1, and CAD in the pericarp increased by 52.19%, 29.75%, 69.81%, 99.20%, and 191.49%, respectively, the relative expression of BCAT and KAS genes in the fruit placenta increased by 50.67% and 41.17%, respectively, and the relative expression of PAL, 4CL, pAMT, CS, AT3, COMT, CCR1, and CAD increased by 108.20%, 10.03%, 56.69%, 43.48%, 42.54%, 180.53%, 55.46%, and 222.80%, respectively (Figure 4B–K).
The analysis of capsaicin content in pepper with different treatments showed that the content increased by 7.22% in the mature fruit placenta tissue of plants infected with blank vectors, while it decreased by 8% in the pericarp. The capsaicin content of plants infected with blank vectors was not significantly different from that of untreated plants (Figure 5A). The changes of capsaicin in the pericarp and placenta of pepper after gene silencing treatment were different. The capsaicin content in the pericarp of pTRV2-CcMYB24 silenced plants increased by 21.33% compared with the untreated group, and increased by 31.72% in the placenta, respectively. There was no significant difference in lignin content in the placenta tissue and pericarp of fruit between the non-infected and blank vector-infected pepper, with an increase of 0.97% in the placenta and a decrease of 0.55% in the pericarp (Figure 5B). However, in the plants silenced by pTRV2-CcMYB24, the lignin content in the pericarp and placenta tissue increased by 11.16% and 20.78%, respectively, indicating that CcMYB24 had a significant effect on the lignin content in the placenta tissue.
Compared with the plants without silencing, the expression of PAL, 4CL, and pAMT-related genes in the phenylpropanoid metabolism pathway in plants infected with pTRV2-CcMYB24 decreased in the pericarp and increased in the placenta. In the fruits and placentas of plants infected with pTRV2-CcMYB24, the expression of BCAT and KAS genes related to the branched-chain fatty acid pathway decreased; the expression of CCR1 and CAD genes related to the lignin pathway and CS, AT3, and COMT genes related to the capsaicin pathway increased; the capsaicin content increased; and the lignin content increased. It was speculated that CcMYB24 has an inhibitory effect on both capsaicin and lignin synthesis.

3. Discussion

Capsaicin biosynthesis is a branch of phenylpropanoid metabolism in pepper. Its synthesis is regulated by a series of structural genes and transcription factors, and MYB transcription factors are an important regulatory gene in plants [32]. In peppers, only the MYB [33,34], WRKY [35], and ERF [36] transcription factor families were found to be associated with the regulation of spiciness. MYBs are widely involved in the regulation of phenylpropanoid metabolism [22,37,38,39,40] and gene expression in various branch pathways, such as the lignin [39], flavonoids [40], anthocyanidins [41,42], and proanthocyanidins [43] pathways. They are also involved in morphological formation regulation, stress, and other physiological activities.
Among plant MYBs, the most common are R2R3-MYB transcription factors, which regulate various biological processes such as tissue development, the abiotic stress response, and metabolism. Many genes and enzymes involved in capsaicin biosynthesis have been identified, cloned, and studied [44]. However, there are only a few studies on the MYB transcription factor of Capsicum chinense, and this study cloned the CcMYB24 transcription factor from the Hainan Huangdenglong pepper to view its conserved domain, which is the typical R2R3-MYB. It was subcellular in the nucleus through bioinformatics analysis, suggesting that it has a regulatory role. However, the research group speculated that the CcMYB24 gene was negatively correlated with the content of capsaicin, and CcMYB24 may affect the accumulation of capsaicin by regulating the synthesis of flavonoids, anthocyanins, and lignin. Hence, the heterologous expression of the CcMYB24 gene confirmed its function in A. thaliana and VIGS in pepper. Heterologous expression is often performed on the model plant A. thaliana to speculate on the function of plant genes [45,46].
In this experiment, the expression of genes related to phenylpropanoid metabolism in pTRV2-free plants did not change much compared with plants without gene silencing, consistent with previous studies [19]. Studies have shown that genes such as pAMT, BCAT, Ca4H, KAS, PAL, 4CL, CS, and AT3 were positively correlated with capsaicin synthesis [19,47,48,49]. Compared with the plants without silencing, the expression of PAL, 4CL, and pAMT-related genes in the phenylpropanoid metabolism pathway in plants infected with pTRV2-CcMYB24 decreased in the pericarp, and it increased in the placenta, which may be related to the synthesis of capsaicin being mainly in the placenta. In the fruit and placenta of plants infected with pTRV2-CcMYB24, the expression of related genes BCAT and KAS in the branched-chain fatty acid pathway decreased; the expression of related genes CCR1 and CAD in the lignin pathway and CS, AT3, and COMT in the capsaicin pathway increased; the capsaicin content increased, and the lignin content increased. It is speculated that CcMYB24 has an inhibitory effect on both capsaicin synthesis and lignin synthesis. The effect of CcMYB24 may be to activate the synthesis of related substances in other metabolic branches of the phenylpropanoid pathway, and the specific function needs to be further tested for identification.

4. Materials and Methods

4.1. Experimental Materials

Hainan Huangdenglong pepper (Capsicum chinense Jacq.) was from the pepper research group of the College of Horticulture, Hainan University. The full seeds were selected and soaked in a 55 °C thermostat water bath for 20 min, soaked in 0.1% potassium permanganate for 15 min, rinsed under running water for 2 min, and soaked in room temperature water for 12 h. Then, the seeds were placed in a Petri dish covered with paper towels, poured with water, exposed to 28 °C light for 16 h and 22 °C dark for 8 h to promote germination, and then seeded in a hole dish; after being exposed to white light, they grew to about six true leaves and were transplanted in pots.
Wild-type Arabidopsis thaliana (Columbia) was granted by the College of Tropical Crops, Hainan University. The seeds were placed in the refrigerated layer at low temperature and vernalized for 3 days, The seeds were evenly sprinkled on the nutrient soil and moisturized with plastic wrap. After the cotyledon was unfolded, the seeds were transplanted, and the seeds were exposed to light at 23 °C for 16 h and dark at 18 °C for 8 h, and the side branches grew more unopened buds in about four weeks for transformation.

4.2. Main Reagents

The FastPure® Plant Total RNA Isolation Kit (RC401), HiScript®III 1st Strand cDNA Synthesis Kit (R312), HiScript®III All-in-one RT SuperMix Perfect for qPCR (R333), 2 × Phanta® Max Master Mix (P515), 5minTM TA/Blunt-Zero Cloning Kit (C601), ChamQ Universal SYBR qPCR Master Mix (Q711), DH5α Competent Cell (C502), FastPure Plasmid Mini Kit (DC201), and ClonExpress® Ultra One Step Cloning Kit (C115) all refer to the instruction manual of Vazyme Biotech Co., Ltd. (Nanjing, China). A Gel Extraction Kit (CW2302M) was purchased from Cowin Biotech Co., Ltd. (Beijing, China) GV3101 Chemically Competent Cell (AC1001) was used according to the manufacturer’s protocol of Shanghai Weidi Biotechnology Co., Ltd. (Shanghai, China). Restriction enzymes from New England Biolabs (Beijing, China) LTD. were used. The primers were synthesized by Sango Biotech (Shanghai, China) Co., Ltd. Lignin test kits all refer to the instruction manual of Beijing Solarbio Science & Technology Co., Ltd. (Beijing, China). Capsaicin test kits were purchased from Beacon. Guangzhou Tianyihuiyuan Co., Ltd. (Guangzhou, China), completed sequencing. The remaining reagents were domestically produced for analytical purity.

4.3. Extraction of Total RNA and Synthesis of the First Strand of cDNA

The total RNA from pepper young leaves was extracted using a FastPure® Plant Total RNA Isolation Kit (RC401), and the concentration and purity of the extracted RNA were determined by Nanodrop ONE and agarose gel electrophoresis, and stored at −20 °C for later use. The first strand of cDNA was synthesized by reference to the HiScript®III 1st Strand cDNA Synthesis Kit (R312).

4.4. Cloning of the CcMYB24 Transcription Factor

According to the protein annotation information in the genome of Capsicum chinense on NCBI, CcMYB24 (PHU01939.1), primer premier 5.0 was used to design the cloning primers CcMYB24-F/R (Appendix A), using cDNA as the template for PCR amplification, 2 × Phanta Max Master Mix 25 μL, CcMYB24-F 2 μL, CcMYB24-R 2 μL, cDNA 5 μL, and ddH2O 16 μL. There was predenaturation at 95 °C for 3 min, denaturation at 95 °C for 15 s, annealing at 52 °C for 15 s, extension at 72 °C for 30 s, 35 extension cycles, 72 °C, and final extension for 5 min, 4 °C storage. The amplification products were detected by 1% agarose gel electrophoresis. The fragments of interest were purified and recovered by Cowin Biotech Century’s DNA Gel Extraction Kit, connected to the pCE2-TA vector by 5minTM TA/Blunt-Zero Cloning Mix, and then transformed into DH5α Competent Cell. The bacterial solution PCR was verified correctly and sent to Guangzhou Tianyihuiyuan Co., Ltd. for sequencing.

4.5. Bioinformatics Analysis of the CcMYB24 Gene

The nucleotide and amino acid sequences were compared by DNAMAN software. The Expasy-ProtParam tool (http://web.expasy.org/protparam/ (accessed on 18 November 2022) was used to predict its physicochemical properties; SignalP-5.0 Server (https://services.healthtech.dtu.dk/service.php?SignalP-5.0 (accessed on 18 November 2022)) to predict its protein signal peptide; TMHMM 2.0 (https://services.healthtech.dtu.dk/service.php?TMHMM-2.0 (accessed on 18 November 2022) to predict the protein transmembrane structure; PSORT II Prediction (https://psort.hgc.jp/form2.html (accessed on 18 November 2022) to predict subcellular localization; and CDD (http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi (accessed on 18 November 2022) to examine its conservative domains. MEME (http://meme-suit.org/index.html (accessed on 28 December 2022) was used to predict conserved motifs of proteins, and MEGA5.0 software and Evoview (https://evolgenius.info//evolview-v2 (accessed on 28 December 2022) were used to map the MYB24 protein sequence evolutionary tree of CcMYB24 and other species.

4.6. qRT-PCR Analysis of CcMYB24 in Different Growth and Development Stages of Pepper

RNA was extracted from Hainan Huangdenglong pepper pericarp and placenta at 10, 20, 30, 40, and 50 days after flowering, respectively, and was reversely transcribed into cDNA. Specific primers QMYB24-F/R and Actin-F/R (Appendix A) were designed using Primer Premier 5.0 based on CcMYB24 and Actin (AY486137.1) mRNA sequences. CcMYB24 was detected using a real-time PCR machine (Applied Biosystems by Thermo Fisher Scientific, Waltham, MA, USA) for CcMYB24 at different stages of growth and development. The qRT-PCR reaction system was: 2 × ChanQ Universal SYBR qPCR Master Mix, 10 μL; QMYB24-F and QMYB24-F, 0.4 μL each; cDNA, 2 μL; and ddH2O, 7.2 μL. The qRT-PCR reaction procedure was: 50 °C for 3 min, 95 °C for 30 s, 95 °C for 5 s, 60 °C for 30 s (fluorescence acquisition), and 72 °C for 30 s (fluorescence acquisition) for 40 cycles. The dissolution curve program was: 95 °C for 25 s, 60 °C for 60 s, and 95 °C for 1 s.

4.7. Heterologous Expression of CcMYB24 in A. thaliana

Based on cloning CcMYB24 in Hainan Huangdenglong pepper, ScaI and XBaI digestion sites on the pBI121 vector were selected and primers pB-CcMYB24-F/R with homologous arms were designed (Appendix A). The plasmid extracted from the sequenced CcMYB24 gene solution was used as a template to obtain fragments with homologous arms and digestion sites. The pBI121 no-load plasmid was linearized by endoenzyme digestion of ScaI and XBaI, followed by gel recovery. The insert with the homologous arm and digestion site was attached to the linearization vector. The homologous recombinant plasmid was converted into DH5α, single colonies were singled for PCR and sequencing verification, and the plasmid pBI121-CcMYB24 plant heterologous expression vector was extracted from the sequenced homologous recombinant plasmid to GV3101 Chemically Competent Cell.
The CcMYB24 gene was transformed with reference to A. thaliana inflorescence infection [50,51,52]. The total DNA of transgenic A. thaliana was extracted by the CTAB method. Positive plants identified correctly by PCR were continued in culture to collect T2 seeds. T2-generation seeds were screened for resistance using 50 μg/mL Kan. The total RNA of T2-generation A. thaliana leaves was extracted, and the expression of the CcMYB24 gene in transgenic A. thaliana plants was detected by qRT-PCR; A. thaliana plants with high expression were selected. Wild-type A. thaliana plants up to eight weeks old and T2-generation transgenic A. thaliana plants with positive screening verification and high expression were dried at 80 °C, ground, and subjected to a 40-mesh sieve, and 5 mg was weighed for lignin assay.

4.8. VIGS of CcMYB24 in Hainan Huangdenglong Pepper

CcMYB24-specific fragments of about 400 bp were selected, the digestion sites BamHI and EcoRI were added at the 5′ end of the upstream and downstream primers, and a homologous arm of the pTRV2 vector of about 20 bp was added, respectively, and the primer pT-CcMYB24-F/R with a homologous arm (Appendix A) was designed. The homologous recombination method of the pTRV2-CcMYB24 plant heterologous expression vector was obtained.
When the fruits reached the green ripening stage, the plants with the same growth were divided into three experimental groups; each experimental group had three peppers: one group was pTRV2 unloaded, one group was pTRV2-CcMYB24, and another group was a blank control. Except for the blank control group, all other groups needed to be mixed with pTRV1 without load and injected. An amount of 100 μL of pTRV2 no-loaded Agrobacterium, pTRV2-CcMYB24 Agrobacterium, and pTRV1 Agrobacterium was added to 10 mL of YEB liquid medium (25 μg/mL Kan, Rif and Gen) at 28 °C, 200 rpm, and cultured for 16–20 h to make the OD600 value between 1.0 and 1.2. Then, to 1 mL of the cultured bacteria, 25 mL of IM induction medium was added at a ratio of 1:25 (NaH2PO4, glucose and MES) at 28 °C, 200 rpm, and cultured for 16 h, so that the OD600 value was about 0.9. Then, the cultured bacteria were centrifuged at 4 °C, 3500 rpm for 10 min to collect the bacteria, 25 mL of MES was added to resuspend the bacteria, and they were centrifuged again at 4 °C for 10 min. Next, the bacteria were resuspended with 1/2 volume of MES to an OD600 of about 1.0, and 50 μL of 200 mM AS was added per 25 mL pTRV1 (the final concentration of AS was 400 μM, and the bacteria OD600 was about 2.0). pTRV1 was mixed with pTRV2 no-load and pTRV2-CcMYB24 at 1:1, respectively, so that the final concentration of AS was 200 μM, with an OD600 of about 1.0, and was placed in the dark at about 23 °C for 3 h. In the placenta of the young fruit, about five days after injection of pepper flowers, the plants were dark treated at 16 °C for 24 h, then placed in light at 24 °C/16 h and dark at 22 °C/8 h to continue incubation. After the pepper was ripe, the content of capsaicin and lignin in the pericarp and placenta of the pepper, as well as the expression of genes related to phenylpropanoid metabolism, were measured. The genes and primers determined are shown in Appendix A. Actin was the internal reference, and the qRT-PCR reaction system and procedure were consistent with 4.6.

4.9. Statistical Analysis

All experiments were repeated three times. Data are presented as the mean ± standard error. Statistical comparisons of the data obtained were performed by SPSS. The data were statistically analyzed by using Student’s t-test, with p < 0.05 being considered significant.

5. Conclusions

In this study, we analyzed the expression characteristics of the CcMYB24 gene, which was hypothesized to be negatively correlated with capsaicin content by the group in the previous stage. We confirmed its function by heterologous expression of the CcMYB24 gene in A. thaliana and VIGS in pepper. The results indicate that CcMYB24 may play an inhibitory role in the lignin synthesis pathway in A. thaliana. It is determined that CcMYB24 can inhibit the synthesis of capsaicin and lignin, but whether it also affects the expression of other branch-related genes of phenylpropanoid metabolism and the synthesis of metabolites remains to be further studied.

Author Contributions

S.Y. wrote the manuscript; S.Y., W.Z. and S.C. conceived and designed the experiments; S.Y. and W.Z. completed the experiments and data analysis; L.Z., D.W., P.S., C.H. and G.F. were helpful with some technology of the experiments; Q.D. and Z.W. led and guided the study; S.C. led and guided the study and revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (32160717) and Hainan Provincial Natural Science Foundation High-level Talents Project (grant No. 2019RC030).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

Sample Availability

Samples of the compounds are available from the authors.

Appendix A. Primer Sequences

Table A1. The lowercase portion of the primer sequence above is the homology arm.
Table A1. The lowercase portion of the primer sequence above is the homology arm.
PrimerSequence (5′–3′)Use
CcMYB24-FATGAGTAGTAATAATAATAATAATAATTTATCATCClone
CcMYB24-RTCAAATATCTACATCTCCTAGCClone
pB-CcMYB24-FgagaacacgggggactctagaATGAGTAGTAATAATAATAATAATAATTTATCATCOverexpression
pB-CcMYB24-RcgatcggggaaattcgagctcTCAAATATCTACATCTCCTAGCOverexpression
pT-CcMYB24-FgtgagtaaggttaccgaattcGAAGCAATAAAGAATCTATGGGTAVIGS
pT-CcMYB24-RcgtgagctcggtaccggatccACAATGATCCTTCATTAGTAAACCVIGS
QMYB24-FAATAGCAAGAAGTTTGTTGAAGCAqRT-PCR
QMYB24-RTAAGGGTAAATTTGGAAATGAAAGqRT-PCR
Actin-FGTCCATCTGCTCTCTGTTGqRT-PCR
Actin-RCACCCCAAGCACAATAAGACqRT-PCR
PAL-FTGTCCCGTTGTCCTACATTGCTqRT-PCR
PAL-RCTCGGGCTTTCCATTCATCACqRT-PCR
4CL-FCTTCTTCTCAACCATCCCAACAqRT-PCR
4CL-RACGAAATCCTTGACTTCATCCTCqRT-PCR
pAMT-FTGGATTTGGAAGACTTGGGACAqRT-PCR
pAMT-RGCTTACAAGGACAGCGGCAqRT-PCR
COMT-FTAGCACATAACCCAGGAGGCAqRT-PCR
COMT-RCACAGCACACCTTACG GAATCTqRT-PCR
KAS-FTCGGCTATTGGTGTTGGTGGTqRT-PCR
KAS-RCACCTCCCAAGTATTCCGCTAqRT-PCR
AT3-FTCAAATGGCAGTTTCCCTTCTCqRT-PCR
AT3-RTCAAATGGCAGTTTCCCTTCTCqRT-PCR
CAD-FTATGGCACCAGAACAAGCAGqRT-PCR
CAD-RCTCCAAGTCCCAATATTCCACqRT-PCR
CCR1-FGATCCAGAACAAATGGTGGAGCqRT-PCR
CCR1-RCCAGCAAGTCTCGTCCA CAACqRT-PCR
CS-FTTGGCTCGCGTATAATGACTTqRT-PCR
CS-RTGCCGCTGGAATAACACCTCqRT-PCR

References

  1. Zhang, D.; Sun, X.; Battino, M.; Wei, X.; Shi, J.; Zhao, L.; Liu, S.; Xiao, J.; Shi, B.; Zou, X. A comparative overview on chili pepper (capsicum genus) and sichuan pepper (zanthoxylum genus): From pungent spices to pharma-foods. Trends Food Sci. Technol. 2021, 117, 148–162. [Google Scholar] [CrossRef] [Scilit]
  2. Saleh, B.K.; Omer, A.; Teweldemedhin, B. Medicinal uses and health benefits of chili pepper (Capsicum spp.): A review. MOJ Food Process. Technol. 2018, 6, 325–328. [Google Scholar] [CrossRef] [Scilit]
  3. Baenas, N.; Belović, M.; Ilic, N.; Moreno, D.A.; García, V.C. Industrial use of pepper (Capsicum annum L.) derived products: Technological benefits and biological advantages. Food Chem. 2019, 274, 872–885. [Google Scholar] [CrossRef] [Scilit]
  4. Pyo, M.Y.; Park, B.K.; Choi, J.J.; Yang, M.; Yang, H.O.; Cha, J.W.; Kim, J.-C.; Kim, I.S.; Lee, H.B.; Jin, M. Pheophytin a and chlorophyll a identified from environmentally friendly cultivation of green pepper enhance interleukin-2 and interferon-γ in Peyer’s patches ex vivo. Biol. Pharm. Bull. 2013, 36, 1747–1753. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Gudeva, L.K.; Mitrev, S.; Maksimova, V.; Spasov, D. Content of capsaicin extracted from hot pepper (Capsicum annuum ssp. microcarpum L.) and its use as an ecopesticide. Hem. Ind. 2013, 67, 671–675. [Google Scholar] [CrossRef] [Scilit]
  6. Srinivasan, K. Biological Activities of Red Pepper (Capsicum annuum) and Its Pungent Principle Capsaicin: A Review. Crit. Rev. Food Sci. Nutr. 2016, 56, 1488–1500. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Crapnell, R.D.; Banks, C.E. Electroanalytical overview: The pungency of chile and chilli products determined via the sensing of capsaicinoids. Analyst 2021, 146, 2769–2783. [Google Scholar] [CrossRef] [Scilit]
  8. Hideshi, F.; Tetsuya, S.; Kazuo, I. Capsaicinoid Formation in the Protoplast from the Placenta of Capsicum Fruits. Agric. Biol. Chem. 2014, 46, 2591–2592. [Google Scholar] [CrossRef] [Scilit]
  9. Liu, S.; Chen, C.; Chen, G.; Cao, B.; Chen, Q.; Lei, J. RNA-sequencing tag profiling of the placenta and pericarp of pungent pepper provides robust candidates contributing to capsaicinoid biosynthesis. Plant Cell Tissue Organ Cult. 2012, 110, 111–121. [Google Scholar] [CrossRef] [Scilit]
  10. Zhang, Y.; Butelli, E.; Alseekh, S.; Tohge, T.; Rallapalli, G.; Luo, J.; Kawar, P.G.; Hill, L.; Santino, A.; Fernie, A.R.; et al. Multi-level engineering facilitates the production of phenylpropanoid compounds in tomato. Nat. Commun. 2015, 6, 8635. [Google Scholar] [CrossRef] [Scilit]
  11. Han, K.; Lee, H.Y.; Ro, N.Y.; Hur, O.S.; Lee, J.H.; Kwon, J.K.; Kang, B.C. QTL mapping and GWAS reveal candidate genes controlling capsaicinoid content in Capsicum. Plant Biotechnol. J. 2018, 16, 1546–1558. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Mazourek, M.; Pujar, A.; Borovsky, Y.; Paran, I.; Mueller, L.; Jahn, M.M. A dynamic interface for capsaicinoid systems biology. Plant Physiol. 2009, 150, 1806–1821. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Qin, C.; Yu, C.S.; Shen, Y.; Fang, X.D.; Chen, L.; Min, J.M.; Cheng, J.W.; Zhao, S.C.; Xu, M.; Luo, Y.; et al. Whole-genome sequencing of cultivated and wild peppers provides insights into capsicum domestication and specialization. Proc. Natl. Acad. Sci. USA 2014, 111, 5135–5140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Kim, S.; Park, M.; Yeom, S.; Kim, Y.M.; Lee, J.M.; Lee, H.A.; Seo, E.; Choi, J.; Cheong, K.; Kim, K.T.; et al. Genome sequence of the hot pepper provides insights into the evolution of pungency in Capsicum species. Nat. Genet. 2014, 46, 270–278. [Google Scholar] [CrossRef] [Scilit]
  15. Arce-Rodríguez, M.L.; Ochoa-Alejo, N. Biochemistry and molecular biology of capsaicinoid biosynthesis: Recent advances and perspectives. Plant Cell Rep. 2019, 38, 1017–1030. [Google Scholar] [CrossRef] [Scilit]
  16. Stewart, C.J.; Kang, B.C.; Liu, K.; Mazourek, M.; Moore, S.L.; Yoo, E.Y.; Kim, B.D.; Paran, I.; Jahn, M.M. The Pun1 gene for pungency in pepper encodes a putative acyltransferase. Plant J. 2005, 42, 675–688. [Google Scholar] [CrossRef] [Scilit]
  17. Kabita, K.C.; Sharma, S.K.; Sanatombi, K. Analysis of capsaicinoid biosynthesis pathway genes expression in callus cultures of Capsicum chinense Jacq. cv. ‘Umorok’. Plant Cell Tissue Organ Cult. 2019, 137, 565–573. [Google Scholar] [CrossRef] [Scilit]
  18. Arce-Rodriguez, M.L.; Ochoa-Alejo, N. Silencing AT3 gene reduces the expression of pAmt, BCAT, Kas, and Acl genes involved in capsaicinoid biosynthesis in chili pepper fruits. Biol. Plant. 2015, 59, 477–484. [Google Scholar] [CrossRef] [Scilit]
  19. Abraham-Juárez, M.; Rocha-Granados, M.; López, M.G.; Rivera-Bustamante, R.F.; Ochoa-Alejo, N. Virus-induced silencing of Comt, pAmt and Kas genes results in a reduction of capsaicinoid accumulation in chili pepper fruits. Planta 2008, 227, 681–695. [Google Scholar] [CrossRef] [Scilit]
  20. Koeda, S.; Sato, K.; Saito, H.; Nagano, A.J.; Yasugi, M.; Kudoh, H.; Tanaka, Y. Mutation in the putative ketoacyl-ACP reductase CaKR1 induces loss of pungency in Capsicum. Theor. Appl. Genet. 2019, 132, 65–80. [Google Scholar] [CrossRef] [Scilit]
  21. Christian, D.; Stracke, R.; Erich, G.; Bernd, W.; Cathie, M.; Loïc, L. MYB transcription factors in Arabidopsis. Trends Plant Sci. 2010, 15, 573–581. [Google Scholar] [CrossRef] [Scilit]
  22. Ma, D.; Constabel, C.P. MYB respressors as regulators of phenylpropanoid metabolism in plants. Trends Plant Sci. 2019, 24, 275–289. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Sarpras, M.; Rashmi, G.; Vineet, S.; Chhapekar, S.S.; Jharna, D.; Ajay, K.; Satish, K.Y.; Mukesh, N.; Vijaya, B.; Suresh, K.A.; et al. Comparative analysis of fruit metabolites and pungency candidate genes expression between bhut jolokia and other Capsicum species. PLoS ONE 2016, 11, e0167791. [Google Scholar] [CrossRef] [Scilit]
  24. Tanaka, Y.; Nakashima, F.; Kirii, E.; Goto, T.; Yoshida, Y.; Yasuba, K.I. Difference in capsaicinoid biosynthesis gene expression in the pericarp reveals elevation of capsaicinoid contents in chili peppers (Capsicum chinense). Plant Cell Rep. 2017, 36, 267–279. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Arce-Rodríguez, M.L.; Ochoa-Alejo, N. An R2R3-MYB transcription factor regulates capsaicinoid biosynthesis. Plant Physiol. 2017, 174, 1359–1370. [Google Scholar] [CrossRef] [Scilit]
  26. Sun, B.; Zhu, Z.; Chen, C.; Chen, G.; Cao, B.; Chen, C.; Lei, J. Jasmonate-inducible R2R3-MYB transcription factor regulates capsaicinoid biosynthesis and stamen development in Capsicum. J. Agric. Food Chem. 2019, 67, 10891–10903. [Google Scholar] [CrossRef] [Scilit]
  27. Sun, B.M.; Zhou, X.; Chen, C.M.; Chen, C.J.; Chen, K.H.; Chen, M.X.; Liu, S.Q.; Chen, G.J.; Cao, B.H.; Cao, F.R.; et al. Coexpression network analysis reveals an MYB transcriptional activator involved in capsaicinoid biosynthesis in hot peppers. Hortic. Res. 2020, 7, 816–824. [Google Scholar] [CrossRef] [Scilit]
  28. Liu, J.; Osbourn, A.; Ma, P. MYB Transcription Factors as Regulators of Phenylpropanoid Metabolism in Plants. Mol. Plant 2015, 8, 689–708. [Google Scholar] [CrossRef] [Scilit]
  29. Marie, P.; Meike, B. Regulation of MYB and bHLH transcription factors: A glance at the protein level. Mol. Plant 2015, 8, 378–388. [Google Scholar] [CrossRef] [Scilit]
  30. Wang, S.; Shi, M.; Zhang, Y.; Xie, X.; Sun, P.; Fang, C.; Zhao, J. FvMYB24, a strawberry R2R3-MYB transcription factor, improved salt stress tolerance in transgenic Arabidopsis. Biochem. Biophys. Res. Commun. 2021, 569, 93–99. [Google Scholar] [CrossRef] [Scilit]
  31. Wang, Y.; Liu, W.; Jiang, H.; Mao, Z.; Wang, N.; Jiang, S.; Xu, H.; Yang, G.; Zhang, Z.; Chen, X. The R2R3-MYB transcription factor MdMYB24-like is involved in methyl jasmonate-induced anthocyanin biosynthesis in apple. Plant Physiol. Biochem. 2019, 139, 273–282. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Ambawat, S.; Sharma, P.; Yadav, N.R.; Yadav, R.C. MYB transcription factor genes as regulators for plant responses: An overview. Physiol. Mol. Biol. Plants 2013, 19, 307–321. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Ma, X.; Yu, Y.N.; Jia, J.H.; Li, Q.H.; Gong, Z.H. The pepper MYB transcription factor CaMYB306 accelerates fruit coloration and negatively regulates cold resistance. Sci. Hortic. 2022, 295, 0304–4238. [Google Scholar] [CrossRef] [Scilit]
  34. Xu, Q.; Yin, X.-R.; Zeng, J.-K.; Ge, H.; Song, M.; Xu, C.-J.; Li, X.; Ferguson, I.B.; Chen, K.-S. Activator- and repressor-type MYB transcription factors are involved in chilling injury induced flesh lignification in loquat via their interactions with the phenylpropanoid pathway. J. Exp. Bot. 2014, 65, 4349–4359. [Google Scholar] [CrossRef] [Scilit]
  35. Diao, W.P.; Snyder, J.C.; Wang, S.B.; Liu, J.B.; Pan, B.G.; Guo, G.J.; Wei, J. Genome-Wide Identification and Expression Analysis of WRKY Gene Family in Capsicum annuum L. Front. Plant Sci. 2016, 7, 211. [Google Scholar] [CrossRef] [Scilit]
  36. Song, J.; Chen, C.; Zhang, S.; Wang, J.; Huang, Z.; Chen, M.; Cao, B.; Zhu, Z.; Lei, J. Systematic analysis of the Capsicum ERF transcription factor family: Identification of regulatory factors involved in the regulation of species-specific metabolites. BMC Genom. 2020, 21, 573. [Google Scholar] [CrossRef] [Scilit]
  37. Yang, L.; Zhao, X.; Ran, L.; Li, C.; Fan, D.; Luo, K. PtoMYB156 is involved in negative regulation of phenylpropanoid metabolism and secondary cell wall biosynthesis during wood formation in poplar. Sci. Rep. 2017, 7, 41209. [Google Scholar] [CrossRef] [Scilit]
  38. Zhu, Z.; Sun, B.; Cai, W.; Zhou, X.; Mao, Y.; Chen, C.; Wei, J.; Cao, B.; Chen, C.; Chen, G.; et al. Natural variations in the MYB transcription factor MYB31 determine the evolution of extremely pungent peppers. New Phytol. 2019, 223, 1111. [Google Scholar] [CrossRef] [Scilit]
  39. Chen, L.; Wu, F.; Zhang, J. NAC and MYB Families and Lignin Biosynthesis-Related Members Identification and Expression Analysis in Melilotus albus. Plants 2021, 10, 303. [Google Scholar] [CrossRef] [Scilit]
  40. Wang, X.C.; Wu, J.; Guan, M.L.; Zhao, C.H.; Geng, P.; Zhao, Q. Arabidopsis MYB4 plays dual roles in flavonoid biosynthesis. Plant J. 2020, 101, 637–652. [Google Scholar] [CrossRef] [Scilit]
  41. Chen, L.; Hu, B.; Qin, Y.; Hu, G.; Zhao, J. Advance of the negative regulation of anthocyanin biosynthesis by MYB transcription factors. Plant Physiol. Biochem. 2019, 136, 178–187. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Surbhi, S.; Sathi, P.; Sampa, D. Overexpression of CaMYB78 transcription factor enhances resistance response in chickpea against Fusarium oxysporum and negatively regulates anthocyanin biosynthetic pathway. Protoplasma 2023, 260, 589–605. [Google Scholar] [CrossRef] [Scilit]
  43. Zhao, W.; Wu, W.; Liu, Y.; Fan, L.; Meng, H.; Wang, L.; Wu, G. The TT2-type MYB transcription factor JrMYB12 positively regulates proanthocyanidin biosynthesis in red walnut. Sci. Hortic. 2022, 307, 111515. [Google Scholar] [CrossRef] [Scilit]
  44. Kang, W.H.; Sim, Y.M.; Koo, N.; Nam, J.Y.; Lee, J.; Kim, N.; Jang, H.; Kim, Y.M.; Yeom, S.I. Transcriptome profiling of abiotic responses to heat, cold, salt, and osmotic stress of Capsicum annuum L. Sci. Data 2020, 7, 17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Song, X.; Yu, X.; Hori, C.; Demura, T.; Ohtani, M.; Zhu, Q. Heterologous Overexpression of Poplar SnRK2 Genes Enhanced Salt Stress Tolerance in Arabidopsis thaliana. Front. Plant Sci. 2016, 7, 612. [Google Scholar] [CrossRef] [Scilit]
  46. Li, M.; Yang, Y.; Raza, A.; Yin, S.; Wang, H.; Zhang, Y.; Dong, J.; Wang, G.; Zhong, C.; Zhang, H.; et al. Heterologous expression of Arabidopsis thaliana rty gene in strawberry (Fragaria × ananassa Duch.) improves drought tolerance. BMC Plant Biol. 2021, 21, 57. [Google Scholar] [CrossRef] [Scilit]
  47. Prasad, B.C.; Kumar, V.; Gururaj, H.B.; Parimalan, R.; Giridhar, P.; Ravishankar, G.A. Characterization of capsaicin synthase and identification of its gene (csy1) for pungency factor capsaicin in pepper (Capsicum sp.). Proc. Natl. Acad. Sci. USA 2006, 103, 13315–13320. [Google Scholar] [CrossRef] [Scilit]
  48. Zhang, Z.X.; Zhao, S.N.; Liu, G.F.; Huang, Z.M.; Cao, Z.M.; Cheng, S.H.; Lin, S.S. Discovery of putative capsaicin biosynthetic genes by RNA-Seq and digital gene expression analysis of pepper. Sci. Rep. 2016, 6, 34121. [Google Scholar] [CrossRef] [Scilit]
  49. Jeanne, C.; Maneesha, A.; Marcus, M.; Jacob, N.; Martin, M.; Mary, A.O. Transcripts for possible capsaicinoid biosynthetic genes are differentially accumulated in pungent and non-pungent Capsicum spp. Plant Sci. 1999, 148, 47–57. [Google Scholar] [CrossRef] [Scilit]
  50. Yoel, S.; Tzvi, T. Agrobacterium-mediated plant genetic transformation. Plant Biotechnol. Agric. 2012, 12, 99–116. [Google Scholar] [CrossRef] [Scilit]
  51. Ramkumar, T.R.; Lenka, S.K.; Arya, S.S.; Bansal, K.C. A Short History and Perspectives on Plant Genetic Transformation. Methods Mol. Biol. 2020, 2124, 39–68. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  52. Shoaib, A. Genetic Transformation of Plants: Introduction and Recent Advances. Res. J. Pharmacogn. Phytochem. 2017, 9, 125–127. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Analysis of CcMYB24 gene structure and conserved motifs. (A) CcMYB24 protein phylogenetic tree; (B) conservative motif map; and (C) gene structure. Note: OsMYB24 (XP_015624260.1), AtMYB24-1 (AT5G49620.1), AtMYB24-2 (AT5G49620.2), NtMYB62-like (XM_009627940.3), NtMYB108-like2 (XM_016613012.1), NtMYB108-like1 (XM_016595182.1), NsMYB108-like (XM_009799649.1), NaMYB108-like (XM_019401273.1), CbMYB24 (CQW23_25186_mrna), CcMYB24 (BC332_27190_mrna), CaMYB-like (XM_016691132.2), CaMYB24-like (PHT67336), SlMYB24 (rna-XM_004239365.4), SlMYB62 (XM_004239365.4), SpMYB62 (XM_015220269.2), StMYB24 (rna-XM_006344239.2), StMYB108 (XM_006344239.2), SsMYB62-like (XM_049547997.1), SvMYB-like (XM_049500874.1).
Figure 1. Analysis of CcMYB24 gene structure and conserved motifs. (A) CcMYB24 protein phylogenetic tree; (B) conservative motif map; and (C) gene structure. Note: OsMYB24 (XP_015624260.1), AtMYB24-1 (AT5G49620.1), AtMYB24-2 (AT5G49620.2), NtMYB62-like (XM_009627940.3), NtMYB108-like2 (XM_016613012.1), NtMYB108-like1 (XM_016595182.1), NsMYB108-like (XM_009799649.1), NaMYB108-like (XM_019401273.1), CbMYB24 (CQW23_25186_mrna), CcMYB24 (BC332_27190_mrna), CaMYB-like (XM_016691132.2), CaMYB24-like (PHT67336), SlMYB24 (rna-XM_004239365.4), SlMYB62 (XM_004239365.4), SpMYB62 (XM_015220269.2), StMYB24 (rna-XM_006344239.2), StMYB108 (XM_006344239.2), SsMYB62-like (XM_049547997.1), SvMYB-like (XM_049500874.1).
Molecules 28 02644 g001
Figure 2. The relative expression levels of CcMYB24 in pepper at different tissues and growth stages. Each value represents the mean ± standard of three replicates. a, b, c, d, and e indicate significant differences in values at p < 0.05.
Figure 2. The relative expression levels of CcMYB24 in pepper at different tissues and growth stages. Each value represents the mean ± standard of three replicates. a, b, c, d, and e indicate significant differences in values at p < 0.05.
Molecules 28 02644 g002
Figure 3. T2-generation of pBI121-CcMYB24 transgenic A. thaliana detection. (A) T2-generation transgenic A. thaliana PCR detection, M: DL5000 marker, I–IV: CcMYB24 A. thaliana overexpression lines, V–VI: wild-type A. thaliana plants; (B) T2-generation transgenic A. thaliana RT-PCR detection, M: DL2000 marker, I–VI: CcMYB24 A. thaliana transgenic lines; (C) T2-generation resistance screening; (D) relative expression in T2-generation transgenic A. thaliana; and (E) percentage of lignin content in transgenic A. thaliana. Each value represents the mean ± standard of three replicates. a and b indicate significant differences in values at p < 0.05. Note: pBI121-CcMYB24: CcMYB24 A. thaliana overexpression lines; WT: wild-type A. thaliana plants.
Figure 3. T2-generation of pBI121-CcMYB24 transgenic A. thaliana detection. (A) T2-generation transgenic A. thaliana PCR detection, M: DL5000 marker, I–IV: CcMYB24 A. thaliana overexpression lines, V–VI: wild-type A. thaliana plants; (B) T2-generation transgenic A. thaliana RT-PCR detection, M: DL2000 marker, I–VI: CcMYB24 A. thaliana transgenic lines; (C) T2-generation resistance screening; (D) relative expression in T2-generation transgenic A. thaliana; and (E) percentage of lignin content in transgenic A. thaliana. Each value represents the mean ± standard of three replicates. a and b indicate significant differences in values at p < 0.05. Note: pBI121-CcMYB24: CcMYB24 A. thaliana overexpression lines; WT: wild-type A. thaliana plants.
Molecules 28 02644 g003
Figure 4. Expression changes of genes related to capsaicin biosynthesis after CcMYB24 silencing. (A) Changes of CcMYB24 gene expression after gene silencing and (BK) changes in the expression of major genes in capsaicin biosynthesis pathway after gene silencing. Each value represents the mean ± standard of three replicates. a, b, c, and d indicate significant differences in values at p < 0.05.
Figure 4. Expression changes of genes related to capsaicin biosynthesis after CcMYB24 silencing. (A) Changes of CcMYB24 gene expression after gene silencing and (BK) changes in the expression of major genes in capsaicin biosynthesis pathway after gene silencing. Each value represents the mean ± standard of three replicates. a, b, c, and d indicate significant differences in values at p < 0.05.
Molecules 28 02644 g004
Figure 5. Changes of capsaicin and lignin contents after gene silencing treatment. (A) Capsaicin content and (B) lignin content. Each value represents the mean ± standard of three replicates. a b and c indicate significant differences in values at p < 0.05.
Figure 5. Changes of capsaicin and lignin contents after gene silencing treatment. (A) Capsaicin content and (B) lignin content. Each value represents the mean ± standard of three replicates. a b and c indicate significant differences in values at p < 0.05.
Molecules 28 02644 g005
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yu, S.; Zhang, W.; Zhang, L.; Wu, D.; Sun, P.; Huang, C.; Fu, G.; Deng, Q.; Wang, Z.; Cheng, S. MYB24 Negatively Regulates the Biosynthesis of Lignin and Capsaicin by Affecting the Expression of Key Genes in the Phenylpropanoid Metabolism Pathway in Capsicum chinense. Molecules 2023, 28, 2644. https://doi.org/10.3390/molecules28062644

AMA Style

Yu S, Zhang W, Zhang L, Wu D, Sun P, Huang C, Fu G, Deng Q, Wang Z, Cheng S. MYB24 Negatively Regulates the Biosynthesis of Lignin and Capsaicin by Affecting the Expression of Key Genes in the Phenylpropanoid Metabolism Pathway in Capsicum chinense. Molecules. 2023; 28(6):2644. https://doi.org/10.3390/molecules28062644

Chicago/Turabian Style

Yu, Shuang, Wei Zhang, Liping Zhang, Dan Wu, Peixia Sun, Chuang Huang, Genying Fu, Qin Deng, Zhiwei Wang, and Shanhan Cheng. 2023. "MYB24 Negatively Regulates the Biosynthesis of Lignin and Capsaicin by Affecting the Expression of Key Genes in the Phenylpropanoid Metabolism Pathway in Capsicum chinense" Molecules 28, no. 6: 2644. https://doi.org/10.3390/molecules28062644

APA Style

Yu, S., Zhang, W., Zhang, L., Wu, D., Sun, P., Huang, C., Fu, G., Deng, Q., Wang, Z., & Cheng, S. (2023). MYB24 Negatively Regulates the Biosynthesis of Lignin and Capsaicin by Affecting the Expression of Key Genes in the Phenylpropanoid Metabolism Pathway in Capsicum chinense. Molecules, 28(6), 2644. https://doi.org/10.3390/molecules28062644

Article Metrics

Back to TopTop