Next Article in Journal
Synthesis of New Amino-Functionalized Porphyrins:Preliminary Study of Their Organophotocatalytic Activity
Previous Article in Journal
Flow-Based Fmoc-SPPS Preparation and SAR Study of Cathelicidin-PY Reveals Selective Antimicrobial Activity
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

From Aquaculture to Aquaculture: Production of the Fish Feed Additive Astaxanthin by Corynebacterium glutamicum Using Aquaculture Sidestream

Institute for Genetics of Prokaryotes, Faculty of Biology and CeBiTec, Bielefeld University, 33615 Bielefeld, Germany
*
Author to whom correspondence should be addressed.
Molecules 2023, 28(4), 1996; https://doi.org/10.3390/molecules28041996
Submission received: 16 December 2022 / Revised: 31 January 2023 / Accepted: 17 February 2023 / Published: 20 February 2023
(This article belongs to the Section Green Chemistry)

Abstract

Circular economy holds great potential to minimize the use of finite resources, and reduce waste formation by the creation of closed-loop systems. This also pertains to the utilization of sidestreams in large-scale biotechnological processes. A flexible feedstock concept has been established for the industrially relevant Corynebacterium glutamicum, which naturally synthesizes the yellow C50 carotenoid decaprenoxanthin. In this study, we aimed to use a preprocessed aquaculture sidestream for production of carotenoids, including the fish feed ingredient astaxanthin by C. glutamicum. The addition of a preprocessed aquaculture sidestream to the culture medium did not inhibit growth, obviated the need for addition of several components of the mineral salt’s medium, and notably enhanced production of astaxanthin by an engineered C. glutamicum producer strain. Improved astaxanthin production was scaled to 2 L bioreactor fermentations. This strategy to improve astaxanthin production was shown to be transferable to production of several native and non-native carotenoids. Thus, this study provides a proof-of-principle for improving carotenoid production by C. glutamicum upon supplementation of a preprocessed aquaculture sidestream. Moreover, in the case of astaxanthin production it may be a potential component of a circular economy in aquaculture.

Graphical Abstract

1. Introduction

The consumer demand for seafood is rising as the world population is growing and healthier diets are becoming more important. The worldwide fish production was 178.5 million tons (mt) in 2018, and is anticipated to reach 204.4 mt in 2030 [1]. This tremendous demand for fish cannot be met by fishery alone. Accordingly, aquaculture is the fastest-growing food production system [2], enabling the fishing industry to meet the global needs [3,4]. The amount of seafood bred in aquaculture systems contributed 46% of the global production (82.1 mt) in 2018, and this share is expected to reach 53% (108.5 mt) in 2030 [1].
Recirculating aquaculture systems (RAS) present a promising alternative to the traditional cultivation systems as they have greatly reduced land and water requirements, and can be built without exploitation of farmland [5,6]. Moreover, they offer year-round fish growth and provide a high degree of environmental control [7,8]. RAS have great opportunities for waste management and nutrient recycling [9]. The lower flow rates of RAS compared to raceway systems, and the high stocking densities of RAS compared to ponds and cages lead to lesser, more concentrated effluents from the fish tanks, which can be treated more cost effectively [2,7,9,10]. RAS and other aquaculture effluents are mainly composed of settleable and dissolved nutrients from feces and unconsumed fish feed [11], which need to be removed in order to reuse the water for the fish tanks. Via settling of the backwash water, a sludge phase containing most of the settleable wastes and an aqueous sidestream can be obtained [7,12]. Several efforts have been made to recycle this solid and aqueous sidestreams from RAS. For instance, the aqueous phase of the waste streams has been used for the cultivation of several algae [13,14,15]. The algal biomass may be used as natural fertilizer [15,16], an aquaculture feed [17,18], or food [19] ingredient. Alternatively, the algae can be used for the extraction of high value compounds, such as polyunsaturated fatty acids [20] or vitamins [21]. Further technological developments are in demand to utilize these aquaculture sidestreams.
One of the most important quality criteria of aquaculture bred fish, such as salmon (2.4 mt in 2018) and rainbow trout (0.8 mt in 2018), and crustaceans (9.4 mt in 2018) [1], is the degree of flesh and/or shell pigmentation, as it dictates their market value [22,23]. As fish and other aquatic animals are unable to synthesize the responsible carotenoids de novo carotenoids are mixed into the feed of farmed fish and crustaceans [24,25]. Astaxanthin and other carotenoids from synthetic [23,26,27] and from natural sources, such as yeasts [28,29], algae [30,31,32], maize [33], and bacteria [22,34], have been used in aquatic feed formulations, achieving different levels of coloration. The red, cyclic C40 carotenoid astaxanthin is the major carotenoid used in aquatic feeds [25]. The global astaxanthin market is predicted to reach 4.75 billion US$ in 2028, with an annual growth rate of 16.8% [35]. Currently, the petrochemical synthesis of astaxanthin is the most cost-efficient and, therefore, dominates the market [24,36]. However, there is a growing trend towards naturally sourced carotenoids due to consumer demand and regulation. This opens the market for alternative production technologies. Furthermore, it was shown that the antioxidant properties of natural astaxanthin from Haematococcus pluvialis are stronger than those of synthetic astaxanthin [37]. However, studies with rainbow trout showed that the esterified astaxanthin produced by microalgae are deposited in fish muscle less effectively than the free variant, and therefore cause lower coloration [38,39]. Taken together, the demand for natural, unesterified astaxanthin that can be produced efficiently and environmentally friendly is rising. Microbial hosts, such as Yarrowia lipolytica [40,41], Paracoccus carotinifaciens [42], Escherichia coli [43,44], Saccharomyces cerevisiae [45], and Corynebacterium glutamicum [46] are natural or heterologous producers of carotenoids and have been engineered for high-level production of astaxanthin.
Astaxanthin can be synthesized by the Gram+ soil bacterium C. glutamicum that is a natural producer of the yellow C50 carotenoid decaprenoxanthin and its glucosides [47] (Figure 1). Metabolic engineering is effective for C. glutamicum, which efficiently produces the endogenous decaprenoxanthin [48] and lycopene [49], and the heterologous isoprenoids α-pinene [50], (+)-valencene [51], 4-apolycopene and 4-aponeurosporene [52], patchoulol [53], α-farnesene [54] α-carotene [55], bisanhydrobacterioruberin (BABR) [56], C.p.450 and sarcinaxanthin [57], β-carotene [57], and astaxanthin [46]. In order to achieve high level astaxanthin production several engineering strategies have been applied. First, the carotenoid biosynthesis pathway was terminated at lycopene by deletion of crtYeYfEb [49,58], and the precursor supply was improved [58,59]. Furthermore, the regulatory mechanism of the carotenoid biosynthesis by its precursor molecule geranylgeranyl pyrophosphate (GGPP) responsive transcriptional repressor CrtR was elucidated [57,60] and deletion of its gene was shown to improve astaxanthin production [46]. Conversion of β-carotene to astaxanthin was improved by a fusion protein of the heterologous β-carotene hydroxylase and β-carotene ketolase from Fulvimarina pelagi [46]. A CRISPRi library screening identified potential further targets for metabolic engineering [61].
In addition to genetic engineering, other attempts have been made to optimize the carotenoid production by microbial hosts and to design sustainable production processes. Successful strategies include: two-stage cultivations [62,63], the adjustment of operative bioprocess parameters, such as aeration rate [64], CO2 levels [65], light irradiation [66,67], temperature [68,69], pH [70,71], optimization of the growth medium composition [72,73], and utilization of various sustainable carbon sources [64,74,75,76].
C. glutamicum has been engineered for utilization of agricultural sidestreams [77]. This is relevant since the bacterium is used for decades in the production of amino acids at the million ton scale [78]. The flexible feedstock concept for C. glutamicum comprises efficient utilization for growth and production of a number of compounds, for instance, the lignocellulosic sugars arabinose [79,80] and xylose [81,82,83,84], the chitin derived amino sugars glucosamine [85] and N-acetyl-glucosamine [86]. Furthermore, also less processed substrates, such as chitin [87], and hydrolysates of plant biomass, such as rice straw or wheat bran [88,89,90], and sidestreams from biodiesel factories [91], biorefineries [92], or the starch and paper industry [93,94] were harnessed as carbon sources for C. glutamicum.
Here, we studied if a sidestream from a Norwegian salmon farm, operated as a RAS, can be utilized as component of the growth medium to support growth and carotenoid production by C. glutamicum.

2. Results

2.1. Analysis of the Untreated Aquaculture Sidestream

The liquid phase of an aquaculture sidestream from a Norwegian RAS salmon farm was analyzed regarding its physical parameters and nutrient composition in order to get insights about which components of the standard minimal growth medium CGXII of C. glutamicum might be substitutable by the aquaculture sidestream. The aquaculture sidestream has a pH of 5.5, and a dry matter fraction of 16.5 g L−1. In a loss on ignition analysis an organic fraction could not be detected (detection limit 0.1% (w/w) of dry matter fraction). The nutrient analysis of the aquaculture sidestream (Figure 2) showed that nitrogen (8 g L−1) is the major macronutrient present in the aquaculture sidestream, followed by potassium (3 g L−1 K, 3 g L−1 K2O) and sulphate (2 g L−1). Furthermore, elemental sulfur, phosphorus, calcium, zinc, and boron were detected. The analysis also covered ammonium derived nitrogen (NH4-N) (<1 g L−1), P2O5 (<3 g L−1), CaO (<2 g L−1), Mg (<1 g L−1), MgO (<2 g L−1), Mn, Cu, and Mo (all <0.0000485 g L−1), but these nutrients could not be detected.
Furthermore, the amino acid and amine composition of preprocessed aquaculture sidestream (AQ) was analyzed via HPLC. The results (Table S1) display that besides proteinogenic amino acids, the non-proteinogenic ω-amino acid 5-aminovaleric acid (5-AVA), and the diamines putrescine and cadaverine are present in AQ. The concentrations of the proteinogenic amino acids range from 0.5 to 10.7 mg L−1, while 5-AVA (76 mg L−1), putrescine (62 mg L−1), and cadaverine (53 mg L−1) are present in higher concentrations.
Moreover, an ion exchange chromatography (detection with a RID at λ = 210 nm) analysis of AQ was performed via HPLC (Figure S2). Four Peaks were detected. However, none of the peaks could be identified. Glucose, malate, lactate, trehalose, succinate, and α-ketoglutarate were used as standards and can therefore be excluded as possible carbohydrate components of the AQ.

2.2. Growth in Various Media Based on or Supplemented with AQ

In order to use the aquaculture sidestream as a growth medium component, it was preprocessed. Centrifugation and subsequent sterile filtration (Section 4.1) were applied to obtain a clear liquid. C. glutamicum WT was used to verify if AQ as a new complex media component is compatible with growth. Therefore, cultivations in different media compositions were performed in a Biolector® microcultivation system. Addition of AQ to the standard minimal growth medium CGXII to 20% (v/v) led to significantly increased biomass formation (from OD600 nm 52.0 ± 0.9 to 62.0 ± 0.8) and decaprenoxanthin content (from 1.1 ± 0.2 to 1.6 ± 0.0 mg L−1), while the growth rate was only slightly reduced (Figure 3A). To elucidate which components of CGXII could be replaced by the complex media component AQ, each component of the CGXII media composition was substituted by 20% (v/v) AQ (Figure 3A). Replacement of the CGXII components CaCl2, MgSO4, biotin, protocatechuic acid (PCA), or trace elements by AQ led to comparable biomass formation and growth rates compared to CGXII with addition of 20% (v/v) AQ. This indicated that addition of 20% (v/v) AQ is sufficient to replace these components of CGXII. However, replacing PCA or trace elements with 20% (v/v) AQ significantly increased decaprenoxanthin production (plus 58% for PCA; plus 155% for trace elements). The addition of AQ instead of phosphorous reduced biomass formation (∆OD600 nm of 50 ± 3.7; minus 19%), but decaprenoxanthin production was comparable. The replacement of nitrogen had the strongest negative effect: biomass formation was reduced to one-fifth (∆OD600 nm of 10 ± 0.3), the maximal growth rate by one-third (0.3 ± 0.0 h−1), and the decaprenoxanthin production by more than half (0.5 ± 0.0 mg L−1) compared to CGXII. To test whether AQ could function as a carbon source for C. glutamicum, the standard carbon source glucose was replaced by 5%, 10%, 20%, or 40% (v/v) AQ (Figure 3B). In all cases growth was observed, but even with the addition of 40% (v/v) AQ only one-sixth of biomass formation (∆OD600 nm of 8.0 ± 0.0) was observed (Figure 3B). These results indicate that AQ can only partially substitute for the carbon and nitrogen sources of CGXII medium.
Second, we tested if C. glutamicum WT could grow with 20% (v/v) AQ (adjusted to pH 7) as sole medium component. However, the biomass and decaprenoxanthin formation were negligible (Figure 3C). When MOPS buffer (42 g L−1, adjusted to pH 7) and glucose were added, some growth (∆OD600 nm of 10 ± 0.2) and decaprenoxanthin production (0.4 ± 0.0 mg L−1) were detected (Figure 3C). The addition of the nitrogen sources ammonium sulfate and/or urea increased biomass formation to ∆OD600 nm of 34 ± 2.3, 38 ± 0.5 and 36 ± 2.1 for ammonium sulfate, urea, and both, respectively. Regarding decaprenoxanthin production, a significant increase was observed upon addition of urea alone (3.3 ± 0.1 mg L−1), or combined with ammonium sulfate (3.5 ± 0.1 mg L−1). The decaprenoxanthin titer was 3-fold higher than from the standard CGXII medium.
Third, we developed an AQ based growth medium for carotenoid production with C. glutamicum, in which all components that could be replaced by AQ without reducing biomass formation or decaprenoxanthin production (CaCl2, MgSO4, biotin, trace elements, and PCA) were omitted. The new medium was named CGAQ, and it contained 20% (v/v) AQ, 42 g L−1 MOPS buffer, 40 g L−1 glucose, 20 g L−1 (NH4)2SO4, 5 g L−1 urea, 1 g L−1 K2HPO4, and 1 g L−1 KH2PO4). Growth of C. glutamicum was supported by the medium CGAQ (Figure 3C). The biomass formation in CGAQ was comparable to the culture grown in CGXII, even though the growth rate dropped from 0.45 ± 0.02 h−1 to 0.27 ± 0.01 h−1. Notably, a more than doubled decaprenoxanthin content of 2.6 ± 0.2 mg L−1 was observed using medium CGAQ.
Taken together, we have developed two growth media using AQ that are suitable for C. glutamicum: CGAQ and the regular CGXII minimal medium supplemented with 20% (v/v) AQ.

2.3. Carotenoid Production in AQ Supplemented Media

As the new AQ based medium CGAQ more than doubled the decaprenoxanthin production, we further tested its impact on the production of other carotenoids. Therefore, we performed production experiments in the Biolector® microcultivation system using strains overproducing various carotenoids. Strain ASTA* produces astaxanthin while ASTALYS* (strain construction see Section 4.4) is producing astaxanthin along with L-lysine. Strains LYC6, BETA4, ZEA5, and CAN5 (strain construction of ZEA5 and CAN5 see Section 4.4) produce the astaxanthin precursors lycopene, β-carotene, zeaxanthin, and canthaxanthin, respectively. Furthermore, we chose strains MB001∆crtR, BABR1, CP1, and SAX1 for production of the C50 carotenoids decaprenoxanthin, BABR, C.p.450, and sarcinaxanthin, respectively. All strains were grown either in CGXII, CGXII supplemented with 20% (v/v) AQ or CGAQ (Figure 4, Figure S3 and Figure S4).
Decaprenoxanthin and biomass formation by MB001∆crtR were increased in CGAQ (55.1 ± 1.8 mg L−1 decaprenoxanthin; plus 13%), but reduced by supplementation of CGXII with 20% (v/v) AQ (Figure 4). Lycopene formation by LYC6 in CGAQ (8.7 ± 0.4 mg L−1) was comparable to the one in CGXII, but was reduced by 24% when AQ was supplemented.
Production of BABR by strain BARBR1 was increased by supplementation of CGXII with 20% (v/v) AQ (13.7 ± 1.2 mg L−1; plus 17%), and further improved in CGAQ (20.3 ± 1.6 mg L−1; plus 73%), while the biomass formation was decreased in CGAQ. Production of two other non-native C50 carotenoids C.p.450 and sarcinaxanthin by strains CP1 and SAX1, respectively, was reduced in CGAQ as was biomass formation. However, upon addition of AQ to CGXII, carotenoid production increased considerably: plus 280% C.p.450 (47.5 ± 1.2 mg L−1), and plus 360% sarcinaxanthin (72.3 ± 4.3 mg L−1).
A similar pattern was observed for production of astaxanthin and its precursors by BETA4, ZEA5, CAN5, and ASTA*, respectively. In CGAQ, these strains exhibited reduced biomass and carotenoid formation. By contrast, the addition of AQ to CGXII had a positive impact on biomass formation and carotenoid production. While the slight increases in production of β-carotene (127.4 ± 2.7 mg L−1; plus 6%) and canthaxanthin (3.0 ± 0.2 mg L−1; plus 5%) were not significant compared to CGXII, considerable and statistically significant increases were observed for zeaxanthin (0.6 ± 0.0 mg L−1; plus 173%) and astaxanthin (7.4 ± 0.1 mg L−1; plus 213%).
The strain that co-produces astaxanthin with lysine, ASTALYS*, showed very low biomass formation compared to the other carotenoid production strains, which increased significantly upon addition of AQ to the medium (5.6 ± 0.2; plus 393%) or in the CGAQ medium (4.0 ± 0.2; plus 246%). Strain ASTALYS* showed 1.5-fold increased astaxanthin production (0.3 ± 0.0 mg L−1) upon addition of AQ to CGXII. Lysine production was increased 1.8-fold in CGAQ (1.40 ± 0.03 g L−1), and more than 6-fold (5.52 ± 0.14 g L−1) upon supplementation of CGXII with AQ.
For all strains, changes in the total carotenoid content (Figure S3) were observed. In case of strains MB001∆crtR, LYC6, and BETA4, all precursors were converted to decaprenoxanthin, lycopene and β-carotene, respectively. Here, changes in total carotenoids arose solely from changes in the respective product. In the other strains conversion of the precursors e.g., lycopene and β-carotene was incomplete, and therefore changes in the total carotenoid contents result from changes in product and precursor contents.
Taken together, the usage of AQ as a media component showed a positive effect on the carotenoid production by C. glutamicum. Notably, while production of the native carotenoid decaprenoxanthin was increased in CGAQ, supplementation of 20% AQ to CGXII improved production of most other carotenoids, in particular astaxanthin.

2.4. Fermentative Production of Astaxanthin in AQ Supplemented Media

After having shown that astaxanthin production by C. glutamicum ASTA* was enhanced by the addition of 20% (v/v) AQ to CGXII medium in microcultivation, lab-scale bioreactors (2 L) were used to test if this improvement was stable at larger scale. Two parallel 2 L batch fermentations using C. glutamicum ASTA* were performed. They contained either CGXII medium (Figure 5A) or CGXII plus 20% (v/v) AQ (Figure 5B). After 16 h, both cultures reached the stationary phase. The biomass formation was higher upon AQ supplementation (∆OD600 nm of 58 as compared to 46), as was the growth rate (0.31 h−1 compared 0.24 h−1). In CGXII, astaxanthin accumulated to a cellular content of 0.38 mg g−1 cell dry weight (CDW) (equivalent to 3.12 mg L−1) during 77 h, with a maximal volumetric productivity of 0.05 mg L−1 h−1 (Figure 5A). Upon AQ supplementation, the maximum astaxanthin concentration of 4.51 mg L−1 (cellular content of 0.44 mg g−1 CDW) was reached already after 61 h, increasing the maximal volumetric productivity to 0.09 mg L−1 h−1 (Figure 5B). Thus, astaxanthin production was considerably improved regarding titers and volumetric productivities in bioreactor batch cultivation indicating that the beneficial effect of AQ supplementation is transferable to larger scales under defined bioreactor conditions.
With the aim to improve astaxanthin production in bioreactor cultivation, fed-batch fermentations were performed. In a comparison, 1 L CGXII with 20% (v/v) AQ medium was used as a batch medium, and either 600 mL CGXII concentrate or CGXII concentrate supplemented with 20% (v/v) AQ were used as feed medium (Figure S5). Both cultures reached the stationary phase after about 32 h with comparable growth rates (0.21 h−1 for CGXII concentrate as feed, 0.19 h−1 for CGXII concentrate with 20% (v/v) AQ as feed). With CGXII concentrate as feed, a maximal ∆OD600 nm of 206, and an astaxanthin concentration of 6.1 mg L−1 (cellular content of 0.15 mg g−1) accumulated during 64 h with a maximum productivity of 0.10 mg L−1 h−1 (Figure S5A). When AQ was added to the feed, the ∆OD600 nm was 208 and an astaxanthin concentration of 3.8 mg L−1 (cellular content of 0.08 mg g−1 CDW) accumulated during 64 h with a maximum volumetric productivity of 0.08 mg L−1 h−1 (Figure S5B). Therefore, the beneficial effect of AQ supplementation is stable at larger scales, at least in the batch phase. However, additional supplementation of AQ via the feed did not further increase production. H3PO4 was used as acid for pH adjustments in all fermentations. The H3PO4 consumption during both batch fermentations was comparable, as was the consumption during both fed-batch fermentations. Therefore, the addition of H3PO4 did not lead to significant differences in the phosphorus source composition of the cultivation media, and all occurring effects can be attributed to the presence or absence of AQ in the medium. The total carotenoid content was more than doubled in both fed-batch fermentations (max. 72.7 mg L-1 when fed with CGXII concentrate, and max. 106 mg L−1 when fed with CGXII concentrate plus 20% (v/v) AQ, respectively) compared to the batch fermentations (max. 24.8 mg L-1 in CGXII and max. 30.3 mg L-1 in CGXII plus 20% (v/v) AQ) (Figure S6). Thus, the best conditions for astaxanthin production using AQ by C. glutamicum strain ASTA* required supplementation of 20% (v/v) AQ in the batch phase, but not during the feeding phase.

3. Discussion

In this study, a promising example with potential for the circular economy was presented. The liquid phase of a sidestream from a recirculating aquaculture system for salmon served as a sustainable feedstock for C. glutamicum. Fermentative production of several carotenoids, including the aquaculture feed ingredient astaxanthin was increased by usage of AQ.
Growth of C. glutamicum was supported by AQ as the sole medium component. However, it was a poor source of carbon and nitrogen. The addition of glucose, urea, and/or ammonium sulfate restored the growth to levels comparable with the standard medium. While L-glutamine, L-glutamate and a number of other amino acids present in AQ, e.g., L-alanine, L-asparagine, L-serine, and L-threonine, can be used as nitrogen sources by C. glutamicum [95], their concentration was comparatively low. Other amines present in AQ, such as putrescine, cadaverine, and 5-AVA, cannot be utilized as nitrogen sources by C. glutamicum [96,97,98]. Likely, nitrites and nitrates are present in AQ. C. glutamicum is able to metabolize nitrate to nitrite as part of a respiratory chain [99,100]; however, neither is used as a nitrogen source. In RAS, nitrogen is typically removed from the circulating water, e.g., by biofilter arrangements containing microbial communities of nitrifying and denitrifying microorganisms [101,102]. Prior to the demonstration that AQ supported growth and carotenoid production by C. glutamicum, it was reported that the supplementation of an aquaculture sidestream with aquaculture sludge improved growth and omega-3 fatty acid production of an algal co-cultivation [21].
Carotenoid production by C. glutamicum was improved by supplementation with AQ. However, since AQ is a complex source of macro- and micro-elements, it is very difficult to speculate which component(s) cause the improvement. It is tempting to hypothesize that trace elements may be involved as several enzymes of carotenogenesis use metal ions as cofactors. For example, prenyltransferases use divalent metal ions, such as Mg2+ and Mn2+ as cofactors [103,104,105]. In C. glutamicum, the geranylgeranyl pyrophosphate synthases IdsA and CrtE require Mg2+ for their activity [106]; however, Mg and MgO concentrations in AQ were below the detection limit (<3 g L−1). It is not known whether the substrate specificities of the prenyltransferases used here (IdsA, CrtE, CrtB, CrtEb, or LbtBC) are affected when Mg2+ is replaced by Mn2+, as was recently observed for a flavonoid prenyltransferase from Artocarpus heterophyllus [107]. Ferredoxin is involved as an electron carrier in several steps of decaprenoxanthin biosynthesis in C. glutamicum. For example, 28 reduced ferredoxins are required for the biosynthesis of the isoprenoid diphosphate precursors DMAPP, IPP and HMBPP, while their conversion to decaprenoxanthin yields only three reduced ferredoxins [61]. For the biosynthesis of zeaxanthin and astaxanthin, four additional reduced ferredoxins are required for the reactions catalyzed by CrtZ [108]. These iron-sulfur cluster containing enzymes of carotenoid biosynthesis have a high demand for sulfur and iron to be provided by the medium. In this respect, it is noteworthy that supplementation with AQ (containing 1 g L−1 S and 2 g L−1 SO4) increased sulfur availability. Taken together the diverging effects of AQ supplemented CGXII and CGAQ on the production of the tested native and heterologous carotenoids prompt that the production of each carotenoid may be improved by optimization of the (trace) element composition of the growth medium. Earlier studies in carotenoid producing yeast [109,110] and bacteria [111,112] suggest that the optimum concentration ratios for trace elements have to be evaluated with regards to the production host, the involved enzymes, their cofactors, and further reaction partners.
Bacterial astaxanthin production from AQ was demonstrated here for the first time. Previously, sidestream derived astaxanthin production was described for the yeast Xanthophyllomyces dendrorhous. Cultures of X. dendrorhous produced up to 9.69 µg L−1 astaxanthin when grown for five days on pre-treated whey, a sidestream of the dairy industry (volumetric productivity of 0.08 µg L−1 h−1), and up to 1.88 mg L−1 astaxanthin when cultivated in a fruit and vegetable waste derived medium for 7 days (0.01 mg L−1 h−1) [113]. Moreover, 26 mg L−1 astaxanthin were produced by X. dendrorhous after about 200 h of cultivation (0.13 mg L−1 h−1) in a partially-saccharified mussel wastewater [114]. In a co-cultivation of the bacterium Bacillus subtilis and the alga H. pluvialis for astaxanthin production from a starch-containing sidestream of a potato processing plant a titer of 8 mg L−1 astaxanthin was achieved after 350 h of cultivation (0.02 mg L−1 h−1) [115]. Our study revealed a much faster astaxanthin production (7.4 mg L−1 in 48 h; 0.15 mg L−1 h−1) upon supplementation with AQ and partially also higher titers than those achieved by X. dendrorhous. The yeast P. rhodozyma produced about 130 mg L−1 astaxanthin after 120 h by direct fermentation of food wastes (1.08 mg L−1 h−1) [116]. On stillage media derived from bagasse-based ethanol fermentation of S. cerevisiae, about 18 mg L−1 astaxanthin accumulated within one week of fermentation (0.10 mg L−1 h−1) [117]. Both sidestreams are much richer as compared to the AQ used in this study. The total carotenoid concentrations of up to about 0.1 g L−1 observed in this study may indicate that more astaxanthin can be produced if all precursor carotenoids are converted to astaxanthin. This may be approached by adjusting the copy number and/or expression levels of crtZ and crtW as previously demonstrated for E. coli and S. cerevisiae [118,119].
In aquatic feeds, bacterial biomass proved to be a sustainable, protein rich substrate to partially or completely replace traditional protein sources, such as fish meal [120]. In aquaculture feed formulations, phototrophic purple bacteria [121,122], lactic acid bacteria [123], and methanotrophic bacteria [124,125] have been used. Feeding whole cells of C. glutamicum to fish or crustaceans may be an option to provide astaxanthin and additional components relevant as feed additives. For this application, the strain ASTALYS* may be beneficial as it secretes L-lysine to the culture medium and accumulates astaxanthin in the cells [126]. Lysine typically is deficient in aquatic feeds [127,128] and astaxanthin is used in flesh and/or shell coloration of several aquaculture reared fish and crustaceans [24,127]. Whole cells obtained by spray-drying fermentation broth of L-lysine producing C. glutamicum were already commercialized for poultry feeds [95]. Thus, spray-dried fermentation broth of C. glutamicum ASTALYS* may support growth of poultry and coloration of egg yolks. In this regard, it has to be noted that several amino acid producing C. glutamicum strains have been approved by the European Food Safety Authority (EFSA) as a feed additive for all animal species [129]. Today, the establishment of a circular economy-based fish farm, including fish tanks and bioreactors, might be visionary. However, on-site production of the fish feed ingredients by cultivation of bacteria and algae on the sidestreams from the fish tanks would not only reduce the energy consumption of RAS due to reduced transport of feed ingredients [7], but would be one step closer towards a sustainable society.

4. Materials and Methods

4.1. Preprocessing of the Aquaculture Sidestream

The aquaculture sidestream was collected from the sump of a post-smolt RAS for salmon operated by Lumarine AS (Tjeldbergodden, Norway) outside of Trondheim (Norway). A plastic canister was filled with aquaculture sidestream, and was left to settle by gravitation for 0.5 h. The supernatant (liquid aquaculture sidestream) was thereafter gently poured off, frozen (−20 °C), and transported to our research facility in Bielefeld (Germany). The liquid aquaculture sidestream was defrosted, stirred, and frozen (−20 °C) in smaller containers until further use. Preprocessing of the liquid aquaculture sidestream in order to use it as a growth medium component was implemented by a 90 min centrifugation step at 4000 rpm and subsequent sterile filtration of the supernatant. The filtration was performed with a vacuum driven Steritop® (Millipore, Burlington, MA, USA) with 0.22 µm pore diameter. The resulting AQ was used in the growth experiments.

4.2. Microorangisms and Cultivation Conditions

Strains and plasmids used in this study and their characteristics and references are listed in Table 1. Chemicals were delivered by Carl Roth (Karlsruhe, Germany), if not stated differently. Precultures were grown in 100 mL or 500 mL shake flasks at 30 °C and 120 rpm, or 37 °C and 180 rpm for C. glutamicum or E. coli respectively. Precultures of E. coli DH5α, C. glutamicum ATCC 13032, and derived strains were grown in LB medium [130]. C. glutamicum ASTALYS* precultures were grown in BHIS (37 g L−1 BHI, 91 g L−1 Sorbitol) supplemented with 10 g L−1 glucose. For main cultures CGXII minimal medium (20 g L−1 (NH4)2SO4, 1 g L−1 K2HPO4, 1 g L−1 KH2PO4, 5 g L−1 urea, 42 g L−1 MOPS buffer, 0.2 mg L−1 biotin, 30 mg L−1 PCA, 10 mg L−1 CaCl2, 250 mg L−1 MgSO4·7 H2O, trace elements: 10 mg L−1 FeSO4·7 H2O, 10 mg L−1 MnSO4·H2O, 0.02 mg L−1 NiCl2·6 H2O, 0.313 mg L−1 CuSO4·5 H2O, and 1 mg L−1 ZnSO4·7 H2O) [95] supplemented with 40 g L−1 glucose was used as a control. Comparisons of AQ-based or -supplemented media were carried out using 20% (v/v) AQ. When appropriate, 25 µg mL−1 kanamycin, 100 µg mL−1 spectinomycin, and 1 mM IPTG were added to the medium. Cultures were inoculated to an initial OD600 nm of 1 after washing in TN buffer (50 mM Tris, 50 mM NaCl and pH 6.3). For OD measurements a Shimadzu UV-1202 spectrophotometer (Duisburg, Germany) was used. Growth experiments were conducted in 1 mL scale with gas permeable sealing foil in a flowerplate of the Biolector® microcultivation system (m2p-labs GmbH, Baesweiler, Germany) at 30 °C and 1100 rpm in triplicates.

4.3. Fermentative Production

A glass bioreactor with a total volume of 3.7 L (KLF, Bioengineering AG, Switzerland) was used for the fermentations. Two six-bladed Rushton turbines were placed on the stirrer axis with a distance of 6 cm and 12 cm from the bottom of the reactor. A mechanical foam breaker was installed on the stirrer axis with a distance of 22 cm to the bottom of the reactor. The stirrer to reactor diameter ratio was 0.39, and the aspect ratio of the reactor was 2.6:1.0. A steady airflow of 1 NL min−1 was maintained from the bottom through a ring-sparger. The fermentations were performed with a head space overpressure of 0.3 bar. An automatic control of the stirrer speed between 400 rpm and 1500 rpm kept the relative dissolved oxygen saturation (rDOS) at 30%. The temperature was kept at 30 °C, and a pH of 7.0 was automatically maintained by the addition of 10% (v/v) H3PO4 and 4 M KOH. For inoculation a first pre-culture was grown in 10 mL LB medium with addition of 10 g L−1 glucose and 25 µg mL−1 kanamycin in a 100 mL shake flask. A second pre-culture in 200 mL CGXII medium with addition of 40 g L−1 glucose and 25 µg mL−1 kanamycin in a 2 L shake flask was inoculated to an OD600 nm of 1. For the batch fermentation an initial working volume of 2 L was inoculated to an OD600 nm of 2 from the second pre-culture. The fed-batch fermentations were performed with an initial working volume of 1 L, inoculated to an OD600 nm of 2 with the second pre-culture. An amount of 600 mL feed medium (CGXII concentrate) was used with the following formulation: 433.7 g L−1 glucose, 34.4 g L−1 (NH4)2SO4, 8.7 g L−1 K2HPO4, 8.7 g L−1 KH2PO4, 8.6 g L−1 Urea, 5.2 g L−1 MgSO4·7 H2O, 100 mg L−1 FeSO4·7 H2O, 100 mg L−1 MnSO4·H2O, 0.2 mg L−1 NiCl2·6 H2O, 3.13 mg L−1 CuSO4·5 H2O, 10 mg L−1 ZnSO4·7 H2O, 1 mg L−1 Biotin, and 6 mL L−1 Antifoam 204. If indicated, 20% (v/v) AQ was added to this feed formulation. A steady airflow of 0.5 NL min−1 was maintained from the bottom through a ring sparger for the first 24 h of cultivation, afterwards the airflow was increased to 1 NL min−1. The feed was primed when the rDOS fell below 30% for the first time. The feed pump activated every time the rDOS exceeded 60% and stopped when it subsequently fell below 60%, to prevent oversaturation with glucose. Foam formation during the fermentation was reduced by addition of antifoam 204 controlled via an antifoam probe. Samples during the fermentations were collected with an autosampler and cooled down to 4 °C until further use.

4.4. Recombinant DNA Work

The pSH2 expression vector was constructed by site-directed mutagenesis of the repA gene in the pSH1 vector. This mutation (exchange of Gly at position 429 of RepA protein by Glu) resulted in an increased plasmid copy number. Site-directed mutagenesis was performed via plasmid backbone amplification (primer HA36 + HA37; see Table 2) with Pfu Turbo DNA Polymerase (Agilent, Santa Clara, CA, USA). The plasmids pSH2_crtZFp and pSH2_crtWFp were constructed in E. coli DH5α on the basis of pSH2. Polymerase chain reaction (PCR) fragments of crtZFp and crtWFp were generated from Fulvimarina pelagi using the primers HA34 + HA35, and FpW1 + FpW4, respectively. The PCR products were cloned into the BamHI (Thermo Fisher Scientific, Waltham, MA, USA) digested pSH2 vector by Gibson assembly [136]. The CaCl2-competent E. coli DH5α were prepared and transformed via heat shock [137]. Transformants were screened by colony PCR using the primers PD5 and 582. Plasmid isolates were prepared with a plasmid miniprep kit (GeneJet, Thermo Fisher Scientific, Schwerte, Germany), and confirmed via sequencing with primers PD5 and 582. C. glutamicum strains were transformed by electroporation [138]. For the construction of ASTALYS*, BETALYS [126] was transformed with pSH1_crtZ~W [46].

4.5. Quantification of Macro- and Micronutrients

A 1·10−2 dilution of the untreated liquid aquaculture sidestream in water was sent to Eurofins Agraranalytik Deutschland GmbH (Jena, Germany) to analyze the pH, organic substance content, and total nitrogen, ammoniacal nitrogen, phosphorous, phosphorous as P2O5, potassium, potassium as K2O, magnesia, magnesia as MgO, calcium, calcium as CaO, sulfur, sulfur as SO4, boron, manganese, molybdenum, copper, and zinc content of the untreated liquid aquaculture sidestream.

4.6. High-Performance Liquid Chromatography (HPLC) Analysis

For all HPLC analysis an Agilent 1200 series system (Agilent Technologies Deutschland GmbH, Böblingen, Germany) was used. Culture samples (200 or 500 µL) were centrifuged at 14,000 rpm for 10 min, the supernatants and pellets were stored separately at −20 °C until analysis.

4.6.1. Quantification of Amino Acids and Amines

For the analysis of extracellular amino acids and their derivatives 5 µL sample and an automatic pre-column derivatization with ortho-phthaldialdehyde (OPA) were used with a reversed-phase main column (LiChrospher 100 RP18 EC-5, 125 × 4.6 mm; CS-Chromatographie Service GmbH, Langerwehe, Germany). l-asparagine was used as an internal standard. The separation was achieved at 40 °C with 0.25% (v/v) sodium acetate (pH 6.0) (A) and methanol (B) as mobile phases, with the following gradient and flow profile: 0 min 20% B 0.7 mL min−1, 3 min 38% B 0.7 mL min−1, 6 min 42% B 0.1 mL min−1, 7 min 46% B 0.7 mL min−1, 14.5 min 70% B 1.2 mL min−1, 14.8 min 75% B 1.2 mL min−1, 16.8 min 85% B 1.2 mL min−1, 17.8 min 20% B 1.2 mL min−1, and 19.5 min 20% B 1.2 mL min−1 adapted from [139]. The fluorescent derivatives were detected using a fluorescence detector with an excitation wavelength of 230 nm, and an emission wavelength of 450 nm.

4.6.2. Quantification of Carbohydrates and Organic Acids

The carbohydrates in the cultivation medium were quantified with an organic acid resin column (Aminex, 300 mm × 8 mm, 10 µm particle size, 25 Å pore diameter; CS-Chromatographie Service GmbH, Langerwehe, Germany) under isocratic conditions with a flow of 0.8 mL min−1 as described previously [80]. The analytes were detected using a refractive index detector (RID) and a diode array detector (DAD) at 210 nm.

4.6.3. Quantification of Carotenoids

The analysis of carotenoids was performed as previously described [61]. Samples were extracted until the remaining pellet of cell debris was colorless; no further analysis in regards to recovery percentage and purity of the extracted carotenoids was performed. Carotenoid analysis was performed for all growth and production experiments in this study. For quantification of the carotenoid contents the peaks detected at 471 nm were used. Decaprenoxanthin, BABR, C.p. 450, and sarcinaxanthin contents presented in the results section were standardized with β-carotene.

5. Conclusions

The preprocessed liquid phase of a sidestream from a recirculating aquaculture system for salmon was shown to be suitable to support growth and carotenoid production by C. glutamicum. The beneficial effect of adding this sidestream to growth media was observed for strains overproducing either native or non-native carotenoids. In particular, astaxanthin production more than doubled upon AQ supplementation in small-scale cultivation, and in 2 L batch and fed-batch bioreactor fermentations. Thus, our proof-of-principle example for production of the fish feed supplement astaxanthin from AQ holds the potential to contribute to the establishment of the circular economy in aquaculture.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/molecules28041996/s1, Table S1: Amino acid concentrations in the aquaculture sidestream, Figure S1: Chromatogram of the amino acid analysis of the aquaculture sidestream, Figure S2: Chromatogram of the carbohydrate analysis of the aquaculture sidestream, Figure S3: Carotenoid content of C. glutamicum strains grown in AQ supplemented media, Figure S4: Growth of C. glutamicum strains in AQ supplemented media, Figure S5: Fed-batch fermentations, Figure S6: Carotenoid content of C. glutamicum ASTA* during batch and fed-batch fermentations.

Author Contributions

Conceptualization, I.S., F.M., N.A.H., P.P.-W. and V.F.W.; investigation, I.S., F.M., I.K. and N.A.H.; writing—original draft preparation, I.S.; writing—review and editing, F.M., N.A.H., P.P.-W. and V.F.W.; supervision, V.F.W.; project administration, N.A.H. and V.F.W.; funding acquisition, N.A.H. and V.F.W. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the ERA CoBlueBio project SIDESTREAM cofunded by the German Federal Ministry of Education and Research (BMBF) (grant number: 161B0950A). IS, FM, and NAH acknowledge funding by BMBF project KaroTec (grant number: 03VP09460). Support for the article processing charge by the Deutsche Forschungsgemeinschaft and the Open Access Publication Fund of Bielefeld University is acknowledged. The funding bodies had no role in the design of the study or the collection, analysis, or interpretation of data, or in writing the manuscript.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

We thank Arne Malzahn from SINTEF Ocean, Trondheim, Norway, and Lumarine AS, Tjeldbergodden, Norway, for providing the liquid aquaculture sidestream. Additionally, we thank Joe Max Risse and Thomas Schäffer from Fermentation Technology, Technical Faculty and CeBiTec, Bielefeld University, for technical assistance and advice.

Conflicts of Interest

The authors declare no conflict of interest.

Sample Availability

Not applicable.

References

  1. FAO. The State of World Fisheries and Aquaculture 2020; FAO: Rome, Italy, 2020; ISBN 978-92-5-132692-3. [Google Scholar]
  2. Mugwanya, M.; Dawood, M.A.O.; Kimera, F.; Sewilam, H. A review on recirculating aquaculture system: Influence of stocking density on fish and crustacean behavior, growth performance, and immunity. Ann. Anim. Sci. 2022, 22, 873–884. [Google Scholar] [CrossRef] [Scilit]
  3. Costello, C.; Cao, L.; Gelcich, S.; Cisneros-Mata, M.Á.; Free, C.M.; Froehlich, H.E.; Golden, C.D.; Ishimura, G.; Maier, J.; Macadam-Somer, I.; et al. The Future of Food from the Sea. Nature 2020, 588, 95–100. [Google Scholar] [CrossRef] [Scilit]
  4. Willett, W.; Rockström, J.; Loken, B.; Springmann, M.; Lang, T.; Vermeulen, S.; Garnett, T.; Tilman, D.; DeClerck, F.; Wood, A.; et al. Food in the Anthropocene: The EAT–Lancet Commission on Healthy Diets from Sustainable Food Systems. Lancet 2019, 393, 447–492. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Murray, F.; Bostock, J.; Fletcher, D. Review of Recirculation Aquaculture System Technologies and Their Commercial Application; Stirling Aquaculture, Institute of Aquaculture, University of Stirling: Stirling, UK, 2014. [Google Scholar]
  6. Verdegem, M.C.J.; Bosma, R.H.; Verreth, J.A.J. Reducing Water Use for Animal Production through Aquaculture. Int. J. Water Resour. Dev. 2006, 22, 101–113. [Google Scholar] [CrossRef] [Scilit]
  7. Martins, C.I.M.; Eding, E.H.; Verdegem, M.C.J.; Heinsbroek, L.T.N.; Schneider, O.; Blancheton, J.P.; d’Orbcastel, E.R.; Verreth, J.A.J. New Developments in Recirculating Aquaculture Systems in Europe: A Perspective on Environmental Sustainability. Aquac. Eng. 2010, 43, 83–93. [Google Scholar] [CrossRef] [Scilit]
  8. Masser, M.P.; Rakocy, J.; Losordo, T.M. Recirculating Aquaculture Tank Production Systems. South. Reg. Aquac. Cent. Publ. 1992, 13. [Google Scholar]
  9. Campanati, C.; Willer, D.; Schubert, J.; Aldridge, D.C. Sustainable Intensification of Aquaculture through Nutrient Recycling and Circular Economies: More Fish, Less Waste, Blue Growth. Rev. Fish. Sci. Aquac. 2022, 30, 143–169. [Google Scholar] [CrossRef] [Scilit]
  10. Boyd, C.E.; D’Abramo, L.R.; Glencross, B.D.; Huyben, D.C.; Juarez, L.M.; Lockwood, G.S.; McNevin, A.A.; Tacon, A.G.J.; Teletchea, F.; Tomasso Jr, J.R.; et al. Achieving Sustainable Aquaculture: Historical and Current Perspectives and Future Needs and Challenges. J. World Aquac. Soc. 2020, 51, 578–633. [Google Scholar] [CrossRef] [Scilit]
  11. van Rijn, J. Waste Treatment in Recirculating Aquaculture Systems. Aquac. Eng. 2013, 53, 49–56. [Google Scholar] [CrossRef] [Scilit]
  12. Dauda, A.B.; Ajadi, A.; Tola-Fabunmi, A.S.; Akinwole, A.O. Waste Production in Aquaculture: Sources, Components and Managements in Different Culture Systems. Aquac. Fish. 2019, 4, 81–88. [Google Scholar] [CrossRef] [Scilit]
  13. Ansari, F.A.; Singh, P.; Guldhe, A.; Bux, F. Microalgal Cultivation Using Aquaculture Wastewater: Integrated Biomass Generation and Nutrient Remediation. Algal Res. 2017, 21, 169–177. [Google Scholar] [CrossRef] [Scilit]
  14. Han, P.; Lu, Q.; Fan, L.; Zhou, W. A Review on the Use of Microalgae for Sustainable Aquaculture. Appl. Sci. 2019, 9, 2377. [Google Scholar] [CrossRef] [Scilit]
  15. Milhazes-Cunha, H.; Otero, A. Valorisation of Aquaculture Effluents with Microalgae: The Integrated Multi-Trophic Aquaculture Concept. Algal Res. 2017, 24, 416–424. [Google Scholar] [CrossRef] [Scilit]
  16. Roy, E.D. Phosphorus Recovery and Recycling with Ecological Engineering: A Review. Ecol. Eng. 2017, 98, 213–227. [Google Scholar] [CrossRef] [Scilit]
  17. Khatoon, H.; Banerjee, S.; Syakir Syahiran, M.; Mat Noordin, N.Bt.; Munafi Ambok Bolong, A.; Endut, A. Re-Use of Aquaculture Wastewater in Cultivating Microalgae as Live Feed for Aquaculture Organisms. Desalination Water Treat. 2016, 57, 29295–29302. [Google Scholar] [CrossRef] [Scilit]
  18. Roy, S.S.; Pal, R. Microalgae in Aquaculture: A Review with Special References to Nutritional Value and Fish Dietetics. Proc. Zool. Soc. 2015, 68, 1–8. [Google Scholar] [CrossRef] [Scilit]
  19. Wells, M.L.; Potin, P.; Craigie, J.S.; Raven, J.A.; Merchant, S.S.; Helliwell, K.E.; Smith, A.G.; Camire, M.E.; Brawley, S.H. Algae as Nutritional and Functional Food Sources: Revisiting Our Understanding. J. Appl. Phycol. 2017, 29, 949–982. [Google Scholar] [CrossRef] [Scilit]
  20. Queiroz, M.I.; Hornes, M.O.; Gonçalves da Silva Manetti, A.; Zepka, L.Q.; Jacob-Lopes, E. Fish Processing Wastewater as a Platform of the Microalgal Biorefineries. Biosyst. Eng. 2013, 115, 195–202. [Google Scholar] [CrossRef] [Scilit]
  21. Tossavainen, M.; Lahti, K.; Edelmann, M.; Eskola, R.; Lampi, A.-M.; Piironen, V.; Korvonen, P.; Ojala, A.; Romantschuk, M. Integrated Utilization of Microalgae Cultured in Aquaculture Wastewater: Wastewater Treatment and Production of Valuable Fatty Acids and Tocopherols. J. Appl. Phycol. 2019, 31, 1753–1763. [Google Scholar] [CrossRef] [Scilit]
  22. Grassi, T.L.M.; do Espírito Santo, E.F.; de Siqueira Marcos, M.T.; Cavazzana, J.F.; Oliveira, D.L.; Bossolani, I.L.C.; Ponsano, E.H.G. Bacterial Pigment for Nile Tilapia Feeding. Aquacult. Int. 2016, 24, 647–660. [Google Scholar] [CrossRef] [Scilit]
  23. Rahman, M.M.; Khosravi, S.; Chang, K.H.; Lee, S.-M. Effects of Dietary Inclusion of Astaxanthin on Growth, Muscle Pigmentation and Antioxidant Capacity of Juvenile Rainbow Trout (Oncorhynchus mykiss). Prev. Nutr. Food Sci. 2016, 21, 281–288. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Lim, K.C.; Yusoff, F.Md.; Shariff, M.; Kamarudin, M.S. Astaxanthin as Feed Supplement in Aquatic Animals. Rev. Aquac. 2018, 10, 738–773. [Google Scholar] [CrossRef] [Scilit]
  25. Pereira da Costa, D.; Campos Miranda-Filho, K. The Use of Carotenoid Pigments as Food Additives for Aquatic Organisms and Their Functional Roles. Rev. Aquac. 2020, 12, 1567–1578. [Google Scholar] [CrossRef] [Scilit]
  26. Maoka, T.; Tanimoto, F.; Sano, M.; Tsurukawa, K.; Tsuno, T.; Tsujiwaki, S.; Ishimaru, K.; Takii, K. Effects of Dietary Supplementation of Ferulic Acid and γ-Oryzanol on Integument Color and Suppression of Oxidative Stress in Cultured Red Sea Bream, Pagrus major. J. Oleo Sci. 2008, 57, 133–137. [Google Scholar] [CrossRef] [Scilit]
  27. Paibulkichakul, C.; Piyatiratitivorakul, S.; Sorgeloos, P.; Menasveta, P. Improved Maturation of Pond-Reared, Black Tiger Shrimp (Penaeus monodon) Using Fish Oil and Astaxanthin Feed Supplements. Aquaculture 2008, 282, 83–89. [Google Scholar] [CrossRef] [Scilit]
  28. Johnson, E.A.; Villa, T.G.; Lewis, M.J. Phaffia rhodozyma as an Astaxanthin Source in Salmonid Diets. Aquaculture 1980, 20, 123–134. [Google Scholar] [CrossRef] [Scilit]
  29. Kheirabadi, E.P.; Shekarabi, P.H.; Yadollahi, F.; Soltani, M.; Najafi, E.; von Hellens, J.; Flores, C.L.; Salehi, K.; Faggio, C. Red Yeast (Phaffia rhodozyma) and Its Effect on Growth, Antioxidant Activity and Color Pigmentation of Rainbow Trout (Oncorhynchus mykiss). Aquac. Rep. 2022, 23, 101082. [Google Scholar] [CrossRef] [Scilit]
  30. Choubert, G.; Mendes-Pinto, M.M.; Morais, R. Pigmenting Efficacy of Astaxanthin Fed to Rainbow Trout Oncorhynchus mykiss: Effect of Dietary Astaxanthin and Lipid Sources. Aquaculture 2006, 257, 429–436. [Google Scholar] [CrossRef] [Scilit]
  31. Li, M.; Wu, W.; Zhou, P.; Xie, F.; Zhou, Q.; Mai, K. Comparison Effect of Dietary Astaxanthin and Haematococcus pluvialis on Growth Performance, Antioxidant Status and Immune Response of Large Yellow Croaker Pseudosciaena crocea. Aquaculture 2014, 434, 227–232. [Google Scholar] [CrossRef] [Scilit]
  32. Xie, J.; Fang, H.; He, X.; Liao, S.; Liu, Y.; Tian, L.; Niu, J. Study on Mechanism of Synthetic Astaxanthin and Haematococcus pluvialis Improving the Growth Performance and Antioxidant Capacity under Acute Hypoxia Stress of Golden Pompano (Trachinotus ovatus) and Enhancing Anti-Inflammatory by Activating Nrf2-ARE Pathway to Antagonize the NF-ΚB Pathway. Aquaculture 2020, 518, 734657. [Google Scholar] [CrossRef] [Scilit]
  33. Breitenbach, J.; Nogueira, M.; Farré, G.; Zhu, C.; Capell, T.; Christou, P.; Fleck, G.; Focken, U.; Fraser, P.D.; Sandmann, G. Engineered Maize as a Source of Astaxanthin: Processing and Application as Fish Feed. Transgenic Res. 2016, 25, 785–793. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Authority (EFSA), E.F.S. Opinion of the Scientific Panel on Additives and Products or Substances Used in Animal Feed (FEEDAP) on Safety and Efficacy of Panaferd-AX (Red Carotenoid-Rich Bacterium Paracoccus carotinifaciens) as Feed Additive for Salmon and Trout. EFSA J. 2007, 5, 546. [Google Scholar] [CrossRef] [Scilit]
  35. Grand-View-Research. Astaxanthin Market Size, Share & Trends Analysis Report By Product (Oil, Softgel, Liquid), By Source (Natural, Synthetic), By Application (Aquaculture & Animal Feed, Nutraceuticals), By Region, And Segment Forecasts, 2021–2028; Grand View Research Inc.: San Francisco, MA, USA, 2021. [Google Scholar]
  36. Butler, T.; Golan, Y. Astaxanthin Production from Microalgae. In Microalgae Biotechnology for Food, Health and High Value Products; Alam, M.A., Xu, J.-L., Wang, Z., Eds.; Springer: Singapore, 2020; pp. 175–242. ISBN 9789811501692. [Google Scholar]
  37. Capelli, B.; Bagchi, D.; Cysewski, G.R. Synthetic Astaxanthin Is Significantly Inferior to Algal-Based Astaxanthin as an Antioxidant and May Not Be Suitable as a Human Nutraceutical Supplement. Nutrafoods 2013, 12, 145–152. [Google Scholar] [CrossRef] [Scilit]
  38. Moretti, V.M.; Mentasti, T.; Bellagamba, F.; Luzzana, U.; Caprino, F.; Turchini, G.M.; Giani, I.; Valfrè, F. Determination of Astaxanthin Stereoisomers and Colour Attributes in Flesh of Rainbow Trout (Oncorhynchus mykiss) as a Tool to Distinguish the Dietary Pigmentation Source. Food Addit. Contam. 2006, 23, 1056–1063. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. White, D.A.; Moody, A.J.; Serwata, R.D.; Bowen, J.; Soutar, C.; Young, A.J.; Davies, S.J. The Degree of Carotenoid Esterification Influences the Absorption of Astaxanthin in Rainbow Trout, Oncorhynchus mykiss (Walbaum). Aquac. Nutr. 2003, 9, 247–251. [Google Scholar] [CrossRef] [Scilit]
  40. Ma, Y.; Li, J.; Huang, S.; Stephanopoulos, G. Targeting Pathway Expression to Subcellular Organelles Improves Astaxanthin Synthesis in Yarrowia lipolytica. Metab. Eng. 2021, 68, 152–161. [Google Scholar] [CrossRef] [Scilit]
  41. Tramontin, L.R.R.; Kildegaard, K.R.; Sudarsan, S.; Borodina, I. Enhancement of Astaxanthin Biosynthesis in Oleaginous Yeast Yarrowia lipolytica via Microalgal Pathway. Microorganisms 2019, 7, 472. [Google Scholar] [CrossRef] [Scilit]
  42. Hayashi, M.; Ishibashi, T.; Kuwahara, D.; Hirasawa, K. Commercial Production of Astaxanthin with Paracoccus carotinifaciens. In Carotenoids: Biosynthetic and Biofunctional Approaches; Misawa, N., Ed.; Advances in Experimental Medicine and Biology; Springer: Singapore, 2021; pp. 11–20. ISBN 9789811573606. [Google Scholar]
  43. Park, S.Y.; Binkley, R.M.; Kim, W.J.; Lee, M.H.; Lee, S.Y. Metabolic Engineering of Escherichia coli for High-Level Astaxanthin Production with High Productivity. Metab. Eng. 2018, 49, 105–115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Zhang, C.; Seow, V.Y.; Chen, X.; Too, H.-P. Multidimensional Heuristic Process for High-Yield Production of Astaxanthin and Fragrance Molecules in Escherichia coli. Nat Commun 2018, 9, 1858. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Jiang, G.; Yang, Z.; Wang, Y.; Yao, M.; Chen, Y.; Xiao, W.; Yuan, Y. Enhanced Astaxanthin Production in Yeast via Combined Mutagenesis and Evolution. Biochem. Eng. J. 2020, 156, 107519. [Google Scholar] [CrossRef] [Scilit]
  46. Henke, N.A.; Wendisch, V.F. Improved Astaxanthin Production with Corynebacterium glutamicum by Application of a Membrane Fusion Protein. Mar. Drugs 2019, 17, 621. [Google Scholar] [CrossRef] [Scilit]
  47. Krubasik, P.; Takaichi, S.; Maoka, T.; Kobayashi, M.; Masamoto, K.; Sandmann, G. Detailed Biosynthetic Pathway to Decaprenoxanthin Diglucoside in Corynebacterium glutamicum and Identification of Novel Intermediates. Arch. Microbiol. 2001, 176, 217–223. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  48. Heider, S.A.E.; Peters-Wendisch, P.; Netzer, R.; Stafnes, M.; Brautaset, T.; Wendisch, V.F. Production and Glucosylation of C50 and C40 Carotenoids by Metabolically Engineered Corynebacterium glutamicum. Appl. Microbiol. Biotechnol. 2014, 98, 1223–1235. [Google Scholar] [CrossRef] [Scilit]
  49. Heider, S.A.E.; Peters-Wendisch, P.; Wendisch, V.F. Carotenoid Biosynthesis and Overproduction in Corynebacterium glutamicum. BMC Microbiol. 2012, 12, 198. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  50. Kang, M.-K.; Eom, J.-H.; Kim, Y.; Um, Y.; Woo, H.M. Biosynthesis of Pinene from Glucose Using Metabolically-Engineered Corynebacterium glutamicum. Biotechnol. Lett. 2014, 36, 2069–2077. [Google Scholar] [CrossRef] [Scilit]
  51. Frohwitter, J.; Heider, S.A.E.; Peters-Wendisch, P.; Beekwilder, J.; Wendisch, V.F. Production of the Sesquiterpene (+)-Valencene by Metabolically Engineered Corynebacterium glutamicum. J. Biotechnol. 2014, 191, 205–213. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  52. Ravikumar, S.; Woo, H.M.; Choi, J.-I. Analysis of Novel Antioxidant Sesquarterpenes (C35 Terpenes) Produced in Recombinant Corynebacterium glutamicum. Appl. Biochem. Biotechnol. 2018, 186, 525–534. [Google Scholar] [CrossRef] [Scilit]
  53. Henke, N.A.; Wichmann, J.; Baier, T.; Frohwitter, J.; Lauersen, K.J.; Risse, J.M.; Peters-Wendisch, P.; Kruse, O.; Wendisch, V.F. Patchoulol Production with Metabolically Engineered Corynebacterium glutamicum. Genes 2018, 9, 219. [Google Scholar] [CrossRef] [Scilit]
  54. Lim, H.; Park, J.; Woo, H.M. Overexpression of the Key Enzymes in the Methylerythritol 4-Phosphate Pathway in Corynebacterium glutamicum for Improving Farnesyl Diphosphate-Derived Terpene Production. J. Agric. Food Chem. 2020, 68, 10780–10786. [Google Scholar] [CrossRef] [Scilit]
  55. Li, C.; Swofford, C.A.; Rückert, C.; Chatzivasileiou, A.O.; Ou, R.W.; Opdensteinen, P.; Luttermann, T.; Zhou, K.; Stephanopoulos, G.; Jones Prather, K.L.; et al. Heterologous Production of α-Carotene in Corynebacterium glutamicum Using a Multi-Copy Chromosomal Integration Method. Bioresour. Technol. 2021, 341, 125782. [Google Scholar] [CrossRef] [Scilit]
  56. Taniguchi, H.; Henke, N.A.; Heider, S.A.E.; Wendisch, V.F. Overexpression of the Primary Sigma Factor Gene SigA Improved Carotenoid Production by Corynebacterium glutamicum: Application to Production of β-Carotene and the Non-Native Linear C50 Carotenoid Bisanhydrobacterioruberin. Metab. Eng. Commun. 2017, 4, 1–11. [Google Scholar] [CrossRef] [Scilit]
  57. Henke, N.A.; Heider, S.A.E.; Hannibal, S.; Wendisch, V.F.; Peters-Wendisch, P. Isoprenoid Pyrophosphate-Dependent Transcriptional Regulation of Carotenogenesis in Corynebacterium glutamicum. Front. Microbiol. 2017, 8, 633. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  58. Henke, N.A.; Heider, S.; Peters-Wendisch, P.; Wendisch, V. Production of the Marine Carotenoid Astaxanthin by Metabolically Engineered Corynebacterium glutamicum. Mar. Drugs 2016, 14, 124. [Google Scholar] [CrossRef] [Scilit]
  59. Heider, S.A.E.; Wolf, N.; Hofemeier, A.; Peters-Wendisch, P.; Wendisch, V.F. Optimization of the IPP Precursor Supply for the Production of Lycopene, Decaprenoxanthin and Astaxanthin by Corynebacterium glutamicum. Front. Bioeng. Biotechnol. 2014, 2, 28. [Google Scholar] [CrossRef] [Scilit]
  60. Henke, N.A.; Austermeier, S.; Grothaus, I.L.; Götker, S.; Persicke, M.; Peters-Wendisch, P.; Wendisch, V.F. Corynebacterium glutamicum CrtR and Its Orthologs in Actinobacteria: Conserved Function and Application as Genetically Encoded Biosensor for Detection of Geranylgeranyl Pyrophosphate. Int. J. Mol. Sci. 2020, 21, 5482. [Google Scholar] [CrossRef] [Scilit]
  61. Göttl, V.L.; Schmitt, I.; Braun, K.; Peters-Wendisch, P.; Wendisch, V.F.; Henke, N.A. CRISPRi-Library-Guided Target Identification for Engineering Carotenoid Production by Corynebacterium glutamicum. Microorganisms 2021, 9, 670. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  62. Chen, J.-H.; Kato, Y.; Matsuda, M.; Chen, C.-Y.; Nagarajan, D.; Hasunuma, T.; Kondo, A.; Chang, J.-S. Lutein Production with Chlorella sorokiniana MB-1-M12 Using Novel Two-Stage Cultivation Strategies–Metabolic Analysis and Process Improvement. Bioresour. Technol. 2021, 334, 125200. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  63. Li, Q.; You, J.; Qiao, T.; Zhong, D.; Yu, X. Sodium Chloride Stimulates the Biomass and Astaxanthin Production by Haematococcus pluvialis via a Two-Stage Cultivation Strategy. Bioresour. Technol. 2022, 344, 126214. [Google Scholar] [CrossRef] [Scilit]
  64. Sharma, R.; Ghoshal, G. Optimization of Carotenoids Production by Rhodotorula mucilaginosa (MTCC-1403) Using Agro-Industrial Waste in Bioreactor: A Statistical Approach. Biotechnol. Rep. 2020, 25, e00407. [Google Scholar] [CrossRef] [Scilit]
  65. Molino, A.; Mehariya, S.; Iovine, A.; Casella, P.; Marino, T.; Karatza, D.; Chianese, S.; Musmarra, D. Enhancing Biomass and Lutein Production From Scenedesmus almeriensis: Effect of Carbon Dioxide Concentration and Culture Medium Reuse. Front. Plant Sci. 2020, 11, 415. [Google Scholar] [CrossRef] [Scilit]
  66. Zhang, Z.; Zhang, X.; Tan, T. Lipid and Carotenoid Production by Rhodotorula glutinis under Irradiation/High-Temperature and Dark/Low-Temperature Cultivation. Bioresour. Technol. 2014, 157, 149–153. [Google Scholar] [CrossRef] [Scilit]
  67. Ahirwar, A.; Meignen, G.; Khan, M.J.; Sirotiya, V.; Harish; Scarsini, M.; Roux, S.; Marchand, J.; Schoefs, B.; Vinayak, V. Light Modulates Transcriptomic Dynamics Upregulating Astaxanthin Accumulation in Haematococcus: A Review. Bioresour. Technol. 2021, 340, 125707. [Google Scholar] [CrossRef] [Scilit]
  68. Giannelli, L.; Yamada, H.; Katsuda, T.; Yamaji, H. Effects of Temperature on the Astaxanthin Productivity and Light Harvesting Characteristics of the Green Alga Haematococcus pluvialis. J. Biosci. Bioeng. 2015, 119, 345–350. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  69. El-Banna, A.A.; Abd El-Razek, A.M.; El-Mahdy, A.R. Some Factors Affecting the Production of Carotenoids by Rhodotorula Glutinis Var. Glutinis. Food Nutr. Sci. 2012, 3, 64–71. [Google Scholar] [CrossRef]
  70. Han, S.-I.; Chang, S.H.; Lee, C.; Jeon, M.S.; Heo, Y.M.; Kim, S.; Choi, Y.-E. Astaxanthin Biosynthesis Promotion with PH Shock in the Green Microalga, Haematococcus Lacustris. Bioresour. Technol. 2020, 314, 123725. [Google Scholar] [CrossRef] [Scilit]
  71. Harith, Z.T.; de Andrade Lima, M.; Charalampopoulos, D.; Chatzifragkou, A. Optimised Production and Extraction of Astaxanthin from the Yeast Xanthophyllomyces dendrorhous. Microorganisms 2020, 8, 430. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  72. Jiang, M.; Nakano, S. New Insights into the Stoichiometric Regulation of Carotenoid Production in Chlorella vulgaris. Bioresour. Technol. Rep. 2022, 20, 101227. [Google Scholar] [CrossRef] [Scilit]
  73. Marinho, Y.F.; Malafaia, C.B.; de Araújo, K.S.; da Silva, T.D.; dos Santos, A.P.F.; de Moraes, L.B.; Gálvez, A.O. Evaluation of the Influence of Different Culture Media on Growth, Life Cycle, Biochemical Composition, and Astaxanthin Production in Haematococcus pluvialis. Aquacult. Int. 2021, 29, 757–778. [Google Scholar] [CrossRef] [Scilit]
  74. Martins, V.; Dias, C.; Caldeira, J.; Duarte, L.C.; Reis, A.; Lopes da Silva, T. Carob Pulp Syrup: A Potential Mediterranean Carbon Source for Carotenoids Production by Rhodosporidium toruloides NCYC 921. Bioresour. Technol. Rep. 2018, 3, 177–184. [Google Scholar] [CrossRef] [Scilit]
  75. Liu, Z.; Feist, A.M.; Dragone, G.; Mussatto, S.I. Lipid and Carotenoid Production from Wheat Straw Hydrolysates by Different Oleaginous Yeasts. J. Clean. Prod. 2020, 249, 119308. [Google Scholar] [CrossRef] [Scilit]
  76. Pedras, B.M.; Gonçalves, C.; Figueira, D.R.; Simões, P.; Gonçalves, P.; Paiva, A.; Barreiros, S.; Salema-Oom, M. White Wine Grape Pomace as a Suitable Carbon Source for Lipid and Carotenoid Production by Fructophilic Rhodorotula Babjevae. J. Appl. Microbiol. 2022, 133, 656–664. [Google Scholar] [CrossRef] [Scilit]
  77. Wendisch, V.F.; Brito, L.F.; Gil Lopez, M.; Hennig, G.; Pfeifenschneider, J.; Sgobba, E.; Veldmann, K.H. The Flexible Feedstock Concept in Industrial Biotechnology: Metabolic Engineering of Escherichia coli, Corynebacterium glutamicum, Pseudomonas, Bacillus and Yeast Strains for Access to Alternative Carbon Sources. J. Biotechnol. 2016, 234, 139–157. [Google Scholar] [CrossRef] [Scilit]
  78. Wendisch, V.F. Metabolic Engineering Advances and Prospects for Amino Acid Production. Metab. Eng. 2020, 58, 17–34. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  79. Kawaguchi, H.; Sasaki, M.; Vertès, A.A.; Inui, M.; Yukawa, H. Engineering of an L-Arabinose Metabolic Pathway in Corynebacterium glutamicum. Appl. Microbiol. Biotechnol. 2008, 77, 1053–1062. [Google Scholar] [CrossRef] [Scilit]
  80. Schneider, J.; Niermann, K.; Wendisch, V.F. Production of the Amino Acids L-Glutamate, l-Lysine, l-Ornithine and l-Arginine from Arabinose by Recombinant Corynebacterium glutamicum. J. Biotechnol. 2011, 154, 191–198. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  81. Jin, C.; Huang, Z.; Bao, J. High-Titer Glutamic Acid Production from Lignocellulose Using an Engineered Corynebacterium glutamicum with Simultaneous Co-Utilization of Xylose and Glucose. ACS Sustain. Chem. Eng. 2020, 8, 6315–6322. [Google Scholar] [CrossRef] [Scilit]
  82. Kawaguchi, H.; Vertès, A.A.; Okino, S.; Inui, M.; Yukawa, H. Engineering of a Xylose Metabolic Pathway in Corynebacterium glutamicum. Appl. Environ. Microbiol. 2006, 72, 3418–3428. [Google Scholar] [CrossRef] [Scilit]
  83. Meiswinkel, T.M.; Gopinath, V.; Lindner, S.N.; Nampoothiri, K.M.; Wendisch, V.F. Accelerated Pentose Utilization by Corynebacterium glutamicum for Accelerated Production of Lysine, Glutamate, Ornithine and Putrescine. Microb. Biotechnol. 2013, 6, 131–140. [Google Scholar] [CrossRef] [Scilit]
  84. Mindt, M.; Heuser, M.; Wendisch, V.F. Xylose as Preferred Substrate for Sarcosine Production by Recombinant Corynebacterium glutamicum. Bioresour. Technol. 2019, 281, 135–142. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  85. Uhde, A.; Youn, J.-W.; Maeda, T.; Clermont, L.; Matano, C.; Krämer, R.; Wendisch, V.F.; Seibold, G.M.; Marin, K. Glucosamine as Carbon Source for Amino Acid-Producing Corynebacterium glutamicum. Appl. Microbiol. Biotechnol. 2013, 97, 1679–1687. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  86. Matano, C.; Uhde, A.; Youn, J.-W.; Maeda, T.; Clermont, L.; Marin, K.; Krämer, R.; Wendisch, V.F.; Seibold, G.M. Engineering of Corynebacterium glutamicum for Growth and l-Lysine and Lycopene Production from N-Acetyl-Glucosamine. Appl. Microbiol. Biotechnol. 2014, 98, 5633–5643. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  87. Vortmann, M.; Stumpf, A.K.; Sgobba, E.; Dirks-Hofmeister, M.E.; Krehenbrink, M.; Wendisch, V.F.; Philipp, B.; Moerschbacher, B.M. A Bottom-up Approach towards a Bacterial Consortium for the Biotechnological Conversion of Chitin to l-Lysine. Appl. Microbiol. Biotechnol. 2021, 105, 1547–1561. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  88. Gopinath, V.; Meiswinkel, T.M.; Wendisch, V.F.; Nampoothiri, K.M. Amino Acid Production from Rice Straw and Wheat Bran Hydrolysates by Recombinant Pentose-Utilizing Corynebacterium glutamicum. Appl. Microbiol. Biotechnol. 2011, 92, 985–996. [Google Scholar] [CrossRef] [Scilit]
  89. Mindt, M.; Hannibal, S.; Heuser, M.; Risse, J.M.; Sasikumar, K.; Nampoothiri, K.M.; Wendisch, V.F. Fermentative Production of N-Alkylated Glycine Derivatives by Recombinant Corynebacterium glutamicum Using a Mutant of Imine Reductase DpkA From Pseudomonas putida. Front. Bioeng. Biotechnol. 2019, 7, 232. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  90. Sasaki, Y.; Eng, T.; Herbert, R.A.; Trinh, J.; Chen, Y.; Rodriguez, A.; Gladden, J.; Simmons, B.A.; Petzold, C.J.; Mukhopadhyay, A. Engineering Corynebacterium glutamicum to Produce the Biogasoline Isopentenol from Plant Biomass Hydrolysates. Biotechnol. Biofuels 2019, 12, 41. [Google Scholar] [CrossRef] [Scilit]
  91. Meiswinkel, T.M.; Rittmann, D.; Lindner, S.N.; Wendisch, V.F. Crude Glycerol-Based Production of Amino Acids and Putrescine by Corynebacterium glutamicum. Bioresour. Technol. 2013, 145, 254–258. [Google Scholar] [CrossRef] [Scilit]
  92. Lange, J.; Müller, F.; Bernecker, K.; Dahmen, N.; Takors, R.; Blombach, B. Valorization of Pyrolysis Water: A Biorefinery Sidestream, for 1,2-Propanediol Production with Engineered Corynebacterium glutamicum. Biotechnol. Biofuels 2017, 10, 277. [Google Scholar] [CrossRef] [Scilit]
  93. Burgardt, A.; Prell, C.; Wendisch, V.F. Utilization of a Wheat Sidestream for 5-Aminovalerate Production in Corynebacterium glutamicum. Front. Bioeng. Biotechnol. 2021, 9, 732271. [Google Scholar] [CrossRef] [Scilit]
  94. Prell, C.; Burgardt, A.; Meyer, F.; Wendisch, V.F. Fermentative Production of L-2-Hydroxyglutarate by Engineered Corynebacterium glutamicum via Pathway Extension of l-Lysine Biosynthesis. Front. Bioeng. Biotechnol. 2021, 8, 630476. [Google Scholar] [CrossRef] [Scilit]
  95. Eggeling, L.; Bott, M. Handbook of Corynebacterium glutamicum, 1st ed.; CRC Press: Boca Raton, FL, USA, 2004. [Google Scholar]
  96. Kind, S.; Jeong, W.K.; Schröder, H.; Wittmann, C. Systems-Wide Metabolic Pathway Engineering in Corynebacterium glutamicum for Bio-Based Production of Diaminopentane. Metab. Eng. 2010, 12, 341–351. [Google Scholar] [CrossRef] [Scilit]
  97. Schneider, J.; Wendisch, V.F. Putrescine Production by Engineered Corynebacterium glutamicum. Appl. Microbiol. Biotechnol. 2010, 88, 859–868. [Google Scholar] [CrossRef] [Scilit]
  98. Haupka, C.; Delépine, B.; Irla, M.; Heux, S.; Wendisch, V.F. Flux Enforcement for Fermentative Production of 5-Aminovalerate and Glutarate by Corynebacterium glutamicum. Catalysts 2020, 10, 1065. [Google Scholar] [CrossRef] [Scilit]
  99. Platzen, L.; Koch-Koerfges, A.; Weil, B.; Brocker, M.; Bott, M. Role of Flavohaemoprotein Hmp and Nitrate Reductase NarGHJI of Corynebacterium glutamicum for Coping with Nitrite and Nitrosative Stress. FEMS Microbiol. Lett. 2014, 350, 239–248. [Google Scholar] [CrossRef] [Scilit]
  100. Takeno, S.; Ohnishi, J.; Komatsu, T.; Masaki, T.; Sen, K.; Ikeda, M. Anaerobic Growth and Potential for Amino Acid Production by Nitrate Respiration in Corynebacterium glutamicum. Appl. Microbiol. Biotechnol. 2007, 75, 1173–1182. [Google Scholar] [CrossRef] [Scilit]
  101. Brailo, M.; Schreier, H.J.; McDonald, R.; Maršić-Lučić, J.; Gavrilović, A.; Pećarević, M.; Jug-Dujaković, J. Bacterial Community Analysis of Marine Recirculating Aquaculture System Bioreactors for Complete Nitrogen Removal Established from a Commercial Inoculum. Aquaculture 2019, 503, 198–206. [Google Scholar] [CrossRef] [Scilit]
  102. Ruiz, P.; Vidal, J.M.; Sepúlveda, D.; Torres, C.; Villouta, G.; Carrasco, C.; Aguilera, F.; Ruiz-Tagle, N.; Urrutia, H. Overview and Future Perspectives of Nitrifying Bacteria on Biofilters for Recirculating Aquaculture Systems. Rev. Aquac. 2020, 12, 1478–1494. [Google Scholar] [CrossRef] [Scilit]
  103. Koyama, T. Molecular Analysis of Prenyl Chain Elongating Enzymes. Biosci. Biotechnol. Biochem. 1999, 63, 1671–1676. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  104. Liang, P.-H.; Ko, T.-P.; Wang, A.H.-J. Structure, Mechanism and Function of Prenyltransferases: Structure, Mechanism and Function of Prenyltransferases. Eur. J. Biochem. 2002, 269, 3339–3354. [Google Scholar] [CrossRef] [Scilit]
  105. Liang, P.-H. Reaction Kinetics, Catalytic Mechanisms, Conformational Changes, and Inhibitor Design for Prenyltransferases. Biochemistry 2009, 48, 6562–6570. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  106. Heider, S.A.E.; Peters-Wendisch, P.; Beekwilder, J.; Wendisch, V.F. IdsA Is the Major Geranylgeranyl Pyrophosphate Synthase Involved in Carotenogenesis in Corynebacterium glutamicum. FEBS J. 2014, 281, 4906–4920. [Google Scholar] [CrossRef] [Scilit]
  107. Yang, J.; Zhou, T.; Jiang, Y.; Yang, B. Substrate Specificity Change of a Flavonoid Prenyltransferase AhPT1 Induced by Metal Ion. Int. J. Biol. Macromol. 2020, 153, 264–275. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  108. Bouvier, F.; Keller, Y.; d’Harlingue, A.; Camara, B. Xanthophyll Biosynthesis: Molecular and Functional Characterization of Carotenoid Hydroxylases from Pepper Fruits (Capsicum annuum L.). Biochim. Biophys. Acta 1998, 1391, 320–328. [Google Scholar] [CrossRef] [Scilit]
  109. Buzzini, P.; Martini, A.; Gaetani, M.; Turchetti, B.; Pagnoni, U.M.; Davoli, P. Optimization of Carotenoid Production by Rhodotorula graminis DBVPG 7021 as a Function of Trace Element Concentration by Means of Response Surface Analysis. Enzym. Microb. Technol. 2005, 36, 687–692. [Google Scholar] [CrossRef] [Scilit]
  110. Rusinova-Videva, S.; Dimitrova, S.; Georgieva, K.; Katsarova, M.; Pavlova, K. Effect of Zn2+, Cu2+ and Fe2+ Ions for Accumulation of Ergosterol, β–Carotene and Coenzyme Q10 by Antarctic Yeast Strain Sporobolomyces salmonicolor AL1. Compt. Rend. Acad. Bulg. Sci. 2016, 69, 1005–1012. [Google Scholar]
  111. Chen, D.; Han, Y.; Gu, Z. Application of Statistical Methodology to the Optimization of Fermentative Medium for Carotenoids Production by Rhodobacter sphaeroides. Process Biochem. 2006, 41, 1773–1778. [Google Scholar] [CrossRef] [Scilit]
  112. Nasri Nasrabadi, M.R.; Razavi, S.H. Enhancement of Canthaxanthin Production from Dietzia natronolimnaea HS-1 in a Fed-Batch Process Using Trace Elements and Statistical Methods. Braz. J. Chem. Eng. 2010, 27, 517–529. [Google Scholar] [CrossRef] [Scilit]
  113. Gervasi, T.; Santini, A.; Daliu, P.; Salem, A.Z.M.; Gervasi, C.; Pellizzeri, V.; Barrega, L.; De Pasquale, P.; Dugo, G.; Cicero, N. Astaxanthin Production by Xanthophyllomyces dendrorhous Growing on a Low Cost Substrate. Agroforest. Syst. 2020, 94, 1229–1234. [Google Scholar] [CrossRef] [Scilit]
  114. Amado, I.R.; Vázquez, J.A. Mussel Processing Wastewater: A Low-Cost Substrate for the Production of Astaxanthin by Xanthophyllomyces dendrorhous. Microb. Cell Factories 2015, 14, 177. [Google Scholar] [CrossRef] [Scilit]
  115. Bohutskyi, P.; Kucek, L.A.; Hill, E.; Pinchuk, G.E.; Mundree, S.G.; Beliaev, A.S. Conversion of Stranded Waste-Stream Carbon and Nutrients into Value-Added Products via Metabolically Coupled Binary Heterotroph-Photoautotroph System. Bioresour. Technol. 2018, 260, 68–75. [Google Scholar] [CrossRef] [Scilit]
  116. Lai, J.-X.; Chen, X.; Bu, J.; Hu, B.-B.; Zhu, M.-J. Direct Production of Astaxanthin from Food Waste by Phaffia rhodozyma. Process Biochem. 2022, 113, 224–233. [Google Scholar] [CrossRef] [Scilit]
  117. Stoklosa, R.J.; Nghiem, N.P.; Latona, R.J. Xylose-Enriched Ethanol Fermentation Stillage from Sweet Sorghum for Xylitol and Astaxanthin Production. Fermentation 2019, 5, 84. [Google Scholar] [CrossRef] [Scilit]
  118. Qi, D.-D.; Jin, J.; Liu, D.; Jia, B.; Yuan, Y.-J. In Vitro and in Vivo Recombination of Heterologous Modules for Improving Biosynthesis of Astaxanthin in Yeast. Microb. Cell Factories 2020, 19, 103. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  119. Zhang, M.; Gong, Z.; Tang, J.; Lu, F.; Li, Q.; Zhang, X. Improving Astaxanthin Production in Escherichia coli by Co-Utilizing CrtZ Enzymes with Different Substrate Preference. Microb. Cell Factories 2022, 21, 71. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  120. Wan-Mohtar, W.A.A.Q.I.; Ibrahim, M.F.; Rasdi, N.W.; Zainorahim, N.; Taufek, N.M. Microorganisms as a Sustainable Aquafeed Ingredient: A Review. Aquac. Res. 2022, 53, 746–766. [Google Scholar] [CrossRef] [Scilit]
  121. Alloul, A.; Wille, M.; Lucenti, P.; Bossier, P.; Van Stappen, G.; Vlaeminck, S.E. Purple Bacteria as Added-Value Protein Ingredient in Shrimp Feed: Penaeus vannamei Growth Performance, and Tolerance against Vibrio and Ammonia Stress. Aquaculture 2021, 530, 735788. [Google Scholar] [CrossRef] [Scilit]
  122. Delamare-Deboutteville, J.; Batstone, D.J.; Kawasaki, M.; Stegman, S.; Salini, M.; Tabrett, S.; Smullen, R.; Barnes, A.C.; Hülsen, T. Mixed Culture Purple Phototrophic Bacteria Is an Effective Fishmeal Replacement in Aquaculture. Water Res. X 2019, 4, 100031. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  123. Mora-Sánchez, B.; Balcázar, J.L.; Pérez-Sánchez, T. Effect of a Novel Postbiotic Containing Lactic Acid Bacteria on the Intestinal Microbiota and Disease Resistance of Rainbow Trout (Oncorhynchus mykiss). Biotechnol. Lett. 2020, 42, 1957–1962. [Google Scholar] [CrossRef] [Scilit]
  124. Biswas, A.; Takakuwa, F.; Yamada, S.; Matsuda, A.; Saville, R.M.; LeBlanc, A.; Silverman, J.A.; Sato, N.; Tanaka, H. Methanotroph (Methylococcus capsulatus, Bath) Bacteria Meal as an Alternative Protein Source for Japanese Yellowtail, Seriola quinqueradiata. Aquaculture 2020, 529, 735700. [Google Scholar] [CrossRef] [Scilit]
  125. Chen, Y.; Chi, S.; Zhang, S.; Dong, X.; Yang, Q.; Liu, H.; Tan, B.; Xie, S. Evaluation of Methanotroph (Methylococcus capsulatus, Bath) Bacteria Meal on Body Composition, Lipid Metabolism, Protein Synthesis and Muscle Metabolites of Pacific White Shrimp (Litopenaeus vannamei). Aquaculture 2022, 547, 737517. [Google Scholar] [CrossRef] [Scilit]
  126. Henke, N.A.; Wiebe, D.; Pérez-García, F.; Peters-Wendisch, P.; Wendisch, V.F. Coproduction of Cell-Bound and Secreted Value-Added Compounds: Simultaneous Production of Carotenoids and Amino Acids by Corynebacterium glutamicum. Bioresour. Technol. 2018, 247, 744–752. [Google Scholar] [CrossRef] [Scilit]
  127. Craig, S.; Helfrich, L.; Kuhn, D.D.; Schwarz, M.H. Understanding Fish Nutrition, Feeds, and Feeding. VCE Publ. 2017, 269, 6. [Google Scholar]
  128. Li, X.; Zheng, S.; Wu, G. Nutrition and Functions of Amino Acids in Fish. In Amino Acids in Nutrition and Health: Amino Acids in the Nutrition of Companion, Zoo and Farm Animals; Wu, G., Ed.; Advances in Experimental Medicine and Biology; Springer International Publishing: Cham, Switzerland, 2021; pp. 133–168. ISBN 978-3-030-54462-1. [Google Scholar]
  129. Feeda, P.; Bampidis, V.; Azimonti, G.; de Bastos, M.L.; Christensen, H.; Dusemund, B.; Fašmon Durjava, M.; Kouba, M.; López-Alonso, M.; López Puente, S.; et al. Safety and Efficacy of a Feed Additive Consisting of L-Lysine Sulfate Produced by Corynebacterium glutamicum KCCM 80227 for All Animal Species (Daesang Europe BV). EFSA J. 2021, 19, e06706. [Google Scholar] [CrossRef] [Scilit]
  130. Bertani, G. STUDIES ON LYSOGENESIS I: The Mode of Phage Liberation by Lysogenic Escherichia Coli. J Bacteriol 1951, 62, 293–300. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  131. Hanahan, D. Studies on Transformation of Escherichia coli with Plasmids. J. Mol. Biol. 1983, 166, 557–580. [Google Scholar] [CrossRef] [Scilit]
  132. Cho, J.-C.; Giovannoni, S.J. Fulvimarina pelagi Gen. Nov., Sp. Nov., a Marine Bacterium That Forms a Deep Evolutionary Lineage of Descent in the Order “Rhizobiales.”. Int. J. Syst. Evol. Microbiol. 2003, 53, 1853–1859. [Google Scholar] [CrossRef] [Scilit]
  133. Abe, S.; Takayama, K.-I.; Kinoshita, S. Taxonomical Studies on Glutamic Acid-Producing Bacteria. J. Gen. Appl. Microbiol. 1967, 13, 279–301. [Google Scholar] [CrossRef] [Scilit]
  134. Baumgart, M.; Unthan, S.; Rückert, C.; Sivalingam, J.; Grünberger, A.; Kalinowski, J.; Bott, M.; Noack, S.; Frunzke, J. Construction of a Prophage-Free Variant of Corynebacterium glutamicum ATCC 13032 for Use as a Platform Strain for Basic Research and Industrial Biotechnology. Appl. Environ. Microbiol. 2013, 79, 6006–6015. [Google Scholar] [CrossRef] [Scilit]
  135. Taniguchi, H.; Wendisch, V.F. Exploring the Role of Sigma Factor Gene Expression on Production by Corynebacterium glutamicum: Sigma Factor H and FMN as Example. Front. Microbiol. 2015, 6, 740. [Google Scholar] [CrossRef] [Scilit]
  136. Gibson, D.G.; Young, L.; Chuang, R.-Y.; Venter, J.C.; Hutchison, C.A.; Smith, H.O. Enzymatic Assembly of DNA Molecules up to Several Hundred Kilobases. Nat. Methods 2009, 6, 343–345. [Google Scholar] [CrossRef] [Scilit]
  137. Hanahan, D.; Jessee, J.; Bloom, F.R. Plasmid Transformation of Escherichia coli and Other Bacteria. In Methods in Enzymology; Bacterial Genetic Systems; Academic Press: Cambridge, MA, USA, 1991; Volume 204, pp. 63–113. [Google Scholar]
  138. van der Rest, M.E.; Lange, C.; Molenaar, D. A Heat Shock Following Electroporation Induces Highly Efficient Transformation of Corynebacterium glutamicum with Xenogeneic Plasmid DNA. Appl. Microbiol. Biotechnol. 1999, 52, 541–545. [Google Scholar] [CrossRef] [Scilit]
  139. Prell, C.; Vonderbank, S.-A.; Meyer, F.; Pérez-García, F.; Wendisch, V.F. Metabolic Engineering of Corynebacterium glutamicum for de Novo Production of 3-Hydroxycadaverine. Curr. Res. Biotechnol. 2022, 4, 32–46. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Carotenoid Biosynthesis in C. glutamicum. Gene names are given next to the reactions catalyzed by their gene products. Heterologous genes are depicted with a grey box. GAP: Glyceraldehyde 3-phosphate; IPP: isopenthenyl pyrophosphate; DMAPP: dimethylallyl diphosphate; BABR: bisanhydrobacterioruberin; C.p.450: 2,2′-bis-(4-hydroxy-3-methybut-2enyl)-β,β-carotene; dxs: 1-deoxy-D-xylulose 5-phosphate synthase; idsA: geranylgeranyl pyrophosphate synthase; crtE: geranylgeranyl pyrophosphate synthase; crtB: phytoene synthase, crtI: phytoene desaturase; crtEb: lycopene elongase; crtYe/f: ϵ-cyclase; crtYg/h Ml: C50 carotenoid γ-cyclase from Micrococcus leuteus; lbtBCDs: subunit of C50 carotenoid β-cyclase (B) and lycopene elongase (C) from Dietzia sp. CQ4; lbtABDs: C50 carotenoid β-cyclase from Dietzia sp. CQ4; crtYPa: lycopene cyclase from Pantoea ananatis; crtWFp: β-carotene ketolase from Fulvimarina pelagi; crtZFp: β-carotene hydroxylase from Fulvimarina pelagi.
Figure 1. Carotenoid Biosynthesis in C. glutamicum. Gene names are given next to the reactions catalyzed by their gene products. Heterologous genes are depicted with a grey box. GAP: Glyceraldehyde 3-phosphate; IPP: isopenthenyl pyrophosphate; DMAPP: dimethylallyl diphosphate; BABR: bisanhydrobacterioruberin; C.p.450: 2,2′-bis-(4-hydroxy-3-methybut-2enyl)-β,β-carotene; dxs: 1-deoxy-D-xylulose 5-phosphate synthase; idsA: geranylgeranyl pyrophosphate synthase; crtE: geranylgeranyl pyrophosphate synthase; crtB: phytoene synthase, crtI: phytoene desaturase; crtEb: lycopene elongase; crtYe/f: ϵ-cyclase; crtYg/h Ml: C50 carotenoid γ-cyclase from Micrococcus leuteus; lbtBCDs: subunit of C50 carotenoid β-cyclase (B) and lycopene elongase (C) from Dietzia sp. CQ4; lbtABDs: C50 carotenoid β-cyclase from Dietzia sp. CQ4; crtYPa: lycopene cyclase from Pantoea ananatis; crtWFp: β-carotene ketolase from Fulvimarina pelagi; crtZFp: β-carotene hydroxylase from Fulvimarina pelagi.
Molecules 28 01996 g001
Figure 2. Nutrient composition of the aquaculture sidestream. Macro- and Micro-nutrients detected in an analysis of the untreated aquaculture sidestream performed by Eurofins Agraranalytik Deutschland GmbH. Nutrients below the detection limit are not represented.
Figure 2. Nutrient composition of the aquaculture sidestream. Macro- and Micro-nutrients detected in an analysis of the untreated aquaculture sidestream performed by Eurofins Agraranalytik Deutschland GmbH. Nutrients below the detection limit are not represented.
Molecules 28 01996 g002
Figure 3. Growth of C. glutamicum WT in AQ containing media. ∆OD600 nm, µmax, and decaprenoxanthin production after 48 h of C. glutamicum WT grown in a Biolector® flowerplate microcultivation system. The maximal OD600 nm difference from the initial OD600 nm during 48 h of cultivation is given as ∆OD600 nm. Values and error bars represent means and standard deviations of triplicate cultivations. Statistical significance in comparison to the cultivation in CGXII medium was assessed for ∆OD600 nm (marked in green) and decaprenoxanthin production (marked in black) in Student’s t-test (*** p < 0.0001, ** p < 0.001, * p < 0.05). (A) Growth on CGXII, CGXII with addition of 20% (v/v) AQ and CGXII with 20% (v/v) AQ replacing media components of the CGXII composition. (B) Growth on CGXII without carbon source, 5 to 40% (v/v) AQ were supplemented as replacement. (C) Growth on AQ as the sole medium component, with adjustment to pH 7 and the addition of MOPS buffer, glucose, (NH4)2SO4, and/or urea and phosphorous source (P). The last column represents the AQ based medium CGAQ.
Figure 3. Growth of C. glutamicum WT in AQ containing media. ∆OD600 nm, µmax, and decaprenoxanthin production after 48 h of C. glutamicum WT grown in a Biolector® flowerplate microcultivation system. The maximal OD600 nm difference from the initial OD600 nm during 48 h of cultivation is given as ∆OD600 nm. Values and error bars represent means and standard deviations of triplicate cultivations. Statistical significance in comparison to the cultivation in CGXII medium was assessed for ∆OD600 nm (marked in green) and decaprenoxanthin production (marked in black) in Student’s t-test (*** p < 0.0001, ** p < 0.001, * p < 0.05). (A) Growth on CGXII, CGXII with addition of 20% (v/v) AQ and CGXII with 20% (v/v) AQ replacing media components of the CGXII composition. (B) Growth on CGXII without carbon source, 5 to 40% (v/v) AQ were supplemented as replacement. (C) Growth on AQ as the sole medium component, with adjustment to pH 7 and the addition of MOPS buffer, glucose, (NH4)2SO4, and/or urea and phosphorous source (P). The last column represents the AQ based medium CGAQ.
Molecules 28 01996 g003
Figure 4. Carotenoid production of C. glutamicum strains in AQ supplemented media. Carotenoid production of C. glutamicum MB001∆crtR (decaprenoxanthin), LYC6 (lycopene), CP1 (C.p.450), BABR1 (bisanhydrobacterioruberin), SAX1 (sarcinaxanthin), BETA4 (β-carotene), ZEA5 (zeaxanthin), CAN5 (canthaxanthin), ASTA* (astaxanthin) grown on CGXII, CGXII supplemented with 20% (v/v) AQ, or the AQ derived medium CGAQ for 48 h. Values and error bars represent means and standard deviations of triplicate cultivations. Statistical significance in comparison to the cultivation of each strain in CGXII medium was assessed in Student´s t-test (*** p < 0.0001, ** p < 0.001, * p < 0.05).
Figure 4. Carotenoid production of C. glutamicum strains in AQ supplemented media. Carotenoid production of C. glutamicum MB001∆crtR (decaprenoxanthin), LYC6 (lycopene), CP1 (C.p.450), BABR1 (bisanhydrobacterioruberin), SAX1 (sarcinaxanthin), BETA4 (β-carotene), ZEA5 (zeaxanthin), CAN5 (canthaxanthin), ASTA* (astaxanthin) grown on CGXII, CGXII supplemented with 20% (v/v) AQ, or the AQ derived medium CGAQ for 48 h. Values and error bars represent means and standard deviations of triplicate cultivations. Statistical significance in comparison to the cultivation of each strain in CGXII medium was assessed in Student´s t-test (*** p < 0.0001, ** p < 0.001, * p < 0.05).
Molecules 28 01996 g004
Figure 5. Batch-Fermentations. Progression of astaxanthin content (red squares), OD600 nm (green dots), agitator speed (grey line), and relative dissolved oxygen concentration (rDOS) (blue line) over time during 2 L batch fermentations with C. glutamicum ASTA* grown in CGXII medium (A) and CGXII medium supplemented with 20% (v/v) AQ (B).
Figure 5. Batch-Fermentations. Progression of astaxanthin content (red squares), OD600 nm (green dots), agitator speed (grey line), and relative dissolved oxygen concentration (rDOS) (blue line) over time during 2 L batch fermentations with C. glutamicum ASTA* grown in CGXII medium (A) and CGXII medium supplemented with 20% (v/v) AQ (B).
Molecules 28 01996 g005
Table 1. Strains and plasmids used in this study.
Table 1. Strains and plasmids used in this study.
Strain/PlasmidCharacteristicsReference
Escherichia coli DH5αF- thi−1 endA1 hsdR17(r-, m-) supE44lacU169 (Φ80lacZ∆M15) recA1 gyrA96[131]
Fulvimarina pelagiType strain, HTCC 2506; DSM No. 15513[132]
Corynebacterium glutamicum strains
WTwild type, ATCC 13032[133]
MB001ATCC 13032 with in-frame deletion of prophages cgp1 (cg1507-cg1524), cgp2 (cg1746-cg1752), cgp3 (cg1890-cg2071)[134]
MB001∆crtRMB001 derivative with deletion of crtR (cg0725)[57]
LYC5MB001 derivative with deletion of crtYefEb (cg0717-cg0719), and chromosomal integration of Ptuf-dxs and Ptuf-crtEBI[58]
LYC6LYC5 derivative with deletion of crtR (cg0725)[57]
BABR1LYC5 carrying pVWEx1_lbtBC and pEKEx3_sigA[56]
CP1LYC6 carrying pEKEx3_lbtABC[57]
SAX1LYC6 carrying pEKEx3_crtE2Y[57]
BETA4LYC6 with chromosomal integration of crtY from P. ananatis under the control of tuf promotor[57]
ZEA5BETA4 carrying pSH2_crtZFpthis work
CAN5BETA4 carrying pSH2_crtWFpthis work
ASTA*BETA4 carrying pSH1_crtZ~WFp[46]
BETALYSGRLys1 with the following modifications: ∆ldhA (cg3219), ∆sugR (cg2115), ∆crtR (cg0725), ∆crtYefEb (cg0717-cg0719), chromosomal integration of Ptuf-crtEBI and Ptuf-crtYPa[126]
ASTALYS*BETALYS carrying pSH1_crtZ~WFpthis work
Plasmids
pEKEx3_sigASpecR; pBL1 oriVCg, E. coli/C. glutamicum shuttle vector; for IPTG-inducible expression of sigA from C. glutamicum[135]
pEKEx3_crtE2YSpecR; pBL1 oriVCg, E. coli/C. glutamicum shuttle vector; for IPTG-inducible expression of crtE2 and crtYg/h from M. luteus containing an artificial ribosome binding site in front of crtE2[48]
pEKEx3_lbtABCSpecR; pBL1 oriVCg, E. coli/C. glutamicum shuttle vector for IPTG-inducible expression of codon optimized lbtABC from Dietzia sp. CQ4 containing artificial ribosome binding sites in front of each gene[48]
pVWEx1_lbtBCKmR; pCG1 oriVCg, E. coli/C. glutamicum shuttle vector for IPTG-inducible expression of lbtBC from Dietzia sp. CQ4[56]
pSH1_crtZ~WFpKmR; pHM519 oriVCg; E. coli/C. glutamicum shuttle vector, Ptuf, encoding a fusion protein comprising CrtZ and CrtW from F. pelagi[46]
pSH2pSH1 derivative with mutation in repAthis work
pSH2_crtZFppSH2 derivative for constitutive expression of crtZ from F. pelagithis work
pSH2_crtWFppSH2 derivative for constitutive expression of crtW from F. pelagithis work
Table 2. Oligonucleotides used in this study.
Table 2. Oligonucleotides used in this study.
Oligonucleotide Sequence (5′→3′)
HA36 AAAATCGCTTGACCATTGCAGGTTG
HA37 CTTTAGCTTTCCTAGCTTGTCGTTGAC
HA34 CATGCCTGCAGGTCGACTCTAGAGGAAAGGAGGCCCTTCAGATGACGATCTGGACTCTCTACTAC
HA35 ATTCGAGCTCGGTACCCGGGGATCTTACCGAACCGGCGCGT
FpW1 CATGCCTGCAGGTCGACTCTAGAGGAAAGGAGGCCCTTCAGATGACCCTCAGCCCAACCTC
FpW4 ATTCGAGCTCGGTACCCGGGGATCTTAGGACTGGCGAGTATGCG
PD5 CGCTCACCGGCTCCAGATTTATCAG
582 ATCTTCTCTCATCCGCCA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Schmitt, I.; Meyer, F.; Krahn, I.; Henke, N.A.; Peters-Wendisch, P.; Wendisch, V.F. From Aquaculture to Aquaculture: Production of the Fish Feed Additive Astaxanthin by Corynebacterium glutamicum Using Aquaculture Sidestream. Molecules 2023, 28, 1996. https://doi.org/10.3390/molecules28041996

AMA Style

Schmitt I, Meyer F, Krahn I, Henke NA, Peters-Wendisch P, Wendisch VF. From Aquaculture to Aquaculture: Production of the Fish Feed Additive Astaxanthin by Corynebacterium glutamicum Using Aquaculture Sidestream. Molecules. 2023; 28(4):1996. https://doi.org/10.3390/molecules28041996

Chicago/Turabian Style

Schmitt, Ina, Florian Meyer, Irene Krahn, Nadja A. Henke, Petra Peters-Wendisch, and Volker F. Wendisch. 2023. "From Aquaculture to Aquaculture: Production of the Fish Feed Additive Astaxanthin by Corynebacterium glutamicum Using Aquaculture Sidestream" Molecules 28, no. 4: 1996. https://doi.org/10.3390/molecules28041996

APA Style

Schmitt, I., Meyer, F., Krahn, I., Henke, N. A., Peters-Wendisch, P., & Wendisch, V. F. (2023). From Aquaculture to Aquaculture: Production of the Fish Feed Additive Astaxanthin by Corynebacterium glutamicum Using Aquaculture Sidestream. Molecules, 28(4), 1996. https://doi.org/10.3390/molecules28041996

Article Metrics

Back to TopTop