The Ameliorative Effect of Pioglitazone against Neuroinflammation Caused by Doxorubicin in Rats
Abstract
:1. Introduction
2. Results
2.1. Effect of DOX and PIO on Mortality
2.2. Effect of DOX and PIO on Body Weight
2.3. Effect of DOX and PIO on Performance in the Y-Maze Test
2.4. Effects of DOX and PIO on Performance in the NOR Test
2.5. Effects of DOX and PIO on Performance in the EPM Test
2.6. Effect of DOX and PIO on IL-1β Level in Rat Brain
2.7. Effect of DOX and PIO on TNF-α Level in Rat Brain
2.8. Effect of DOX and PIO on IL-6 Level in Rat Brain
2.9. Effect of DOX and PIO on mRNA Expression of IL-1β
2.10. Effect of DOX and PIO on mRNA Expression of TNF-α
2.11. Effect of DOX and PIO on mRNA Expression of IL-6
3. Materials and Methods
3.1. Chemicals
3.2. Animals
3.3. Drug Treatment
3.4. Y-Maze Test
3.5. Novel Object Recognition Test
3.6. Elevated plus Maze
3.7. Collection of Brain Tissue Samples
3.8. Enzyme-Linked Immunosorbent Assays
3.9. Reverse-Transcription Quantitative Polymerase Chain Reaction
3.10. Statistical Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Sample Availability
Abbreviations
DOX | doxorubicin |
BBB | blood–brain barrier |
PIO | pioglitazone |
PPARs | peroxisome proliferator-activated receptors |
NOR | novel object recognition |
EPM | elevated plus maze |
References
- Zandbergen, N.; de Rooij, B.H.; Vos, M.C.; Pijnenborg, J.M.A.; Boll, D.; Kruitwagen, R.; van de Poll-Franse, L.V.; Ezendam, N.P.M. Changes in health-related quality of life among gynecologic cancer survivors during the two years after initial treatment: A longitudinal analysis. Acta Oncol. 2019, 58, 790–800. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lange, M.; Joly, F.; Vardy, J.; Ahles, T.; Dubois, M.; Tron, L.; Winocur, G.; De Ruiter, M.B.; Castel, H. Cancer-related cognitive impairment: An update on state of the art, detection, and management strategies in cancer survivors. Ann. Oncol. 2019, 30, 1925–1940. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vardy, J.; Wefel, J.S.; Ahles, T.; Tannock, I.F.; Schagen, S.B. Cancer and cancer-therapy related cognitive dysfunction: An international perspective from the Venice cognitive workshop. Ann. Oncol. 2008, 19, 623–629. [Google Scholar] [CrossRef] [PubMed]
- Wefel, J.S.; Lenzi, R.; Theriault, R.; Buzdar, A.U.; Cruickshank, S.; Meyers, C.A. ‘Chemobrain’ in breast carcinoma?: A prologue. Cancer 2004, 101, 466–475. [Google Scholar] [CrossRef]
- Oberste, M.; Schaffrath, N.; Schmidt, K.; Bloch, W.; Jager, E.; Steindorf, K.; Hartig, P.; Joisten, N.; Zimmer, P. Protocol for the “Chemobrain in Motion—Study” (CIM—Study): A randomized placebo-controlled trial of the impact of a high-intensity interval endurance training on cancer related cognitive impairments in women with breast cancer receiving first-line chemotherapy. BMC Cancer 2018, 18, 1071. [Google Scholar] [CrossRef] [Green Version]
- Horowitz, T.S.; Suls, J.; Trevino, M. A Call for a Neuroscience Approach to Cancer-Related Cognitive Impairment. Trends Neurosci. 2018, 41, 493–496. [Google Scholar] [CrossRef]
- Wefel, J.S.; Kesler, S.R.; Noll, K.R.; Schagen, S.B. Clinical characteristics, pathophysiology, and management of noncentral nervous system cancer-related cognitive impairment in adults. CA Cancer J. Clin. 2015, 65, 123–138. [Google Scholar] [CrossRef] [Green Version]
- Silberfarb, P.M. Chemotherapy and cognitive defects in cancer patients. Annu. Rev. Med. 1983, 34, 35–46. [Google Scholar] [CrossRef]
- Ahles, T.A.; Saykin, A.J.; Furstenberg, C.T.; Cole, B.; Mott, L.A.; Skalla, K.; Whedon, M.B.; Bivens, S.; Mitchell, T.; Greenberg, E.R.; et al. Neuropsychologic impact of standard-dose systemic chemotherapy in long-term survivors of breast cancer and lymphoma. J. Clin. Oncol. 2002, 20, 485–493. [Google Scholar] [CrossRef]
- Ahles, T.A.; Silberfarb, P.M.; Herndon, J., 2nd; Maurer, L.H.; Kornblith, A.B.; Aisner, J.; Perry, M.C.; Eaton, W.L.; Zacharski, L.L.; Green, M.R.; et al. Psychologic and neuropsychologic functioning of patients with limited small-cell lung cancer treated with chemotherapy and radiation therapy with or without warfarin: A study by the Cancer and Leukemia Group B. J. Clin. Oncol. 1998, 16, 1954–1960. [Google Scholar] [CrossRef]
- Mitchell, T.; Turton, P. ‘Chemobrain’: Concentration and memory effects in people receiving chemotherapy—A descriptive phenomenological study. Eur. J. Cancer Care 2011, 20, 539–548. [Google Scholar] [CrossRef]
- Alhowail, A.H.; Aldubayan, M. Recent progress in the elucidation of the mechanisms of chemotherapy-induced cognitive impairment. Eur. Rev. Med. Pharmacol. Sci. 2021, 25, 5807–5817. [Google Scholar] [CrossRef]
- Sparano, J.A.; Wang, M.; Martino, S.; Jones, V.; Perez, E.A.; Saphner, T.; Wolff, A.C.; Sledge, G.W., Jr.; Wood, W.C.; Davidson, N.E. Weekly paclitaxel in the adjuvant treatment of breast cancer. N. Engl. J. Med. 2008, 358, 1663–1671. [Google Scholar] [CrossRef]
- McGowan, J.V.; Chung, R.; Maulik, A.; Piotrowska, I.; Walker, J.M.; Yellon, D.M. Anthracycline Chemotherapy and Cardiotoxicity. Cardiovasc. Drugs Ther. 2017, 31, 63–75. [Google Scholar] [CrossRef] [Green Version]
- Ramalho, M.; Fontes, F.; Ruano, L.; Pereira, S.; Lunet, N. Cognitive impairment in the first year after breast cancer diagnosis: A prospective cohort study. Breast 2017, 32, 173–178. [Google Scholar] [CrossRef] [Green Version]
- John, T.; Lomeli, N.; Bota, D.A. Systemic cisplatin exposure during infancy and adolescence causes impaired cognitive function in adulthood. Behav. Brain Res. 2017, 319, 200–206. [Google Scholar] [CrossRef] [Green Version]
- Deprez, S.; Amant, F.; Smeets, A.; Peeters, R.; Leemans, A.; Van Hecke, W.; Verhoeven, J.S.; Christiaens, M.R.; Vandenberghe, J.; Vandenbulcke, M.; et al. Longitudinal assessment of chemotherapy-induced structural changes in cerebral white matter and its correlation with impaired cognitive functioning. J. Clin. Oncol. 2012, 30, 274–281. [Google Scholar] [CrossRef] [Green Version]
- Dietrich, J.; Prust, M.; Kaiser, J. Chemotherapy, cognitive impairment and hippocampal toxicity. Neuroscience 2015, 309, 224–232. [Google Scholar] [CrossRef]
- Lyman, M.; Lloyd, D.G.; Ji, X.; Vizcaychipi, M.P.; Ma, D. Neuroinflammation: The role and consequences. Neurosci. Res. 2014, 79, 1–12. [Google Scholar] [CrossRef]
- Gorelick, P.B. Role of inflammation in cognitive impairment: Results of observational epidemiological studies and clinical trials. Ann. N. Y. Acad. Sci. 2010, 1207, 155–162. [Google Scholar] [CrossRef]
- Ongnok, B.; Chattipakorn, N.; Chattipakorn, S.C. Doxorubicin and cisplatin induced cognitive impairment: The possible mechanisms and interventions. Exp. Neurol. 2020, 324, 113118. [Google Scholar] [CrossRef]
- Morales-Garcia, J.A.; Luna-Medina, R.; Alfaro-Cervello, C.; Cortes-Canteli, M.; Santos, A.; Garcia-Verdugo, J.M.; Perez-Castillo, A. Peroxisome proliferator-activated receptor gamma ligands regulate neural stem cell proliferation and differentiation in vitro and in vivo. Glia 2011, 59, 293–307. [Google Scholar] [CrossRef] [Green Version]
- Sarruf, D.A.; Yu, F.; Nguyen, H.T.; Williams, D.L.; Printz, R.L.; Niswender, K.D.; Schwartz, M.W. Expression of peroxisome proliferator-activated receptor-gamma in key neuronal subsets regulating glucose metabolism and energy homeostasis. Endocrinology 2009, 150, 707–712. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- He, C.; Qu, X.; Cui, L.; Wang, J.; Kang, J.X. Improved spatial learning performance of fat-1 mice is associated with enhanced neurogenesis and neuritogenesis by docosahexaenoic acid. Proc. Natl. Acad. Sci. USA 2009, 106, 11370–11375. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Moreno, S.; Farioli-Vecchioli, S.; Ceru, M.P. Immunolocalization of peroxisome proliferator-activated receptors and retinoid X receptors in the adult rat CNS. Neuroscience 2004, 123, 131–145. [Google Scholar] [CrossRef] [PubMed]
- Xing, B.; Liu, M.; Bing, G. Neuroprotection with pioglitazone against LPS insult on dopaminergic neurons may be associated with its inhibition of NF-kappaB and JNK activation and suppression of COX-2 activity. J. Neuroimmunol. 2007, 192, 89–98. [Google Scholar] [CrossRef]
- Swanson, C.R.; Joers, V.; Bondarenko, V.; Brunner, K.; Simmons, H.A.; Ziegler, T.E.; Kemnitz, J.W.; Johnson, J.A.; Emborg, M.E. The PPAR-gamma agonist pioglitazone modulates inflammation and induces neuroprotection in parkinsonian monkeys. J. Neuroinflammation 2011, 8, 91. [Google Scholar] [CrossRef] [Green Version]
- Kumar, P.; Kaundal, R.K.; More, S.; Sharma, S.S. Beneficial effects of pioglitazone on cognitive impairment in MPTP model of Parkinson’s disease. Behav. Brain Res. 2009, 197, 398–403. [Google Scholar] [CrossRef]
- Chang, K.L.; Pee, H.N.; Yang, S.; Ho, P.C. Influence of drug transporters and stereoselectivity on the brain penetration of pioglitazone as a potential medicine against Alzheimer’s disease. Sci. Rep. 2015, 5, 9000. [Google Scholar] [CrossRef] [Green Version]
- Takechi, R.; Lam, V.; Brook, E.; Giles, C.; Fimognari, N.; Mooranian, A.; Al-Salami, H.; Coulson, S.H.; Nesbit, M.; Mamo, J.C.L. Blood-Brain Barrier Dysfunction Precedes Cognitive Decline and Neurodegeneration in Diabetic Insulin Resistant Mouse Model: An Implication for Causal Link. Front. Aging Neurosci. 2017, 9, 399. [Google Scholar] [CrossRef] [Green Version]
- Liu, M.; Bachstetter, A.D.; Cass, W.A.; Lifshitz, J.; Bing, G. Pioglitazone Attenuates Neuroinflammation and Promotes Dopaminergic Neuronal Survival in the Nigrostriatal System of Rats after Diffuse Brain Injury. J. Neurotrauma 2017, 34, 414–422. [Google Scholar] [CrossRef]
- Wang, Y.; Zhao, W.; Li, G.; Chen, J.; Guan, X.; Chen, X.; Guan, Z. Neuroprotective Effect and Mechanism of Thiazolidinedione on Dopaminergic Neurons In Vivo and In Vitro in Parkinson’s Disease. PPAR Res. 2017, 2017, 4089214. [Google Scholar] [CrossRef] [Green Version]
- Sato, T.; Hanyu, H.; Hirao, K.; Kanetaka, H.; Sakurai, H.; Iwamoto, T. Efficacy of PPAR-gamma agonist pioglitazone in mild Alzheimer disease. Neurobiol. Aging 2011, 32, 1626–1633. [Google Scholar] [CrossRef]
- Quan, Q.; Qian, Y.; Li, X.; Li, M. Pioglitazone Reduces β Amyloid Levels via Inhibition of PPARγ Phosphorylation in a Neuronal Model of Alzheimer’s Disease. Front. Aging Neurosci. 2019, 11, 178. [Google Scholar] [CrossRef] [Green Version]
- Heneka, M.T.; Sastre, M.; Dumitrescu-Ozimek, L.; Hanke, A.; Dewachter, I.; Kuiperi, C.; O’Banion, K.; Klockgether, T.; Van Leuven, F.; Landreth, G.E. Acute treatment with the PPARγ agonist pioglitazone and ibuprofen reduces glial inflammation and Aβ1–42 levels in APPV717I transgenic mice. Brain 2005, 128, 1442–1453. [Google Scholar] [CrossRef] [Green Version]
- Alhowail, A.; Alsikhan, R.; Alsaud, M.; Aldubayan, M.; Rabbani, S.I. Protective Effects of Pioglitazone on Cognitive Impairment and the Underlying Mechanisms: A Review of Literature. Drug. Des. Dev. Ther. 2022, 16, 2919–2931. [Google Scholar] [CrossRef]
- Morellini, F. Spatial memory tasks in rodents: What do they model? Cell. Tissue Res. 2013, 354, 273–286. [Google Scholar] [CrossRef]
- Hughes, R.N. The value of spontaneous alternation behavior (SAB) as a test of retention in pharmacological investigations of memory. Neurosci. Biobehav. Rev. 2004, 28, 497–505. [Google Scholar] [CrossRef] [PubMed]
- Ennaceur, A.; Delacour, J. A new one-trial test for neurobiological studies of memory in rats. 1: Behavioral data. Behav. Brain Res. 1988, 31, 47–59. [Google Scholar] [CrossRef]
- Carobrez, A.P.; Bertoglio, L.J. Ethological and temporal analyses of anxiety-like behavior: The elevated plus-maze model 20 years on. Neurosci. Biobehav. Rev. 2005, 29, 1193–1205. [Google Scholar] [CrossRef]
- Pellow, S.; File, S.E. Anxiolytic and anxiogenic drug effects on exploratory activity in an elevated plus-maze: A novel test of anxiety in the rat. Pharm. Biochem. Behav. 1986, 24, 525–529. [Google Scholar] [CrossRef] [PubMed]
- Handley, S.L.; Mithani, S. Effects of alpha-adrenoceptor agonists and antagonists in a maze-exploration model of ‘fear’-motivated behaviour. Naunyn Schmiedebergs Arch. Pharm. 1984, 327, 1–5. [Google Scholar] [CrossRef]
- Vasudevan, M.; Parle, M. Pharmacological actions of Thespesia populnea relevant to Alzheimer’s disease. Phytomedicine 2006, 13, 677–687. [Google Scholar] [CrossRef] [PubMed]
- Komada, M.; Takao, K.; Miyakawa, T. Elevated plus maze for mice. J. Vis. Exp. 2008, 22, e1088. [Google Scholar] [CrossRef] [Green Version]
- Smith, P.K.; Krohn, R.I.; Hermanson, G.T.; Mallia, A.K.; Gartner, F.H.; Provenzano, M.D.; Fujimoto, E.K.; Goeke, N.M.; Olson, B.J.; Klenk, D.C. Measurement of protein using bicinchoninic acid. Anal. Biochem. 1985, 150, 76–85. [Google Scholar] [CrossRef]
- Fanselow, M.S.; Dong, H.-W. Are the Dorsal and Ventral Hippocampus Functionally Distinct Structures? Neuron 2010, 65, 7–19. [Google Scholar] [CrossRef] [Green Version]
- Anwar, M.J.; Pillai, K.K.; Khanam, R.; Akhtar, M.; Vohora, D. Effect of alprazolam on anxiety and cardiomyopathy induced by doxorubicin in mice. Fundam. Clin. Pharm. 2012, 26, 356–362. [Google Scholar] [CrossRef]
- McEwen, B.S. In pursuit of resilience: Stress, epigenetics, and brain plasticity. Ann. N. Y. Acad. Sci. 2016, 1373, 56–64. [Google Scholar] [CrossRef]
- Beheshti, F.; Hosseini, M.; Hashemzehi, M.; Soukhtanloo, M.; Asghari, A. The effects of PPAR-γ agonist pioglitazone on anxiety and depression-like behaviors in lipopolysaccharide injected rats. Toxin Rev. 2021, 40, 1223–1232. [Google Scholar] [CrossRef]
- van der Willik, K.D.; Koppelmans, V.; Hauptmann, M.; Compter, A.; Ikram, M.A.; Schagen, S.B. Inflammation markers and cognitive performance in breast cancer survivors 20 years after completion of chemotherapy: A cohort study. Breast Cancer Res. 2018, 20, 135. [Google Scholar] [CrossRef] [Green Version]
- Ren, X.; St Clair, D.K.; Butterfield, D.A. Dysregulation of cytokine mediated chemotherapy induced cognitive impairment. Pharm. Res. 2017, 117, 267–273. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.; Zhao, Y.; Wang, L.; Pan, S.; Liu, Y.; Li, S.; Wang, D. C-phycocyanin Mitigates Cognitive Impairment in Doxorubicin-Induced Chemobrain: Impact on Neuroinflammation, Oxidative Stress, and Brain Mitochondrial and Synaptic Alterations. Neurochem. Res. 2021, 46, 149–158. [Google Scholar] [CrossRef]
- Combs, C.K.; Johnson, D.E.; Karlo, J.C.; Cannady, S.B.; Landreth, G.E. Inflammatory mechanisms in Alzheimer’s disease: Inhibition of beta-amyloid-stimulated proinflammatory responses and neurotoxicity by PPARgamma agonists. J. Neurosci. 2000, 20, 558–567. [Google Scholar] [CrossRef] [Green Version]
- Gupta, R.; Gupta, L.K. Improvement in long term and visuo-spatial memory following chronic pioglitazone in mouse model of Alzheimer’s disease. Pharm. Biochem. Behav. 2012, 102, 184–190. [Google Scholar] [CrossRef]
Gene | Primer Sequence (5′–3′) | Length/bp |
---|---|---|
TNF-α FWD | ACCTTATCTACTCCCAGGTTCT | 87 |
TNF-α REV | GGCTGACTTTCTCCTGGTATG | |
IL6 FWD | GCCAGAGTCATTCAGAGCAATA | 87 |
IL6 REV | TTAGGAGAGCATTGGAAGTTGG | |
GAPDH FWD | ACTCCCATTCTTCCACCTTTG | 104 |
GAPDH REV | CCCTGTTGCTGTAGCCATATT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Alsaud, M.M.; Alhowail, A.H.; Aldubayan, M.A.; Almami, I.S. The Ameliorative Effect of Pioglitazone against Neuroinflammation Caused by Doxorubicin in Rats. Molecules 2023, 28, 4775. https://doi.org/10.3390/molecules28124775
Alsaud MM, Alhowail AH, Aldubayan MA, Almami IS. The Ameliorative Effect of Pioglitazone against Neuroinflammation Caused by Doxorubicin in Rats. Molecules. 2023; 28(12):4775. https://doi.org/10.3390/molecules28124775
Chicago/Turabian StyleAlsaud, May M., Ahmad H. Alhowail, Maha A. Aldubayan, and Ibtesam S. Almami. 2023. "The Ameliorative Effect of Pioglitazone against Neuroinflammation Caused by Doxorubicin in Rats" Molecules 28, no. 12: 4775. https://doi.org/10.3390/molecules28124775