Stretch-Induced Down-Regulation of HCN2 Suppresses Contractile Activity
Abstract
1. Introduction
2. Results
2.1. Effects of HCN Inhibition on Spontaneous Contractile Activity
2.2. Effects of HCN Inhibition on Agonist-Induced Contractile Activity
2.3. Impact of Inflammation on the Effects of HCN Inhibition
2.4. Impact of Stretch on the Effects of HCN Inhibition
2.5. Cell-Specific Mechanotransduction Effects on HCN2 Expression
3. Materials and Methods
3.1. Materials
3.2. Contractile Activity
3.3. Cells
3.4. Cell Stretching Protocols
3.5. Macrophage-Conditioned Media
3.6. Western Blot
3.7. Reverse Transcriptase Quantitative PCR
3.8. Statistical Analyses
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Sample Availability
References
- Grocott, M.P.; Browne, J.P.; Van der Meulen, J.; Matejowsky, C.; Mutch, M.; Hamilton, M.A.; Levett, D.Z.; Emberton, M.; Haddad, F.S.; Mythen, M.G. The Postoperative Morbidity Survey was validated and used to describe morbidity after major surgery. J. Clin. Epidemiol. 2007, 60, 919–928. [Google Scholar] [CrossRef] [PubMed]
- Virani, F.R.; Peery, T.; Rivas, O.; Tomasek, J.; Huerta, R.; Wade, C.E.; Lee, J.; Holcomb, J.B.; Uray, K. Incidence and Effects of Feeding Intolerance in Trauma Patients. JPEN J. Parenter. Enter. Nutr. 2019, 43, 742–749. [Google Scholar] [CrossRef] [PubMed]
- Blaser, A.R.; Starkopf, J.; Kirsimagi, U.; Deane, A.M. Definition, prevalence, and outcome of feeding intolerance in intensive care: A systematic review and meta-analysis. Acta Anaesthesiol. Scand. 2014, 58, 914–922. [Google Scholar] [CrossRef] [PubMed]
- Kassin, M.T.; Owen, R.M.; Perez, S.D.; Leeds, I.; Cox, J.C.; Schnier, K.; Sadiraj, V.; Sweeney, J.F. Risk factors for 30-day hospital readmission among general surgery patients. J. Am. Coll. Surg. 2012, 215, 322–330. [Google Scholar] [CrossRef]
- Solanki, S.; Chakinala, R.C.; Haq, K.F.; Singh, J.; Khan, M.A.; Solanki, D.; Vyas, M.J.; Kichloo, A.; Mansuri, U.; Shah, H.; et al. Paralytic ileus in the United States: A cross-sectional study from the national inpatient sample. SAGE Open Med. 2020, 8, 2050312120962636. [Google Scholar] [CrossRef]
- Livingston, E.H.; Passaro, E.P., Jr. Postoperative ileus. Dig. Dis. Sci. 1990, 35, 121–132. [Google Scholar] [CrossRef]
- Merkow, R.P.; Shan, Y.; Gupta, A.R.; Yang, A.D.; Sama, P.; Schumacher, M.; Cooke, D.; Barnard, C.; Bilimoria, K.Y. A Comprehensive Estimation of the Costs of 30-Day Postoperative Complications Using Actual Costs from Multiple, Diverse Hospitals. Jt. Comm. J. Qual. Patient Saf. 2020, 46, 558–564. [Google Scholar] [CrossRef]
- Senagore, A.J. Pathogenesis and clinical and economic consequences of postoperative ileus. Clin. Exp. Gastroenterol. 2010, 3, 87–89. [Google Scholar] [CrossRef]
- Asgeirsson, T.; El-Badawi, K.I.; Mahmood, A.; Barletta, J.; Luchtefeld, M.; Senagore, A.J. Postoperative ileus: It costs more than you expect. J. Am. Coll. Surg. 2010, 210, 228–231. [Google Scholar] [CrossRef]
- Bauer, A.J.; Schwarz, N.T.; Moore, B.A.; Turler, A.; Kalff, J.C. Ileus in critical illness: Mechanisms and management. Curr. Opin. Crit. Care 2002, 8, 152–157. [Google Scholar] [CrossRef]
- Docsa, T.; Bhattarai, D.; Sipos, A.; Wade, C.E.; Cox, C.S., Jr.; Uray, K. CXCL1 is upregulated during the development of ileus resulting in decreased intestinal contractile activity. Neurogastroenterol. Motil. 2020, 32, e13757. [Google Scholar] [CrossRef] [PubMed]
- Engel, D.R.; Koscielny, A.; Wehner, S.; Maurer, J.; Schiwon, M.; Franken, L.; Schumak, B.; Limmer, A.; Sparwasser, T.; Hirner, A.; et al. T helper type 1 memory cells disseminate postoperative ileus over the entire intestinal tract. Nat. Med. 2010, 16, 1407–1413. [Google Scholar] [CrossRef]
- Hupa, K.J.; Stein, K.; Schneider, R.; Lysson, M.; Schneiker, B.; Hornung, V.; Latz, E.; Iwakura, Y.; Kalff, J.C.; Wehner, S. AIM2 inflammasome-derived IL-1beta induces postoperative ileus in mice. Sci. Rep. 2019, 9, 10602. [Google Scholar] [CrossRef] [PubMed]
- Wehner, S.; Behrendt, F.F.; Lyutenski, B.N.; Lysson, M.; Bauer, A.J.; Hirner, A.; Kalff, J.C. Inhibition of macrophage function prevents intestinal inflammation and postoperative ileus in rodents. Gut 2007, 56, 176–185. [Google Scholar] [CrossRef] [PubMed]
- Chu, J.; Miller, C.T.; Kislitsyna, K.; Laine, G.A.; Stewart, R.H.; Cox, C.S.; Uray, K.S. Decreased myosin phosphatase target subunit 1(MYPT1) phosphorylation via attenuated rho kinase and zipper-interacting kinase activities in edematous intestinal smooth muscle. Neurogastroenterol. Motil. 2012, 24, 257-e109. [Google Scholar] [CrossRef]
- Chu, J.; Pham, N.T.; Olate, N.; Kislitsyna, K.; Day, M.C.; LeTourneau, P.A.; Kots, A.; Stewart, R.H.; Laine, G.A.; Cox, C.S., Jr.; et al. Biphasic regulation of myosin light chain phosphorylation by p21-activated kinase modulates intestinal smooth muscle contractility. J. Biol. Chem. 2013, 288, 1200–1213. [Google Scholar] [CrossRef]
- Uray, K.S.; Laine, G.A.; Xue, H.; Allen, S.J.; Cox, C.S., Jr. Intestinal edema decreases intestinal contractile activity via decreased myosin light chain phosphorylation. Crit. Care Med. 2006, 34, 2630–2637. [Google Scholar] [CrossRef] [PubMed]
- Uray, K.S.; Shah, S.K.; Radhakrishnan, R.S.; Jimenez, F.; Walker, P.A.; Stewart, R.H.; Laine, G.A.; Cox, C.S., Jr. Sodium hydrogen exchanger as a mediator of hydrostatic edema-induced intestinal contractile dysfunction. Surgery 2011, 149, 114–125. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Uray, K.S.; Wright, Z.; Kislitsyna, K.; Xue, H.; Cox, C.S., Jr. Nuclear factor-kappaB activation by edema inhibits intestinal contractile activity. Crit. Care Med. 2010, 38, 861–870. [Google Scholar] [CrossRef]
- Radhakrishnan, R.S.; Xue, H.; Weisbrodt, N.; Moore, F.A.; Allen, S.J.; Laine, G.A.; Cox, C.S., Jr. Resuscitation-induced intestinal edema decreases the stiffness and residual stress of the intestine. Shock 2005, 24, 165–170. [Google Scholar] [CrossRef]
- Uray, K.S.; Laine, G.A.; Xue, H.; Allen, S.J.; Cox, C.S., Jr. Edema-induced intestinal dysfunction is mediated by STAT3 activation. Shock 2007, 28, 239–244. [Google Scholar] [CrossRef] [PubMed]
- Brown, H.; Difrancesco, D. Voltage-clamp investigations of membrane currents underlying pace-maker activity in rabbit sino-atrial node. J. Physiol. 1980, 308, 331–351. [Google Scholar] [CrossRef] [PubMed]
- DiFrancesco, D.; Ferroni, A.; Mazzanti, M.; Tromba, C. Properties of the hyperpolarizing-activated current (if) in cells isolated from the rabbit sino-atrial node. J. Physiol. 1986, 377, 61–88. [Google Scholar] [CrossRef]
- Pape, H.C.; McCormick, D.A. Noradrenaline and serotonin selectively modulate thalamic burst firing by enhancing a hyperpolarization-activated cation current. Nature 1989, 340, 715–718. [Google Scholar] [CrossRef] [PubMed]
- Greenwood, I.A.; Prestwich, S.A. Characteristics of hyperpolarization-activated cation currents in portal vein smooth muscle cells. Am. J. Physiology. Cell Physiol. 2002, 282, C744–C753. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Guo, T.; Li, J.; Li, J.; Kong, D.; Bi, C.; He, Z.; Tang, D.; Jin, X.; Jin, L. Association between hyperpolarization-activated channel in interstitial cells of Cajal and gastrointestinal dysmotility induced by malignant ascites. Oncol. Lett. 2017, 13, 1601–1608. [Google Scholar] [CrossRef][Green Version]
- Mader, F.; Muller, S.; Krause, L.; Springer, A.; Kernig, K.; Protzel, C.; Porath, K.; Rackow, S.; Wittstock, T.; Frank, M.; et al. Hyperpolarization-Activated Cyclic Nucleotide-Gated Non-selective (HCN) Ion Channels Regulate Human and Murine Urinary Bladder Contractility. Front. Physiol. 2018, 9, 753. [Google Scholar] [CrossRef]
- Xiao, J.; Nguyen, T.V.; Ngui, K.; Strijbos, P.J.; Selmer, I.S.; Neylon, C.B.; Furness, J.B. Molecular and functional analysis of hyperpolarisation-activated nucleotide-gated (HCN) channels in the enteric nervous system. Neuroscience 2004, 129, 603–614. [Google Scholar] [CrossRef]
- Benzoni, P.; Bertoli, G.; Giannetti, F.; Piantoni, C.; Milanesi, R.; Pecchiari, M.; Barbuti, A.; Baruscotti, M.; Bucchi, A. The funny current: Even funnier than 40 years ago. Uncanonical expression and roles of HCN/f channels all over the body. Prog. Biophys. Mol. Biol. 2021, 166, 189–204. [Google Scholar] [CrossRef]
- Sartiani, L.; Mannaioni, G.; Masi, A.; Novella Romanelli, M.; Cerbai, E. The Hyperpolarization-Activated Cyclic Nucleotide-Gated Channels: From Biophysics to Pharmacology of a Unique Family of Ion Channels. Pharmacol. Rev. 2017, 69, 354–395. [Google Scholar] [CrossRef]
- Fisher, D.W.; Luu, P.; Agarwal, N.; Kurz, J.E.; Chetkovich, D.M. Loss of HCN2 leads to delayed gastrointestinal motility and reduced energy intake in mice. PLoS ONE 2018, 13, e0193012. [Google Scholar] [CrossRef] [PubMed]
- Ludwig, A.; Budde, T.; Stieber, J.; Moosmang, S.; Wahl, C.; Holthoff, K.; Langebartels, A.; Wotjak, C.; Munsch, T.; Zong, X.; et al. Absence epilepsy and sinus dysrhythmia in mice lacking the pacemaker channel HCN2. EMBO J. 2003, 22, 216–224. [Google Scholar] [CrossRef]
- Yang, S.; Xiong, C.J.; Sun, H.M.; Li, X.S.; Zhang, G.Q.; Wu, B.; Zhou, D.S. The distribution of HCN2-positive cells in the gastrointestinal tract of mice. J. Anat. 2012, 221, 303–310. [Google Scholar] [CrossRef] [PubMed]
- Kola, J.B.; Docsa, T.; Uray, K. Mechanosensing in the Physiology and Pathology of the Gastrointestinal Tract. Int. J. Mol. Sci. 2022, 24, 177. [Google Scholar] [CrossRef] [PubMed]
- Zhu, C.; Gong, H.; Luo, P.; Dong, L.; Zhang, G.; Shi, X.; Rong, W. Oral Administration of Penicillin or Streptomycin May Alter Serum Serotonin Level and Intestinal Motility via Different Mechanisms. Front. Physiol. 2020, 11, 605982. [Google Scholar] [CrossRef]
- Chan, C.S.; Glajch, K.E.; Gertler, T.S.; Guzman, J.N.; Mercer, J.N.; Lewis, A.S.; Goldberg, A.B.; Tkatch, T.; Shigemoto, R.; Fleming, S.M.; et al. HCN channelopathy in external globus pallidus neurons in models of Parkinson’s disease. Nat. Neurosci. 2011, 14, 85–92. [Google Scholar] [CrossRef] [PubMed]
- Tu, H.; Zhang, L.; Tran, T.P.; Muelleman, R.L.; Li, Y.L. Diabetes alters protein expression of hyperpolarization-activated cyclic nucleotide-gated channel subunits in rat nodose ganglion cells. Neuroscience 2010, 165, 39–52. [Google Scholar] [CrossRef]
- Ogut, O.; Brozovich, F.V. Regulation of force in vascular smooth muscle. J. Mol. Cell. Cardiol. 2003, 35, 347–355. [Google Scholar] [CrossRef]
- Sward, K.; Dreja, K.; Susnjar, M.; Hellstrand, P.; Hartshorne, D.J.; Walsh, M.P. Inhibition of Rho-associated kinase blocks agonist-induced Ca2+ sensitization of myosin phosphorylation and force in guinea-pig ileum. J. Physiol. 2000, 522 Pt 1, 33–49. [Google Scholar] [CrossRef]
- Al-Jarallah, A.; Khan, I.; Oriowo, M.A. Role of Ca2+-sensitization in attenuated carbachol-induced contraction of the colon in a rat model of colitis. Eur. J. Pharmacol. 2008, 579, 365–373. [Google Scholar] [CrossRef]
- Yu, X.; Chen, X.W.; Zhou, P.; Yao, L.; Liu, T.; Zhang, B.; Li, Y.; Zheng, H.; Zheng, L.H.; Zhang, C.X.; et al. Calcium influx through If channels in rat ventricular myocytes. Am. J. Physiol. Cell Physiol. 2007, 292, C1147–C1155. [Google Scholar] [CrossRef]
- Lin, Y.C.; Huang, J.; Zhang, Q.; Hollander, J.M.; Frisbee, J.C.; Martin, K.H.; Nestor, C.; Goodman, R.; Yu, H.G. Inactivation of L-type calcium channel modulated by HCN2 channel. Am. J. Physiol. Cell Physiol. 2010, 298, C1029–C1037. [Google Scholar] [CrossRef] [PubMed]
- Sato, K.; Sanders, K.M.; Gerthoffer, W.T.; Publicover, N.G. Sources of calcium utilized in cholinergic responses in canine colonic smooth muscle. Am. J. Physiol. 1994, 267, C1666–C1673. [Google Scholar] [CrossRef] [PubMed]
- Wainger, B.J.; DeGennaro, M.; Santoro, B.; Siegelbaum, S.A.; Tibbs, G.R. Molecular mechanism of cAMP modulation of HCN pacemaker channels. Nature 2001, 411, 805–810. [Google Scholar] [CrossRef] [PubMed]
- Huang, H.; Zhang, Z.; Huang, D. Decreased HCN2 channel expression attenuates neuropathic pain by inhibiting pro-inflammatory reactions and NF-kappaB activation in mice. Int. J. Clin. Exp. Pathol. 2019, 12, 154–163. [Google Scholar] [PubMed]
- Docsa, T.; Sipos, A.; Cox, C.S.; Uray, K. The Role of Inflammatory Mediators in the Development of Gastrointestinal Motility Disorders. Int. J. Mol. Sci. 2022, 23, 6917. [Google Scholar] [CrossRef]
- Santoro, B.; Shah, M.M. Hyperpolarization-Activated Cyclic Nucleotide-Gated Channels as Drug Targets for Neurological Disorders. Annu. Rev. Pharmacol. Toxicol. 2020, 60, 109–131. [Google Scholar] [CrossRef]
- Vay, S.U.; Flitsch, L.J.; Rabenstein, M.; Moniere, H.; Jakovcevski, I.; Andjus, P.; Bijelic, D.; Blaschke, S.; Walter, H.L.; Fink, G.R.; et al. The impact of hyperpolarization-activated cyclic nucleotide-gated (HCN) and voltage-gated potassium KCNQ/Kv7 channels on primary microglia function. J. Neuroinflamm. 2020, 17, 100. [Google Scholar] [CrossRef]
- Peters, C.H.; Singh, R.K.; Bankston, J.R.; Proenza, C. Regulation of HCN Channels by Protein Interactions. Front. Physiol. 2022, 13, 928507. [Google Scholar] [CrossRef]
- Parker, A.R.; Welch, M.A.; Forster, L.A.; Tasneem, S.M.; Dubhashi, J.A.; Baro, D.J. SUMOylation of the Hyperpolarization-Activated Cyclic Nucleotide-Gated Channel 2 Increases Surface Expression and the Maximal Conductance of the Hyperpolarization-Activated Current. Front. Mol. Neurosci. 2016, 9, 168. [Google Scholar] [CrossRef]
- Heo, K.S.; Lee, H.; Nigro, P.; Thomas, T.; Le, N.T.; Chang, E.; McClain, C.; Reinhart-King, C.A.; King, M.R.; Berk, B.C.; et al. PKCzeta mediates disturbed flow-induced endothelial apoptosis via p53 SUMOylation. J. Cell Biol. 2011, 193, 867–884. [Google Scholar] [CrossRef] [PubMed]
- Velatooru, L.R.; Abe, R.J.; Imanishi, M.; Gi, Y.J.; Ko, K.A.; Heo, K.S.; Fujiwara, K.; Le, N.T.; Kotla, S. Disturbed flow-induced FAK K152 SUMOylation initiates the formation of pro-inflammation positive feedback loop by inducing reactive oxygen species production in endothelial cells. Free Radic. Biol. Med. 2021, 177, 404–418. [Google Scholar] [CrossRef] [PubMed]
- Calloe, K.; Elmedyb, P.; Olesen, S.P.; Jorgensen, N.K.; Grunnet, M. Hypoosmotic cell swelling as a novel mechanism for modulation of cloned HCN2 channels. Biophys. J. 2005, 89, 2159–2169. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Acosta, C.; McMullan, S.; Djouhri, L.; Gao, L.; Watkins, R.; Berry, C.; Dempsey, K.; Lawson, S.N. HCN1 and HCN2 in Rat DRG neurons: Levels in nociceptors and non-nociceptors, NT3-dependence and influence of CFA-induced skin inflammation on HCN2 and NT3 expression. PLoS ONE 2012, 7, e50442. [Google Scholar] [CrossRef] [PubMed]
- Jansen, L.R.; Forster, L.A.; Smith, X.L.; Rubaharan, M.; Murphy, A.Z.; Baro, D.J. Changes in peripheral HCN2 channels during persistent inflammation. Channels 2021, 15, 165–179. [Google Scholar] [CrossRef]





| Primer/Probe/sAmp | Primer Sequence |
|---|---|
| hHCN2+ | ATCCACCCGTACAGCGACTT |
| hHCN2− | GATGAGGTTTCCCACCATGAA |
| h/mHCN2 probe | AGGTTCTACTGGGACTTCACCATGCTGCT |
| hHCN2 sAmp | CATCCACCCGTACAGCGACTTCAGGTTCTACTGGGACTTCACCATGCTGCTGTTCATGGTGGGAAACCTCATCA |
| mHCN2+ | CATCCACCCCTACAGCGACTT |
| mHCN2− | CCCACGGGAATGATAATGAGA |
| mHCN2 sAmp | TCATCCACCCCTACAGCGACTTCAGGTTCTACTGGGACTTCACCATGCTGCTGTTCATGGTGGGAAATCTCATTATCATTCCCGTGGGC |
| mCyclophilin+ | CGA TGA CGA GCC CTT GG |
| mCyclophilin− | TCT GCT GTC TTT GGA ACT TTG TC |
| mCyclophilin probe | CGC GTC TCC TTC GAG CTG TTT GCA |
| mCyclophilin sAmp | CGATGACGAGCCCTTGGGCCGCGTCTCCTTCGAGCTGTTTGCAGACAAAGTTCCAAAGACAGCAGA |
| hB-actin+ | CCC TGG CAC CCA GCA C |
| hB-actin− | GCC GAT CCA CAC GGA GTA C |
| hB-actin probe | ATC AAG ATC ATT GCT CCT CCT GAG CGC |
| hB-actin sAmp | TGC CCT GGC ACC CAG CAC AAT GAA GAT CAA GAT CAT TGC TCC TCC TGA GCG CAA GTA CTC CGT GTG GAT CGG CGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kola, J.B.; Turarova, B.; Csige, D.; Sipos, Á.; Varga, L.; Gergely, B.; Refai, F.A.; Uray, I.P.; Docsa, T.; Uray, K. Stretch-Induced Down-Regulation of HCN2 Suppresses Contractile Activity. Molecules 2023, 28, 4359. https://doi.org/10.3390/molecules28114359
Kola JB, Turarova B, Csige D, Sipos Á, Varga L, Gergely B, Refai FA, Uray IP, Docsa T, Uray K. Stretch-Induced Down-Regulation of HCN2 Suppresses Contractile Activity. Molecules. 2023; 28(11):4359. https://doi.org/10.3390/molecules28114359
Chicago/Turabian StyleKola, Job Baffin, Botagoz Turarova, Dora Csige, Ádám Sipos, Luca Varga, Bence Gergely, Farah Al Refai, Iván P. Uray, Tibor Docsa, and Karen Uray. 2023. "Stretch-Induced Down-Regulation of HCN2 Suppresses Contractile Activity" Molecules 28, no. 11: 4359. https://doi.org/10.3390/molecules28114359
APA StyleKola, J. B., Turarova, B., Csige, D., Sipos, Á., Varga, L., Gergely, B., Refai, F. A., Uray, I. P., Docsa, T., & Uray, K. (2023). Stretch-Induced Down-Regulation of HCN2 Suppresses Contractile Activity. Molecules, 28(11), 4359. https://doi.org/10.3390/molecules28114359

