Beneficial Effect of Kidney Bean Resistant Starch on Hyperlipidemia—Induced Acute Pancreatitis and Related Intestinal Barrier Damage in Rats
Abstract
:1. Introduction
2. Results
2.1. Molecular Structure and Digestibility of RS
2.2. Dietary Intake Affected the Body Weight and Pancreas Weight of HLAP Rats
2.3. The Effect of RS on Serum Pathological Parameters in Rats
2.4. Intaking of RS Affects the Degree of Edema and Myeloperoxidase Activity in Pancreatic Tissue of Rats in Each Group
2.5. The Results of the Pancreas Pathology Section
2.6. Effect of Kidney Bean RS on Secretion of Inflammatory Cells in Rats
2.7. Effects of Kidney Bean RS on Serum DAO, DLA, ET, and sIgA Levels in Rats
2.8. Effect of Kidney Bean RS on Histopathological Sections of Rat Small Intestinal Mucosa
2.9. Intestinal Functional Protein mRNA Level and Protein Expression
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Preparation and Purification of Kidney Bean RS
4.3. Structure of RS
4.4. Animal Feeding and Administration
4.5. Serum Analysis
4.6. Histology Analysis
4.7. RNA Extraction and Quantitative PCR
4.8. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Sample Availability
References
- Lankisch, P.G.; Apte, M.; Banks, P.A. Acute pancreatitis. Lancet 2015, 386, 85–96. [Google Scholar] [CrossRef]
- Yang, A.L.; Mcnabb, B.J. Hypertriglyceridemia and acute pancreatitis. Pancreatology 2020, 20, 795–800. [Google Scholar] [CrossRef] [PubMed]
- Reed, J.M.; Hogan, B.M.; Nasser-Ghodsi, N.; Loftus, C.G. Management of Hypertriglyceridemia-Induced Acute Pancreatitis in a Nondiabetic Patient. Mayo Clin. Proc. Innov. Qual. Outcomes 2021, 5, 520–524. [Google Scholar] [CrossRef] [PubMed]
- Prasada, R.; Muktesh, G.; Samanta, J.; Sarma, P.; Singh, S.; Arora, S.K.; Dhaka, N.; Ramachandran, R.; Gupta, V.; Sinha, S.K.; et al. Natural history and profile of selective cytokines in patients of acute pancreatitis with acute kidney injury. Cytokine 2020, 133, 155177. [Google Scholar] [CrossRef]
- Rychter, J.W.; Minnen, L.; Verheem, A.; Timmerman, H.M.; Rijkers, G.T.; Schipper, M.E.I.; Gooszen, H.G.; Akkermans, L.M.A.; Kroese, A.B.A. Pretreatment but not treatment with probiotics abolishes mouse intestinal barrier dysfunction in acute pancreatitis. Surgery 2009, 145, 157–167. [Google Scholar] [CrossRef]
- Tan, C.C.; Ling, Z.X.; Huang, Y.; Cao, Y.D.; Liu, Q.; Cai, T.; Yuan, H.; Liu, C.J.; Li, Y.F.; Xu, K.Q. Dysbiosis of Intestinal Microbiota Associated with Inflammation Involved in the Progression of Acute Pancreatitis. Pancreas 2014, 44, 868–875. [Google Scholar] [CrossRef]
- Hong, W.D.; Zimmer, V.; Basharat, Z.; Zippi, M.; Stock, S.; Geng, W.J.; Bao, X.Q.; Dong, J.F.; Pan, J.Y.; Zhou, M.T. Association of total cholesterol with severe acute pancreatitis: A U-shaped relationship. Clin. Nutr. 2019, 39, 250–257. [Google Scholar] [CrossRef]
- Pang, L.; Yang, Z.H.; Wu, Y.; Yin, R.X.; Liao, Y.H.; Wang, J.W.; Gao, B.X.; Zhang, L.X. The prevalence, awareness, treatment and control of dyslipidemia among adults in China. Atherosclerosis 2016, 248, 2–9. [Google Scholar] [CrossRef]
- Zou, J.; Xu, M.J.; Wen, L.R.; Yang, B. Structure and physicochemical properties of native starch and resistant starch in Chinese yam (Dioscorea opposita Thunb.). Carbohydr. Polym. 2020, 237, 116188. [Google Scholar] [CrossRef]
- Grooms, K.N.; Ommerborn, M.J.; Pham, D.Q.; Djousse, L.; Clark, C.R. Dietary Fiber Intake and Cardiometabolic Risks among US Adults, NHANES 1999–2010. Am. J. Med. 2013, 126, 1059–1067. [Google Scholar] [CrossRef] [Green Version]
- Sun, H.; Ma, X.H.; Zhang, S.Q.; Zhao, D.; Liu, X. Resistant starch produces antidiabetic effects by enhancing glucose metabolism and ameliorating pancreatic dysfunction in type 2 diabetic rats. Int. J. Biol. Macromol. 2017, 110, 276–284. [Google Scholar] [CrossRef] [PubMed]
- Li, T.; Teng, H.; An, F.P.; Huang, Q.; Chen, L.; Song, H.B. The beneficial effects of purple yam (Dioscorea alata L.) resistant starch on hyperlipidemia in high-fat-fed hamsters. Food Funct. 2019, 10, 2642–2650. [Google Scholar] [CrossRef] [PubMed]
- Yuan, H.C.; Meng, Y.; Bai, H.; Shen, D.Q.; Wan, B.C.; Chen, L.Y. Meta-analysis indicates that resistant starch lowers serum total cholesterol and low-density cholesterol. Nutr. Res. 2018, 54, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Zhang, C.J.; Dong, L.; Wu, J.H.; Qiao, S.Y.; Xu, W.J.; Ma, S.S.; Zhao, B.S.; Wang, X.Y. Intervention of resistant starch 3 on type 2 diabetes mellitus and its mechanism based on urine metabonomics by liquid chromatography-tandem mass spectrometry. Biomed. Pharmacother. 2020, 128, 110350. [Google Scholar] [CrossRef]
- Rosado, C.P.; Rosa, V.H.C.; Martins, B.C.; Soares, A.C.; Santos, I.B.; Monteiro, E.B.; Moura-Nunes, N.; Costa, C.A.D.; Mulder, A.D.R.P.; Daleprane, J.B. Resistant starch from green banana (Musa sp.) attenuates non-alcoholic fat liver accumulation and increases short-chain fatty acids production in high-fat diet-induced obesity in mice. Int. J. Biol. Macromol. 2020, 145, 1066–1072. [Google Scholar] [CrossRef]
- Zheng, B.; Wang, T.T.; Wang, H.W.; Chen, L.; Zhou, Z.K. Studies on nutritional intervention of rice starch- oleic acid complex (resistant starch type V) in rats fed by high-fat diet. Carbohydr. Polym. 2020, 246, 116637. [Google Scholar] [CrossRef]
- Kung, B.; Turgeon, S.L.; Rioux, L.E.; Anderson, G.H.; Wright, A.J.; Goff, H.D. Correlating in vitro digestion viscosities and bioaccessible nutrients of milks containing enhanced protein concentration and normal or modified protein ratio to human trials. Food Funct. 2019, 10, 7687–7696. [Google Scholar] [CrossRef]
- Reddy, C.K.; Haripriya, S.; Mohamed, A.N.; Suriya, M. Preparation and characterization of resistant starch III from elephant foot yam (Amorphophallus paeonifolius) starch. Food Chem. 2014, 155, 38–44. [Google Scholar] [CrossRef]
- Dutta, S.K.; Hlasko, J. Dietary fiber in pancreatic disease: Effect of high fiber diet on fat malabsorption in pancreatic insufficiency and in vitro study of the interaction of dietary fiber with pancreatic enzymes. Am. J. Clin. Nutr. 1985, 41, 517–525. [Google Scholar] [CrossRef]
- Dhital, S.; Gidley, M.J.; Warren, F.J. Inhibition of α-amylase activity by cellulose: Kinetic analysis and nutritional implications. Carbohydr. Polym. 2015, 123, 305–312. [Google Scholar] [CrossRef]
- Wang, W.J.; He, B.; Shi, W.; Liang, X.L.; Ma, J.C.; Shan, Z.X.; Hu, Z.Y.; Danesh, F.R. Deletion of scavenger receptor A protects mice from progressive nephropathy independent of lipid control during diet-induced hyperlipidemia. Kidney Int. 2012, 81, 1002–1014. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Khlifi, R.; Lahmar, A.; Dhaouefi, Z.; Kalboussi, Z.; Maatouk, M.; Kilani-Jaziri, S.; Ghedira, K.; Chekir-Ghedira, L. Assessment of hypolipidemic, anti-inflammatory and antioxidant properties of medicinal plant Erica multiflora in triton WR-1339-induced hyperlipidemia and liver function repair in rats: A comparison with fenofibrate-ScienceDirect. Regul. Toxicol. Pharmacol. 2019, 107, 104404. [Google Scholar] [CrossRef] [PubMed]
- Yuan, L.; Tang, M.D.; Huang, L.; Gao, Y.; Li, X.L. Risk Factors of Hyperglycemia in Patients after a First Episode of Acute Pancreatitis: A Retrospective Cohort. Pancreas 2016, 46, 209–218. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.R.; Wang, J.J.; Chen, J.F.; Zhou, L.L.; Wang, H.; Chen, J.N.; Xu, Z.H.; Zhu, S.J.; Liu, W.; Yu, R.J.; et al. Morusin alleviates mycoplasma pneumonia via the inhibition of Wnt/β-catenin and NF-κB signaling. Biosci. Rep. 2019, 39, BSR20190190. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, B.; Yan, P.; Yang, G.Z.; Cao, H.L.; Wang, F.; Li, B. Triptolide reduces ischemia/reperfusion injury in rats and H9C2 cells via inhibition of NF-κB, ROS and the ERK1/2 pathway. Int. J. Mol. Med. 2018, 41, 3127–3136. [Google Scholar] [CrossRef] [PubMed]
- Landahl, P.; Ansari, D.; Andersson, R. Severe Acute Pancreatitis: Gut Barrier Failure, Systemic Inflammatory Response, Acute Lung Injury, and the Role of the Mesenteric Lymph. Surg. Infect. 2015, 16, 651–656. [Google Scholar] [CrossRef]
- Perriot, S.; Mathias, A.; Perriard, G.; Canales, M.; Jonkmans, N.; Merienne, N.; Meunier, C.; Kassar, L.E.; Perrier, A.L.; Laplaud, D.A.; et al. Human Induced Pluripotent Stem Cell-Derived Astrocytes Are Differentially Activated by Multiple Sclerosis-Associated Cytokines. Stem Cell Rep. 2018, 11, 1199–1210. [Google Scholar] [CrossRef] [Green Version]
- Nilsson, A.C.; Johansson-Boll, E.V.; Björck, I.M.E. Increased gut hormones and insulin sensitivity index following a 3-d intervention with a barley kernel-based product: A randomised cross-over study in healthy middle-aged subjects. Br. J. Nutr. 2015, 114, 899–907. [Google Scholar] [CrossRef]
- Dias, G.; Queiroz, L.R.; Máfia, R.; Stephane, B.; Medeiros, G.; Martins, V. Understanding the International Consensus for Acute Pancreatitis: Classification of Atlanta 2012. ABCD Arq. Bras. Cir. Dig. 2016, 29, 206–210. [Google Scholar] [CrossRef] [Green Version]
- Campos, T.D.; Parreira, J.G.; Assef, J.C.; Rizoli, S.; Nascimento, B.; Fraga, G.P. Classification of acute pancreatitis. Rev. Do Colégio Bras. De Cir. 2013, 40, 164–168. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Q.Y.; Qin, M.B.; Liang, Z.H.; Huang, H.L.; Tang, Y.F.; Qin, L.Y.; Wei, Z.P.; Xu, M.T.; Tang, G.D. The relationship between serum triglyceride levels and acute pancreatitis in an animal model and a 14-year retrospective clinical study. Lipids Health Dis. 2019, 18, 183–192. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shang, W.T.; Xu, S.; Zhou, Z.K.; Wang, J.X.; Strappe, P.; Blanchard, C. Studies on the unique properties of resistant starch and chito-oligosaccharide complexes for reducing high-fat diet-induced obesity and dyslipidemia in rats. J. Funct. Foods 2017, 38, 20–27. [Google Scholar] [CrossRef]
- Keenan, M.J.; Zhou, J.; McCutcheon, K.L.; Raggio, A.M.; Bateman, H.G.; Todd, E.; Jones, C.K.; Tulley, R.T.; Melton, S.; Martin, R.J.; et al. Effects of resistant starch, a non-digestible fermentable fiber, on reducing body fat. Obesity 2006, 14, 1523–1534. [Google Scholar] [CrossRef] [PubMed]
- Lin, S.B.; Han, Y.R.; Jenkin, K.; Lee, S.J.; Sasaki, M.; Klapproth, J.M.; He, P.J.; Yun, C.C. Lysophosphatidic Acid Receptor 1 Is Important for Intestinal Epithelial Barrier Function and Susceptibility to Colitis. Am. J. Pathol. 2018, 188, 353–366. [Google Scholar] [CrossRef] [Green Version]
- Ge, P.; Luo, Y.L.; Okoye, C.S.; Chen, H.Y.; Liu, J.Y.; Zhang, G.X.; Xu, C.M.; Chen, H.L. Intestinal barrier damage, systemic inflammatory response syndrome, and acute lung injury: A troublesome trio for acute pancreatitis. Biomed. Pharmacother. 2020, 132, 110770. [Google Scholar] [CrossRef]
- Yang, Y.T.; Chen, L.; Tian, Y.; Ye, J.; Liu, Y.; Song, L.L.; Pan, Q.; He, Y.H.; Chen, W.S.; Peng, Z.H.; et al. Numb modulates the paracellular permeability of intestinal epithelial cells through regulating apical junctional complex assembly and myosin light chain phosphorylation. Exp. Cell Res. 2013, 319, 3214–3225. [Google Scholar] [CrossRef]
- Ma, Z.; Yin, X.X.; Hu, X.Z.; Li, X.P.; Liu, L.; Boye, J.I. Structural characterization of resistant starch isolated from Laird lentils (Lens culinaris) seeds subjected to different processing treatments. Food Chem. 2018, 263, 163–170. [Google Scholar] [CrossRef]
- Li, S.L.; Ward, R.; Gao, Q.Y. Effect of heat-moisture treatment on the formation and physicochemicalproperties of resistant starch from mung bean (Phaseolus radiatus) starch. Food Hydrocoll. 2011, 25, 1702–1709. [Google Scholar] [CrossRef]
- Reddy, C.K.; Suriya, M.; Haripriya, S. Physico-chemical and functional properties of Resistant starch prepared from red kidney beans (Phaseolus vulgaris L.) starch by enzymatic method. Carbohydr. Polym. 2013, 95, 220–226. [Google Scholar] [CrossRef]
- Barreto, S.G.; Carati, C.J.; Schloithe, A.C.; Mathison, R.; Davison, J.S.; Toouli, J.; Saccone, G.T.P. The efficacy of combining feG and galantide in mild caerulein-induced acute pancreatitis in mice. Peptides 2010, 31, 1076–1082. [Google Scholar] [CrossRef]
- Xue, D.B.; Zhang, W.H.; Zhang, Y.M.; Wang, H.Y.; Zheng, B.; Shi, X.Y. Adjusting effects of baicalin for nuclear factor-κB and tumor necrosis factor-α on rats with caerulein-induced acute pancreatitis. Mediat. Inflamm. 2006, 5, e26295. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lerch, M.M.; Gorelick, F.S. Models of Acute and Chronic Pancreatitis. Gastroenterology 2013, 144, 1180–1193. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.J.; He, Y.; Wang, F.; Zhang, H.; Vos, P.D.; Sun, J. Low-methoxyl lemon pectin attenuates inflammatory responses and improves intestinal barrier integrity in caerulein-induced experimental acute pancreatitis. Mol. Nutr. Food Res. 2017, 61, 1600885. [Google Scholar] [CrossRef] [PubMed]
- Piorkowski, G.; Baronti, C.; Lamballerie, X.D.; Fabritus, L.D.; Bichaud, L.; Pastorino, B.A.; Bessaud, M. Development of generic Taqman PCR and RT-PCR assays for the detection of DNA and mRNA of β-actin-encoding sequences in a wide range of animal species. J. Virol. Methods 2014, 202, 101–105. [Google Scholar] [CrossRef] [PubMed]
Sample | Low Particle Size D10/μm | Median Particle Size D50/μm | High Particle Size D90/μm | Volume Average Particle Size/μm | Specific Surface Area/m2·g |
---|---|---|---|---|---|
Starch | 18.65 ± 0.18 a | 28.77 ± 0.75 a | 40.85 ± 3.54 a | 28.88 ± 1.46 a | 0.119 ± 0.011 a |
RS | 41.63 ± 0.22 b | 166.30 ± 2.87 b | 355.2 ± 2.12 b | 184.60 ± 3.39 b | 0.044 ± 0.013 b |
Parameter | Model Group (MOD) | Control Group (CON) | Simvastatin Group (SV) | Low-Dose RS Group (L-RS) | Medium-Dose RS Group (M-RS) | High-Dose RS Group (H-RS) |
---|---|---|---|---|---|---|
Body mass/g | 471.16 ± 8.08 f | 378.73 ± 10.15 a | 405.88 ± 7.19 b | 451.67 ± 6.26 e | 429.78 ± 8.98 d | 418.35 ± 5.19 c |
Pancreas mass/g | 1.295 ± 0.054 a | 1.789 ± 0.019 f | 1.520 ± 0.023 c | 1.468 ± 0.024 b | 1.666 ± 0.035 d | 1.748 ± 0.041 e |
Pancreas index/% | 0.289 ± 0.042 a | 0.455 ± 0.041 e | 0.375 ± 0.012 c | 0.325 ± 0.010 b | 0.388 ± 0.016 cd | 0.418 ± 0.014 d |
Parameter | MOD | CON | SV | L-RS | M-RS | H-RS |
---|---|---|---|---|---|---|
TC (mmol/L) | 4.08 ± 0.13 e | 0.81 ± 0.14 a | 2.44 ± 0.11 d | 2.32 ± 0.21 d | 1.55 ± 0.17 c | 1.25 ± 0.14 b |
TG (mmol/L) | 2.22 ± 0.12 f | 0.67 ± 0.05 a | 1.48 ± 0.07 c | 1.94 ± 0.13 e | 1.74 ± 0.05 d | 1.25 ± 0.08 b |
AMLY (U/L) | 4366.16 ± 117.84 f | 1280.27 ± 71.93 a | 2660.19 ± 105.55 b | 3637.9 ± 61.05 e | 3218.61 ± 60.65 d | 3010.32 ± 65.86 c |
LIPA (U/L) | 1016.58 ± 35.73 e | 107.97 ± 19.91 a | 780.51 ± 20.57 d | 793.22 ± 15.39 d | 674.44 ± 32.76 c | 523.05 ± 27.66 b |
TNF-α (pg/mL) | 197.60 ± 2.72 f | 60.13 ± 4.10 a | 110.60 ± 2.37 b | 181.67 ± 3.25 e | 140.67 ± 4.39 d | 130.33 ± 4.29 c |
IL-6 (pg/mL) | 110.67 ± 4.59 d | 12.33 ± 1.53 a | 50.67 ± 3.61 bc | 90.00 ± 2.00 c | 75.33 ± 4.18 b | 55.33 ± 2.07 b |
IL-1β (pg/mL) | 86.88 ± 2.46 f | 15.00 ± 1.43 a | 53.80 ± 0.82 b | 80.00 ± 1.26 e | 72.82 ± 1.81 d | 67.00 ± 2.03 c |
DAO (ng/mL) | 95.07 ± 4.21 e | 57.58 ± 3.51 a | 70.51 ± 1.41 b | 85.98 ± 3.32 d | 72.13 ± 4.96 bc | 75.31 ± 2.31 c |
DLA (μmol/L) | 38.76 ± 2.27 f | 23.57 ± 0.62 a | 26.72 ± 1.34 b | 36.76 ± 1.05 e | 35.08 ± 1.14 d | 28.41 ± 0.92 c |
ET (EU/mL) | 71.84 ± 1.87 e | 53.16 ± 2.58 a | 57.26 ± 1.82 c | 67.74 ± 1.12 d | 56.37 ± 1.70 bc | 54.84 ± 2.27 ab |
sIgA (μg/mL) | 19.01 ± 0.73 a | 25.04 ± 1.16 c | 26.75 ± 1.75 d | 19.49 ± 0.78 a | 21.28 ± 1.39 b | 22.67 ± 1.38 b |
Ingredients (%) | CON | MOD | SV | L-RS | M-RS | H-RS |
---|---|---|---|---|---|---|
Corn starch | 73.5 | 53.51 | 53.51 | 53.51 | 53.51 | 53.51 |
Wheat bran | 20 | 14.6 | 14.6 | 14.6 | 14.6 | 14.6 |
Fish meal | 5 | 3.6 | 3.6 | 3.6 | 3.6 | 3.6 |
Farina | 1 | 0.73 | 0.73 | 0.73 | 0.73 | 0.73 |
Sodium salt | 0.5 | 0.56 | 0.56 | 0.56 | 0.56 | 0.56 |
Cholesterol | / | 1.2 | 1.2 | 1.2 | 1.2 | 1.2 |
Egg yolk powder | / | 5.8 | 5.8 | 5.8 | 5.8 | 5.8 |
Sucrose | / | 10 | 10 | 10 | 10 | 10 |
Lard | / | 10 | 10 | 10 | 10 | 10 |
Gene Name | Forward Primer | Temperature/°C | Length/bp |
---|---|---|---|
ZO-1 | GAGATGAGCGGGCTACCTTA GCTGTGGAGACTGTGTGGAAT | 57.2 57.0 | 210 |
Occludin | TGGGACAGAGCCTATGGAAC ACCAAGGAAGCGATGAAGC | 57.2 57.5 | 197 |
CRAMP | TCACTGTCACTGCTATTGCTCCT CCTTCACTCGGAACCTCACAT | 59.3 58.9 | 208 |
DEFB1 | CTGCCCATCTCATACCAAACTAC TTTACAATCCCTTGCTGTCCTT | 58.4 58.5 | 112 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zuo, Z.; Liu, S.; Pang, W.; Lu, B.; Sun, W.; Zhang, N.; Zhou, X.; Zhang, D.; Wang, Y. Beneficial Effect of Kidney Bean Resistant Starch on Hyperlipidemia—Induced Acute Pancreatitis and Related Intestinal Barrier Damage in Rats. Molecules 2022, 27, 2783. https://doi.org/10.3390/molecules27092783
Zuo Z, Liu S, Pang W, Lu B, Sun W, Zhang N, Zhou X, Zhang D, Wang Y. Beneficial Effect of Kidney Bean Resistant Starch on Hyperlipidemia—Induced Acute Pancreatitis and Related Intestinal Barrier Damage in Rats. Molecules. 2022; 27(9):2783. https://doi.org/10.3390/molecules27092783
Chicago/Turabian StyleZuo, Zhaohang, Shuting Liu, Weiqiao Pang, Baoxin Lu, Wei Sun, Naidan Zhang, Xinyu Zhou, Dongjie Zhang, and Ying Wang. 2022. "Beneficial Effect of Kidney Bean Resistant Starch on Hyperlipidemia—Induced Acute Pancreatitis and Related Intestinal Barrier Damage in Rats" Molecules 27, no. 9: 2783. https://doi.org/10.3390/molecules27092783
APA StyleZuo, Z., Liu, S., Pang, W., Lu, B., Sun, W., Zhang, N., Zhou, X., Zhang, D., & Wang, Y. (2022). Beneficial Effect of Kidney Bean Resistant Starch on Hyperlipidemia—Induced Acute Pancreatitis and Related Intestinal Barrier Damage in Rats. Molecules, 27(9), 2783. https://doi.org/10.3390/molecules27092783