Evaluation of Anti-Inflammatory and Antioxidant Effectsof Chrysanthemum Stem and Leaf Extract on Zebrafish Inflammatory Bowel Disease Model
Abstract
:1. Introduction
2. Results
2.1. Pathological Changes in DSS-Induced Enterocolitis
2.1.1. Alcian Blue Staining
2.1.2. Hematoxylin Eosin Staining
2.2. Changes in Superoxide Dismutase Levels during DSS Induced Inflammation
2.3. Inflammatory Cytokine Production in Larvae Exposed to DSS
2.4. Flavonoids and Phenolic Acids Were Determined by UPLC-TQ/MS Method
2.4.1. Linearity
2.4.2. Precision, Repeatability, and Stability
2.4.3. Total Flavonoids, Total Phenolic Acid Content
3. Discussion
4. Materials and Methods
4.1. Animal Care Ethics
4.2. Zebrafish Husbandry
4.3. Chemicals and Regents
4.4. Apparatus
4.5. Sample Preparation
4.6. Zebrafish IBD Modeling and Drug Treatment
4.7. Histological Analysis
4.7.1. Alcian Blue Staining
- (1)
- Fix the young fish in 4% paraformaldehyde at room temperature for 2 h.
- (2)
- Rinse the young fish with acidic ethanol (70% ethanol, 1% concentrated hydrochloric acid).
- (3)
- Soak young fish in Alcian blue staining solution (0.001% Alcian blue, 80% ethanol, 20% glacial acetic acid) for 15 min at room temperature.
- (4)
- Remove the staining solution and rinse the background repeatedly with acidic ethanol.
- (5)
- Place the young fish in 3% methylcellulose for imaging. Staining samples in acidic ethanol should be stored in sealed containers to avoid dehydration due to evaporation.
4.7.2. Hematoxylin Eosin Staining
4.8. Superoxide Dismutase (SOD)
- (1)
- SOD inhibition rate (%) = (A control − A control blank) − (A determination−A determination blank)/((A control − A control blank)) × 100%
- (2)
- SOD activity (U/mgprot) = SOD inhibition rate ÷50% × dilution ratio of reaction team system ÷ protein concentration of samples to be tested (mgprot/mL)
4.9. RNA Extraction and q-PCR
4.10. UPLC–TQ/MS Analysis
4.10.1. UPLC-TQ/MS Conditions
4.10.2. Linearity
4.10.3. Precision and Accuracy
4.11. Determination of Total Polysaccharide Content
4.12. Statistical Evaluation
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Sample Availability
References
- Podolsky, D. Inflammatory bowel disease. N. Engl. J. Med. 2002, 347, 417–429. [Google Scholar] [CrossRef] [PubMed]
- Rubin, D.T.; Ananthakrishnan, A.N.; Siegel, C.A.; Sauer, B.G.; Long, M.D. ACG Clinical Guideline: Ulcerative Colitis in Adults. Am. J. Gastroenterol. 2019, 114, 384–413. [Google Scholar] [CrossRef] [PubMed]
- Rubin, D.T.; Sninsky, C.; Siegmund, B.; Sans, M.; Hart, A.; Bressler, B.; Bouhnik, Y.; Armuzzi, A.; Afzali, A. International Perspectives on Management of Inflammatory Bowel Disease: Opinion Differences and Similarities Between Patients and Physicians From the IBD GAPPS Survey. Inflamm. Bowel Dis. 2021, 27, 1942–1953. [Google Scholar] [CrossRef]
- Molodecky, N.A.; Soon, I.S.; Rabi, D.M.; Ghali, W.A.; Ferris, M.; Chernoff, G.; Benchimol, E.I.; Panaccione, R.; Ghosh, S.; Barkema, H.W.; et al. Increasing Incidence and Prevalence of the Inflammatory Bowel Diseases With Time, Based on Systematic Review. Gastroenterology 2012, 142, 46–54e42. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stulman, M.Y.; Asayag, N.; Focht, G.; Brufman, I.; Cahan, A.; Ledderman, N.; Matz, E.; Chowers, Y.; Eliakim, R.; Ben-Horin, S.; et al. Epidemiology of Inflammatory Bowel Diseases in Israel: A Nationwide Epi-Israeli IBD Research Nucleus Study. Inflamm. Bowel Dis. 2021, 27, 1784–1794. [Google Scholar] [CrossRef] [PubMed]
- Kaplan, G. The global burden of IBD: From 2015 to 2025. Nat. Rev. Gastroenterol. Hepatol. 2015, 12, 720–727. [Google Scholar] [CrossRef]
- Kudelka, M.R.; Stowell, S.R.; Cummings, R.D.; Neish, A.S. Intestinal epithelial glycosylation in homeostasis and gut microbiota interactions in IBD. Nat. Rev. Gastroenterol. Hepatol. 2020, 17, 1–21. [Google Scholar] [CrossRef]
- Jergens, A.E.; Parvinroo, S.; Kopper, J.; Wannemuehler, M.J. Rules of Engagement: Epithelial-Microbe Interactions and Inflammatory Bowel Disease. Front. Med. 2021, 8, 669913. [Google Scholar] [CrossRef]
- Somani, S.J.; Modi, K.P.; Majumdar, A.S.; Sadarani, B.N. Phytochemicals and Their Potential Usefulness in Inflammatory Bowel Disease. Phytotherapy Res. 2015, 29, 339–350. [Google Scholar] [CrossRef]
- Pagnini, C.; Cominelli, F. Tumor Necrosis Factor’s Pathway in Crohn’s Disease: Potential for Intervention. Int. J. Mol. Sci. 2021, 22, 10273. [Google Scholar] [CrossRef]
- Burisch, J.; Bergemalm, D.; Halfvarson, J.; Domislovic, V.; Krznaric, Z.; Goldis, A.; Dahlerup, J.; Oksanen, P.; Collin, P.; de Castro, L.; et al. The use of 5-aminosalicylate for patients with Crohn’s disease in a prospective European inception cohort with 5 years follow-up—An Epi-IBD study. United Eur. Gastroenterol. J. 2020, 8, 949–960. [Google Scholar] [CrossRef]
- Bots, S.; Gecse, K.; Barclay, M.; D’Haens, G. Combination Immunosuppression in IBD. Inflamm. Bowel Dis. 2018, 24, 539–545. [Google Scholar] [CrossRef] [PubMed]
- López-Sanromán, A. Steroids and Postoperative Complications in IBD. Curr. Drug Targets 2019, 20, 1323–1326. [Google Scholar] [CrossRef] [PubMed]
- Bernstein, C.N. Past Time for Doctors to Lessen their Dependence on Corticosteroids in the Treatment of IBD. Am. J. Gastroenterol. 2018, 113, 418–420. [Google Scholar] [CrossRef] [PubMed]
- Danese, S.; Vuitton, L.; Peyrin-Biroulet, L. Biologic agents for IBD: Practical insights. Nat. Rev. Gastroenterol. Hepatol. 2015, 12, 537–545. [Google Scholar] [CrossRef] [PubMed]
- Paramsothy, S.; Nielsen, S.; Kamm, M.A.; Deshpande, N.P.; Faith, J.J.; Clemente, J.C.; Paramsothy, R.; Walsh, A.J.; van den Bogaerde, J.; Samuel, D.; et al. Specific Bacteria and Metabolites Associated with Response to Fecal Microbiota Transplantation in Patients with Ulcerative Colitis. Gastroenterology 2019, 156, 1440–1454e2. [Google Scholar] [CrossRef] [Green Version]
- Wan, P.; Chen, H.; Guo, Y.; Bai, A.-P. Advances in treatment of ulcerative colitis with herbs: From bench to bedside. World J. Gastroenterol. 2014, 20, 14099–14104. [Google Scholar] [CrossRef]
- Yang, L.; Luo, H.; Tan, D.; Zhang, S.; Zhong, Z.; Wang, S.; Vong, C.T.; Wang, Y. A recent update on the use of Chinese medicine in the treatment of inflammatory bowel disease. Phytomedicine 2021, 92, 153709. [Google Scholar] [CrossRef]
- Luyen, B.T.T.; Tai, B.H.; Thao, N.P.; Cha, J.Y.; Lee, H.Y.; Lee, Y.M.; Kim, Y.H. Anti-inflammatory components of Chrysanthemum indicum flowers. Bioorganic Med. Chem. Lett. 2014, 25, 266–269. [Google Scholar] [CrossRef]
- Wang, J.; Liang, Q.; Zhao, Q.; Tang, Q.; Ahmed, A.F.; Zhang, Y.; Kang, W. The effect of microbial composition and proteomic on improvement of functional constipation by Chrysanthemum morifolium polysaccharide. Food Chem. Toxicol. 2021, 153, 112305. [Google Scholar] [CrossRef]
- Tao, J.; Duan, J.; Jiang, S.; Feng, N.; Qiu, W.; Ling, Y. Chrysanthemum morifolium Polysaccharides from Ramat ameliorate colitis rats by modulating the intestinal microbiota community. Oncotarget 2017, 8, 80790–80803. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tao, J.-H.; Duan, J.-A.; Jiang, S.; Guo, J.-M.; Qian, Y.-Y.; Qian, D.-W. Simultaneous determination of six short-chain fatty acids in colonic contents of colitis mice after oral administration of polysaccharides from Chrysanthemum morifolium Ramat by gas chromatography with flame ionization detector. J. Chromatogr. B 2016, 1029, 88–94. [Google Scholar] [CrossRef] [PubMed]
- Tao, J.; Duan, J.; Zhang, W.; Jiang, S.; Guo, J.; Wei, D. Chrysanthemum morifolium Polysaccharides from Ramat Ameliorate Colitis Rats via Regulation of the Metabolic Profiling and NF-κ B/TLR4 and IL-6/JAK2/STAT3 Signaling Pathways. Front. Pharmacol. 2018, 9, 746. [Google Scholar] [CrossRef]
- Chen, S.; Liu, J.; Dong, G.; Zhang, X.; Liu, Y.; Sun, W. Flavonoids and caffeoylquinic acids in Chrysanthemum morifolium Ramat flowers: A potentially rich source of bioactive compounds. Food Chem. 2020, 344, 128733. [Google Scholar] [CrossRef] [PubMed]
- Liang, F.; Hu, C.; He, Z.; Pan, Y. An arabinogalactan from flowers of Chrysanthemum morifolium: Structural and bioactivity studies. Carbohydr. Res. 2014, 387, 37–41. [Google Scholar] [CrossRef] [PubMed]
- Kuang, C.; Lv, D.; Shen, G.; Li, S.; Luo, Q.; Zhang, Z. Chrysanthemum morifoliumChemical composition and antimicrobial activities of volatile oil extracted from Ramat. J. Food Sci. Technol. 2018, 55, 2786–2794. [Google Scholar] [CrossRef] [PubMed]
- Ben Sassi, A.; Skhiri, F.H.; Chraief, I.; Bourgougnon, N.; Hammami, M.; Aouni, M. Essential Oils and Crude Extracts from Chrysanthemum trifurcatum Leaves, Stems and Roots: Chemical Composition and Antibacterial Activity. J. Oleo Sci. 2014, 63, 607–617. [Google Scholar] [CrossRef] [Green Version]
- Chiang, Y.; Wu, Y.; Lin, L.; Tsai, T. Comparative biotransformation of luteolin and apigenin from the flower extract and the stem-and-leaf extract of Dendranthema morifolium Ramat. Tzvel. in rats. J. Sci. Food Agric. 2021, 101, 4934–4945. [Google Scholar] [CrossRef]
- Streisinger, G.; Walker, C.; Dower, N.; Knauber, N.; Singer, F. Production of clones of homozygous diploid zebra fish (Brachydanio rerio). Nature 1981, 291, 293–296. [Google Scholar] [CrossRef]
- Howe, K.; Clark, M.D.; Torroja, C.F.; Torrance, J.; Berthelot, C.; Muffato, M.; Collins, J.E.; Humphray, S.; McLaren, K.; Matthews, L.; et al. The zebrafish reference genome sequence and its relationship to the human genome. Nature 2013, 496, 498–503. [Google Scholar] [CrossRef] [Green Version]
- DuBois, M.; Gilles, K.A.; Hamilton, J.K.; Rebers, P.A.; Smith, F. Colorimetric method for determination of sugars and related substances. Anal. Chem. 1956, 28, 350–356. [Google Scholar] [CrossRef]
- Li, J.; Kisara, K.; Danielsson, S.; Lindström, M.; Gellerstedt, G. An improved methodology for the quantification of uronic acid units in xylans and other polysaccharides. Carbohydr. Res. 2007, 342, 1442–1449. [Google Scholar] [CrossRef] [PubMed]
- Oehlers, S.; Flores, M.V.; Hall, C.; Okuda, K.S.; Sison, J.O.; Crosier, K.E.; Crosier, P.S. Chemically Induced Intestinal Damage Models in Zebrafish Larvae. Zebrafish 2013, 10, 184–193. [Google Scholar] [CrossRef] [PubMed]
- Oehlers, S.; Flores, M.V.; Hall, C.; Crosier, K.E.; Crosier, P.S. Retinoic acid suppresses intestinal mucus production and exacerbates experimental enterocolitis. Dis. Model. Mech. 2012, 5, 457–467. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hanyang, L.; Xuanzhe, L.; Xuyang, C.; Yujia, Q.; Jiarong, F.; Jun, S.; Zhihua, R. Application of Zebrafish Models in Inflammatory Bowel Disease. Front. Immunol. 2017, 8, 501. [Google Scholar] [CrossRef] [Green Version]
- Yang, Y.; Tomkovich, S.; Jobin, C. Could a Swimming Creature Inform Us on Intestinal Diseases? Lessons from Zebrafish. Inflamm. Bowel Dis. 2014, 20, 956–966. [Google Scholar] [CrossRef] [Green Version]
- Ng, A.N.; de Jong-Curtain, T.A.; Mawdsley, D.J.; White, S.J.; Shin, J.; Appel, B.; Dong, P.D.S.; Stainier, D.Y.; Heath, J.K. Formation of the digestive system in zebrafish: III. Intestinal epithelium morphogenesis. Dev. Biol. 2005, 286, 114–135. [Google Scholar] [CrossRef] [Green Version]
- Zhou, X.; Chen, X.; Wu, X.; Cao, G.; Zhang, J. Characterization of the chemical composition of white chrysanthemum flowers of Hangzhou by using high-performance ion trap mass spectrometry. J. Sep. Sci. 2016, 39, 1218–1222. [Google Scholar] [CrossRef]
- Lin, L.-Z.; Harnly, J.M. Identification of the phenolic components of chrysanthemum flower (Chrysanthemum morifolium Ramat). Food Chem. 2010, 120, 319–326. [Google Scholar] [CrossRef]
- Yang, L.; Zhou, X.; Huang, W.; Fang, Q.; Hu, J.; Yu, L.; Ma, N.; Zhang, W. Protective Effect of Phillyrin on Lethal LPS-Induced Neutrophil Inflammation in Zebrafish. Cell. Physiol. Biochem. Int. J. Exp. Cell. Physiol. Biochem. Pharmacol. 2017, 43, 2074–2087. [Google Scholar] [CrossRef]
- Westerfield, M. The Zebrafish Book: A Guide for The Laboratory Use of Zebrafish (Danio rerio). In Zebrafish Book a Guide for the Laboratory Use of Zebrafish; University of Oregon: Eugene, OR, USA, 2000. [Google Scholar]
- Nunes, N.S.; Chandran, P.; Sundby, M.; Visioli, F.; Gonçalves, F.D.C.; Burks, S.R.; Paz, A.H.; Frank, J.A. Therapeutic ultrasound attenuates DSS-induced colitis through the cholinergic anti-inflammatory pathway. EBioMedicine 2019, 45, 495–510. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Number | Analytes | Calibration Curves a | R2 | Linear Range (μg/mL) |
---|---|---|---|---|
1 | Neochlorogenic acid | y = 20367x + 14658 | 0.9987 | 0.34~135.00 |
2 | Chlorogenic acid | y = 14377x + 12830 | 0.9975 | 0.40~158.00 |
3 | Caffeic acid | y = 11510x − 359.18 | 0.9928 | 0.36~145.00 |
4 | Cryptochlorogenic acid | y = 12772x + 15468 | 0.9993 | 0.39~157.00 |
5 | 1,3-dicaffeoylquinic acid | y = 44.539x + 37.236 | 0.9967 | 0.31~122.00 |
6 | Isochlorogenic acid B | y = 1162.6x + 130.06 | 0.9999 | 0.41~163.00 |
7 | Isochlorogenic acid A | y = 41.259x − 9.1657 | 0.9998 | 0.36~143.00 |
8 | Isochlorogenic acid C | y = 23.482x + 28.95 | 0.9978 | 0.38~154.00 |
9 | Luteolin-7-O-β-D-glucoside | y = 20728x + 7525.5 | 0.999 | 0.17~69.00 |
10 | Apigenin-7-O-β-D-glucoside | y = 28985x + 2386.8 | 1 | 0.20~81.00 |
11 | Diosmetin-7-glucoside | y = 10955x + 5588.4 | 0.9994 | 0.22~89.00 |
12 | Eriodictyol | y = 35603x − 1415.7 | 0.9991 | 0.17~69.00 |
13 | Luteolin | y = 290.93x − 4.1891 | 0.998 | 0.20~79.00 |
14 | Linarin | y = 7679.9x + 2816 | 0.9986 | 0.16~64.00 |
15 | Tilianin | y = 3.7865x + 3.4176 | 0.9979 | 0.12~49.00 |
16 | Apigenin | y = 348.4x − 6.4809 | 0.9997 | 0.20~81.00 |
17 | Diosmetin | y = 561.49x − 11.501 | 0.9961 | 0.18~70.00 |
18 | Hesperetin | y = 90914x − 3254.3 | 0.9986 | 0.16~66.00 |
19 | Acacetin | y = 28421x + 8227.3 | 0.9995 | 0.15~62.50 |
Gene | Forward Primer Sequence | Reverse Primer Sequence |
---|---|---|
IL-8 | GTCGCTGCATTGAAACAGAA | CTTAACCCATGGAGCAGAGG |
MMP9 | CTTCAAGGACGGGCGCTACT | GAGGTGGTCCTCAAAGGCAG |
IL-1β | TGGACTTCGCAGCACAAAATG | GTTCACTTCACGCTCTTGGATG |
β-actin | CACACCGTGCCCATCTATGA | TTCTCTTTCGGCTGTGGTGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, Y.; Liu, X.-J.; Su, S.-L.; Yan, H.; Guo, S.; Qian, D.-W.; Duan, J.-A. Evaluation of Anti-Inflammatory and Antioxidant Effectsof Chrysanthemum Stem and Leaf Extract on Zebrafish Inflammatory Bowel Disease Model. Molecules 2022, 27, 2114. https://doi.org/10.3390/molecules27072114
Li Y, Liu X-J, Su S-L, Yan H, Guo S, Qian D-W, Duan J-A. Evaluation of Anti-Inflammatory and Antioxidant Effectsof Chrysanthemum Stem and Leaf Extract on Zebrafish Inflammatory Bowel Disease Model. Molecules. 2022; 27(7):2114. https://doi.org/10.3390/molecules27072114
Chicago/Turabian StyleLi, Yi, Xia-Jin Liu, Shu-Lan Su, Hui Yan, Sheng Guo, Da-Wei Qian, and Jin-Ao Duan. 2022. "Evaluation of Anti-Inflammatory and Antioxidant Effectsof Chrysanthemum Stem and Leaf Extract on Zebrafish Inflammatory Bowel Disease Model" Molecules 27, no. 7: 2114. https://doi.org/10.3390/molecules27072114