Modulation of High-Fat Diet-Induced Brain Oxidative Stress by Ferulate-Rich Germinated Brown Rice Ethyl Acetate Extract
Abstract
:1. Introduction
2. Materials and Methods
2.1. Reagents
2.2. Germination of Brown Rice and Extraction
2.3. Diet Preparation
2.4. Animal Experiments
2.5. Determination of Serum Biochemical Profile
2.6. Determination of Serum Total Antioxidant Status
2.7. Analysis of Antioxidant and Inflammation-Related Gene Expressions
2.7.1. RNA Extraction
2.7.2. Primer Design
2.8. Reverse Transcription and Polymerase Chain Reaction
2.9. GEXP Data Analysis
2.10. Quantification of Acetylcholinesterase (AChE) Level
2.11. Statistical Analysis
3. Result and Discussion
3.1. Effects of GBR-EA on Caloric Intake and Body Weight
3.2. Effects of GBR and GBR-EA on Serum Biochemical Profile
3.3. Effects of GBR-EA on Serum Total Antioxidant Status
3.4. Effects of GBR-EA on Antioxidant and Inflammatory Gene Expressions
3.5. Effects of GBR-EA on Hippocampal Acetylcholinesterase Gene and Enzyme Level
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Sample Availability
References
- Umeno, A.; Biju, V.; Yoshida, Y. In vivo ROS production and use of oxidative stress-derived biomarkers to detect the onset of diseases such as Alzheimer’s disease, Parkinson’s disease, and diabetes. Free Radic. Res. 2017, 51, 413–427. [Google Scholar] [CrossRef] [PubMed]
- Leyane, T.S.; Jere, S.W.; Houreld, N.N. Oxidative Stress in Ageing and Chronic Degenerative Pathologies: Molecular Mechanisms Involved in Counteracting Oxidative Stress and Chronic Inflammation. Int. J. Mol. Sci. 2022, 23, 7273. [Google Scholar] [CrossRef] [PubMed]
- Muñoz, A.; Costa, M. Nutritionally mediated oxidative stress and inflammation. Oxid. Med. Cell. Longev. 2013, 2013, 610950. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Csaba, C.; Sárközy, M.; Pipicz, M.; Dux, L.; Csont, T. Modulation of hypercholesterolemia-induced oxidative/nitrative stress in the heart. Oxid. Med. Cell. Longev. 2016, 2016, 3863726. [Google Scholar]
- Hu, P.; Dharmayat, K.I.; Stevens, C.A.T.; Sharabiani, M.T.A.; Jones, R.S.; Watts, G.F.; Genest, J.; Ray, K.K.; Vallejo-Vaz, A.J. Prevalence of familial hypercholesterolemia among the general population and patients with atherosclerotic cardiovascular disease: A systematic review and meta-analysis. Circulation 2020, 141, 1742–1759. [Google Scholar] [CrossRef] [PubMed]
- De Oliveira, J.; Kucharska, E.; Garcez, M.L.; Scarpatto Rodrigues, M.; Quevedo, J.; Moreno-Gonzalez, I.; Budni, J. Inflammatory Cascade in Alzheimer’s Disease Pathogenesis: A Review of Experimental Findings. Cells 2021, 10, 2581. [Google Scholar] [CrossRef]
- Wyss-Coray, T.; Rogers, J. Inflammation in Alzheimer disease—A brief review of the basic science and clinical literature. Cold Spring Harb. Perspect. Med. 2012, 2, a006346. [Google Scholar] [CrossRef]
- Meraz-Ríos, M.A.; Toral-Rios, D.; Franco-Bocanegra, D.; Villeda-Hernández, J.; Campos-Peña, V. Inflammatory process in Alzheimer’s Disease. Front. Integr. Neurosci. 2013, 7, 59. [Google Scholar] [CrossRef] [Green Version]
- Lambert, E.A.; Phillips, S.; Belski, R.; Tursunalieva, A.; Eikelis, N.; Sari, C.I.; Dixon, J.B.; Straznicky, N.; Grima, M.; Head, G.A.; et al. Endothelial Function in Healthy Young Individuals Is Associated with Dietary Consumption of Saturated Fat. Front. Physiol. 2017, 8, 876. [Google Scholar] [CrossRef] [Green Version]
- Graves, S.I.; Baker, D.J. Implicating endothelial cell senescence to dysfunction in the ageing and diseased brain. Basic Clin. Pharmacol. Toxicol. 2020, 127, 102–110. [Google Scholar] [CrossRef] [PubMed]
- Sáiz-Vazquez, O.; Puente-Martínez, A.; Ubillos-Landa, S.; Pacheco-Bonrostro, J.; Santabárbara, J. Cholesterol and Alzheimer’s Disease Risk: A Meta-Meta-Analysis. Brain Sci. 2020, 10, 386. [Google Scholar] [CrossRef] [PubMed]
- Hardy, J. Alzheimer’s disease: The amyloid cascade hypothesis: An update and reappraisal. J. Alzheimer’s Dis. 2006, 9, 151–153. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, H.; Zou, L.; Zhou, R.; Zhang, M.; Gu, S.; Zheng, J.; Hukportie, D.N.; Wu, K.; Huang, Z.; Yuan, Z.; et al. Long-Term Increase in Cholesterol Is Associated with Better Cognitive Function: Evidence from a Longitudinal Study. Front. Aging Neurosci. 2021, 13, 691423. [Google Scholar] [CrossRef] [PubMed]
- Reitz, C.; Tang, M.-X.; Luchsinger, J.; Mayeux, R. Relation of plasma lipids to Alzheimer disease and vascular dementia. Arch. Neurol. 2004, 61, 705–714. [Google Scholar] [CrossRef] [Green Version]
- Ullrich, C.; Pirchl, M.; Humpel, C. Hypercholesterolemia in rats impairs the cholinergic system and leads to memory deficits. Mol. Cell. Neurosci. 2010, 45, 408–417. [Google Scholar] [CrossRef] [PubMed]
- Moreira, E.L.G.; de Oliveira, J.; Engel, D.F.; Walz, R.; de Bem, A.F.; Farina, M.; Prediger, R.D.S. Hypercholesterolemia induces short-term spatial memory impairments in mice: Up-regulation of acetylcholinesterase activity as an early and causal event? J. Neur. Transm. 2014, 121, 415–426. [Google Scholar] [CrossRef] [PubMed]
- Chuang, C.S.; Lin, C.L.; Lin, M.C.; Sung, F.C.; Kao, C.H. Decreased prevalence of dementia associated with statins: A national population-based study. Eur. J. Neurol. 2015, 22, 912–918. [Google Scholar] [CrossRef] [PubMed]
- Losso, J.N. The Potential of Dietary Bioactive Compounds against SARS-CoV-2 and COVID-19-Induced Endothelial Dysfunction. Molecules 2022, 27, 1623. [Google Scholar] [CrossRef] [PubMed]
- Oksman, M.; Iivonen, H.; Hogyes, E.; Amtul, Z.; Penke, B.; Leenders, I.; Broersen, L.; Lütjohann, D.; Hartmann, T.; Tanila, H. Impact of different saturated fatty acid, polyunsaturated fatty acid and cholesterol containing diets on beta-amyloid accumulation in APP/PS1 transgenic mice. Neurobiol. Dis. 2006, 23, 563–572. [Google Scholar] [CrossRef]
- Li, J.; Pora, B.L.; Dong, K.; Hasjim, J. Health benefits of docosahexaenoic acid and its bioavailability: A review. Food Sci. Nutr. 2021, 9, 5229–5243. [Google Scholar] [CrossRef] [PubMed]
- Md Zamri, N.D.; Imam, M.U.; Abd Ghafar, S.A.; Ismail, M. Antioxidative Effects of Germinated Brown Rice-Derived Extracts on H2O2-Induced Oxidative Stress in HepG2 Cells. Evid Based Complement Alternat. Med. 2014, 2014, 371907. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Demeekul, K.; Suthammarak, W.; Petchdee, S. Bioactive Compounds from Germinated Brown Rice Protect Cardiomyocytes Against Simulated Ischemic/Reperfusion Injury by Ameliorating Mitochondrial Dysfunction. Drug Des. Dev. Ther. 2021, 15, 1055–1066. [Google Scholar] [CrossRef] [PubMed]
- Amato, A.; Terzo, S.; Mulè, F. Natural compounds as beneficial antioxidant agents in neurodegenerative disorders: A focus on Alzheimer’s disease. Antioxidants 2019, 8, 608. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, R.; Lu, H.; Tian, S.; Yin, J.; Chen, Q.; Ma, L.; Cui, S.; Niu, Y. Protective effects of pre-germinated brown rice diet on low levels of Pbinduced learning and memory deficits in developing rat. Chem. Biol. Interact. 2010, 184, 484–491. [Google Scholar] [CrossRef] [PubMed]
- Azmi, N.H.; Ismail, M.; Ismail, N.; Imam, M.U.; Alitheen, N.B.M.; Abdullah, M.A. Germinated brown rice alters Aβ (1-42) aggregation and modulates Alzheimer’s disease-related genes in differentiated human SH-SY5Y cells. Evid. Based Complement. Altern. Med. 2015, 2015, 153684. [Google Scholar] [CrossRef] [Green Version]
- Bilyaminu, A.; Yakasai, H.M.; Zawawi, N.; Ismail, M. Compositional analyses of white, brown and germinated forms of popular Malaysian rice to offer insight into the growing diet-related diseases. J. Food Drug Anal. 2018, 26, 706–715. [Google Scholar]
- Ismail, N.; Ismail, M.; Azmi, N.H.; Bakar, M.F.A.; Yida, Z.; Abdullah, M.A.; Basri, H. Thymoquinone-rich fraction nanoemulsion (TQRFNE) decreases Aβ40 and Aβ42 levels by modulating APP processing, up-regulating IDE and LRP1, and down-regulating BACE1 and RAGE in response to high fat/cholesterol diet-induced rats. Biomed. Pharmacother. 2017, 95, 780–788. [Google Scholar] [CrossRef]
- Shudo, J.; Pongpeerapat, A.; Wanawongthai, C.; Moribe, K.; Yamamoto, K. In vivo assessment of oral administration of probucol nanoparticles in rats. Biol. Pharm. Bull. 2008, 31, 321–325. [Google Scholar] [CrossRef] [Green Version]
- Yida, Z.; Imam, M.U.; Ismail, M.; Hou, Z.; Abdullah, M.A.; Ideris, A.; Ismail, N. Edible Bird’s Nest attenuates high fat diet-induced oxidative stress and inflammation via regulation of hepatic antioxidant and inflammatory genes. BMC Complement. Alt. Med. 2015, 15, 1–7. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stein, C.; Julia, H.; Helene, L.; Jochen, K. Effects of Ginkgo biloba extract EGb 761, donepezil and their combination on central cholinergic function in aged rats. J. Pharm. Pharm. Sci. 2015, 18, 634–646. [Google Scholar] [CrossRef] [Green Version]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analyt. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Van Dam, D.; De Deyn, P.P. Animal models in the drug discovery pipeline for Alzheimer’s disease. Br. J. Pharmacol. 2011, 164, 1285–1300. [Google Scholar] [CrossRef]
- Ou, Z.; Deng, L.; Lu, Z.; Wu, F.; Liu, W.; Huang, D.; Peng, Y. Protective effects of Akkermansia muciniphila on cognitive deficits and amyloid pathology in a mouse model of Alzheimer’s disease. Nutr. Diabetes 2020, 10, 12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Abi, I.; Adeniyi, S.O.; Imam, M.U. An assessment of the neurobehavioural effect of cannabidiol and omega-3 in high-fat–diet-induced dementia in albino mice. Alzheimer’s Dement. 2021, 17, e057466. [Google Scholar] [CrossRef]
- Banks, W.A.; Abrass, C.K.; Hansen, K.M. Differentiating the influences of aging and adiposity on brain weights, levels of serum and brain cytokines, gastrointestinal hormones, and amyloid precursor protein. J. Gerontol. Ser. A Biol. Sci. Med. Sci. 2016, 71, 21–29. [Google Scholar] [CrossRef] [Green Version]
- Moy, G.A.; McNay, E.C. Caffeine prevents weight gain and cognitive impairment caused by a high-fat diet while elevating hippocampal BDNF. Physiol. Behav. 2013, 109, 69–74. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Choi, H.D.; Kim, Y.S.; Choi, I.W.; Seog, H.M.; Park, Y.D. Anti-obesity and cholesterol-lowering effects of germinated brown rice in rats fed with high fat and cholesterol diets. Korean J. Food Sci. Technol. 2006, 38, 674–678. [Google Scholar]
- Hao, C.-L.; Lin, H.-L.; Ke, L.-Y.; Yen, H.-W.; Shen, K.-P. Pre-germinated brown rice extract ameliorates high-fat diet-induced metabolic syndrome. J. Food Biochem. 2019, 43, e12769. [Google Scholar] [CrossRef]
- Lim, S.M.; Goh, Y.M.; Kuan, W.B.; Loh, S.P. Effect of germinated brown rice extracts on pancreatic lipase, adipogenesis and lipolysis in 3T3-L1 adipocytes. Lipids Health Dis. 2014, 13, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Bulanawichit, W.; Kirdin, T.; Boonsong, T. Effects of brown rice and germinated brown rice extracts from Thai rice cultivars (PL2 and KDML105) on adipogenic, adipocytokine, and antioxidant genes in 3T3-L1 adipocytes. J. Nat. Sci 2018, 17, 79–96. [Google Scholar] [CrossRef]
- Seo, Y.; Shin, Y.; Kim, H.S.; Kang, I.; Hong, I.S.; Choi, S.W.; Yu, K.R.; Kang, K.S. Donepezil enhances Purkinje cell survival and alleviates motor dysfunction by inhibiting cholesterol synthesis in a murine model of Niemann pick disease type C. J. Neuropathol. Exp. Neurol. 2014, 73, 234–243. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Imam, M.U.; Ismail, M.; Omar, A.R.; Ithnin, H. The hypocholesterolemic effect of germinated brown rice involves the upregulation of the apolipoprotein A1 and low-density lipoprotein receptor genes. J. Diabetes Res. 2013, 2013, 134694. [Google Scholar] [CrossRef] [PubMed]
- Mohd. Esa, N.; Abdul Kadir, K.K.; Amom, Z.; Azlan, A. Improving the lipid profile in hypercholesterolemia-induced rabbit by supplementation of germinated brown rice. J. Agric. Food Chem. 2011, 59, 7985–7991. [Google Scholar] [CrossRef]
- Imam, M.U.; Musa, S.N.A.; Azmi, N.H.; Ismail, M. Effects of white rice, brown rice and germinated brown rice on antioxidant status of type 2 diabetic rats. Int. J. Mol. Sci. 2012, 13, 12952–12969. [Google Scholar] [CrossRef]
- Imam, M.U.; Ishaka, A.; Ooi, D.J.; Zamri, N.D.M.; Sarega, N.; Ismail, M.; Mohd. Esa, N. Germinated brown rice regulates hepatic cholesterol metabolism and cardiovascular disease risk in hypercholesterolaemic rats. J. Funct. Foods 2014, 8, 193–203. [Google Scholar] [CrossRef]
- Mehta, B.K.; Singh, K.K.; Banerjee, S. Effect of exercise on type 2 diabetes-associated cognitive impairment in rats. Int. J. Neurosci. 2019, 129, 252–263. [Google Scholar] [CrossRef]
- Jayaraman, R.; Subramani, S.; Sheik Abdullah, S.H.; Udaiyar, M. Antihyperglycemic effect of hesperetin, a citrus flavonoid, extenuates hyperglycemia and exploring the potential role in antioxidant and antihyperlipidemic in streptozotocin-induced diabetic rats. Biomed. Pharmacother. 2018, 97, 98–106. [Google Scholar] [CrossRef]
- Ashfaq, F.; Butt, M.S.; Bilal, A.; Suleria, H.A.R. Hepatoprotective effects of red cabbage in hypercholesterolemic diet-induced oxidative stressed rabbits. Curr. Bioact. Compd. 2020, 16, 469–480. [Google Scholar] [CrossRef]
- Halliwell, B.; Gutteridge, J.M. Oxygen radicals and the nervous system. Trends Neurosci. 1985, 8, 22–26. [Google Scholar] [CrossRef]
- Walsh, T.J.; Emerich, D.F. The hippocampus as a common target of neurotoxic agents. Toxicology 1988, 49, 137–140. [Google Scholar] [CrossRef]
- Norsharina, I.; Ismail, M.; Azmi, N.H.; Firdaus, M.; Bakar, A.; Yida, Z.; Stanslas, J.; Sani, D.; Basri, H.; Abdullah, M.A. Beneficial effects of TQRF and TQ nano-and conventional emulsions on memory deficit, lipid peroxidation, total antioxidant status, antioxidants genes expression and soluble Aβ levels in high fat-cholesterol diet-induced rats. Chem. Biol. Interact. 2017, 275, 61–73. [Google Scholar]
- Murakami, K.; Murata, N.; Noda, Y.; Tahara, S.; Kaneko, T.; Kinoshita, N.; Hatsuta, H.; Murayama, S.; Barnham, K.J.; Irie, K.; et al. SOD1 (copper/zinc superoxide dismutase) deficiency drives amyloid β protein oligomerization and memory loss in mouse model of Alzheimer disease. J. Biol. Chem. 2011, 286, 44557–44568. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jin, S.Y.; Wang, X.; Xiang, X.T.; Wu, Y.M.; Hu, J.; Li, Y.Y.; Dong, Y.L.; Tan, Y.Q.; Wu, X. Inhibition of GPR17 with cangrelor improves cognitive impairment and synaptic deficits induced by Aβ1–42 through Nrf2/HO-1 and NF-κB signaling pathway in mice. Int. Immunopharmacol. 2021, 101, 108335. [Google Scholar] [CrossRef] [PubMed]
- Martindale, J.L.; Holbrook, N.J. Cellular response to oxidative stress: Signaling for suicide and survival. J. Cell. Physiol. 2002, 192, 1–15. [Google Scholar] [CrossRef] [PubMed]
- Fong, W.H.; Tsai, H.D.; Chen, Y.C.; Wu, J.S.; Lin, T.N. Anti-apoptotic actions of ppar-γ against ischemic stroke. Mol. Neurobiol. 2010, 41, 180–186. [Google Scholar] [CrossRef] [PubMed]
- Ismail, R.; Parbo, P.; Madsen, L.S.; Hansen, A.K.; Hansen, K.V.; Schaldemose, J.L.; Kjeldsen, P.L.; Stokholm, M.G.; Gottrup, H.; Eskildsen, S.F.; et al. The relationships between neuroinflammation, beta-amyloid and tau deposition in Alzheimer’s disease: A longitudinal PET study. J. Neuroinflam. 2020, 17, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Thirumangalakudi, L.; Prakasam, A.; Zhang, R.; Bimonte-Nelson, H.; Sambamurti, K.; Kindy, M.S.; Bhat, N.R. High cholesterol-induced neuroinflammation and amyloid precursor protein processing correlate with loss of working memory in mice. J. Neurochem. 2008, 106, 475–485. [Google Scholar] [CrossRef] [Green Version]
- Zlokovic, B.V. Neurovascular mechanisms of Alzheimer’s neurodegeneration. Trends Neurosci. 2005, 28, 202–208. [Google Scholar] [CrossRef] [PubMed]
- Charlton, R.A.; Lamar, M.; Zhang, A.; Ren, X.; Ajilore, O.; Pandey, G.N.; Kumar, A. Associations between pro-inflammatory cytokines, learning, and memory in late-life depression and healthy aging. Int. J. Geriatr. Psyc. 2018, 33, 104–112. [Google Scholar] [CrossRef] [Green Version]
- Bourgognon, J.-M.; Cavanagh, J. The role of cytokines in modulating learning and memory and brain plasticity. Brain Neurosci. Adv. 2020, 4, 2398212820979802. [Google Scholar] [CrossRef]
- Munishamappa, V.; Seethalakshmi; Vijayakumar, A.E.; Rajathilagam, T. Evaluation of the antioxidant activity of donepezil-in vitro study. Nat. J. Physiol. Pharm. Pharmacol. 2019, 9, 108. [Google Scholar]
- Liu, J.; Lee, T.J.F. Mechanism of prejunctional muscarinic receptormediated inhibition of neurogenic vasodilation in cerebral arteries. Am. J. Physiol. Heart Circ. Physiol. 1999, 276, 194–204. [Google Scholar] [CrossRef]
- Priyanka, H.P.; Singh, R.V.; Mishra, M.; ThyagaRajan, S. Diverse agerelated effects of Bacopa monnieri and donepezil in vitro on cytokine production, antioxidant enzyme activities, and intracellular targets in splenocytes of F344 male rats. Int. Immunopharmacol. 2013, 15, 260–274. [Google Scholar] [CrossRef] [PubMed]
- Cheng, X.; Shen, Y.; Li, R. Targeting TNF: A therapeutic strategy for Alzheimer’s disease. Drug Discov. Today 2014, 19, 1822–1827. [Google Scholar] [CrossRef] [PubMed]
- Luan, Y.-Y.; Yao, Y.M. The clinical significance and potential role of C-reactive protein in chronic inflammatory and neurodegenerative diseases. Front. Immunol. 2018, 9, 1302. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chung, H.-J.; Kim, M.; Jung, J.; Jeong, N.Y. Inhibition of neuronal nitric oxide synthase by ethyl pyruvate in schwann cells protects against peripheral nerve degeneration. Neurochem. Res. 2019, 44, 1964–1976. [Google Scholar] [CrossRef]
- Bi, B.-T.; Lin, H.-B.; Cheng, Y.-F.; Zhou, H.; Lin, T.; Zhang, M.-Z.; Li, T.-J.; Xu, J.-P. Promotion of β-amyloid production by C-reactive protein and its implications in the early pathogenesis of Alzheimer’s disease. Neurochem. Int. 2012, 60, 257–266. [Google Scholar] [CrossRef]
- Hilal, S.; Ikram, M.A.; Verbeek, M.M.; Franco, O.H.; Stoops, E.; Vanderstichele, H.; Niessen, W.J.; Vernooij, M.W. C-reactive protein, plasma amyloid-β levels, and their interaction with magnetic resonance imaging markers. Stroke 2018, 49, 2692–2698. [Google Scholar] [CrossRef]
- Evi, P.; Tzara, O.; Zenelak, S.; Georgopoulos, S. Genetic deletion of tumor necrosis factor-α attenuates amyloid-β production and decreases amyloid plaque formation and glial response in the 5xfad model of Alzheimer’s disease. J. Alzheimer’s Dis. 2017, 60, 165–181. [Google Scholar]
- Clark, I.A.; Vissel, B. Therapeutic implications of how TNF links apolipoprotein E, phosphorylated tau, α-synuclein, amyloid-β and insulin resistance in neurodegenerative diseases. Br. J. Pharmacol. 2018, 175, 3859–3875. [Google Scholar] [CrossRef]
- Blasko, I.; Marx, F.; Steiner, E.; Hartmann, T.; Grubeck-Loebenstein, B. TNFα plus IFNγ induce the production of Alzheimer’s β-amyloid peptides and decrease the secretion of APPs. FASEB J. 1999, 13, 63–68. [Google Scholar] [CrossRef] [PubMed]
- Husain, I.; Akhtar, M.; Abdin, M.Z.; Islamuddin, M.; Shaharyar, M.; Najmi, A.K. Rosuvastatin ameliorates cognitive impairment in rats fed with high-salt and cholesterol diet via inhibiting acetylcholinesterase activity and amyloid beta peptide aggregation. Hum. Exp. Toxicol. 2018, 37, 399–411. [Google Scholar] [CrossRef] [PubMed]
- Kosari, S.; Badoer, E.; Nguyen, J.C.; Killcross, A.S.; Jenkins, T.A. Effect of western and high fat diets on memory and cholinergic measures in the rat. Behav. Brain Res. 2012, 235, 98–103. [Google Scholar] [CrossRef] [PubMed]
- Kaizer, R.R.; Da Silva, A.C.; Morsch, V.M.; Corrêa, M.C.; Schetinger, M.R. Diet-induced changes in AChE activity after long-term exposure. Neurochem. Res. 2004, 29, 2251–2255. [Google Scholar] [CrossRef]
- Cibicková, L.; Palicka, V.; Cibicek, N.; Cermakova, E.; Micuda, S.; Bartosova, L.; Jun, D. Differential effects of statins and alendronate on cholinesterases in serum and brain of rats. Physiol. Res. 2007, 56, 765–770. [Google Scholar] [CrossRef] [PubMed]
- Srivastava, Anant, and Rishabh Singh. Pharmacological evaluation of combined neuroprotective effect of Melatonin and Simvastatin against LPS and STZ induced memory impairment in rodents. Asian J. Pharm. Pharmacol. 2019, 5, 316–325. [Google Scholar] [CrossRef]
- Fang, L.; Kraus, B.; Lehmann, J.; Heilmann, J.; Zhang, Y.; Decker, M. Design and synthesis of tacrine–ferulic acid hybrids as multi-potent antiAlzheimer drug candidates. Bioorg. Med. Chem. Lett. 2008, 18, 2905–2909. [Google Scholar] [CrossRef]
- Kumar, P.; Singh, V.K.; Singh, D.K. Kinetics of enzyme inhibition by active molluscicidal agents ferulic acid, umbelliferone, eugenol and limonene in the nervous tissue of snail Lymnaea acuminata. Phytother. Res. 2009, 23, 172–177. [Google Scholar] [CrossRef]
- Henstridge, C.M.; Hyman, B.T.; Spires-Jones, T.L. Beyond the neuron–cellular interactions early in Alzheimer disease pathogenesis. Nat. Rev. Neurosci. 2019, 20, 94–108. [Google Scholar] [CrossRef]
- Tiwari, S.; Atluri, V.; Kaushik, A.; Yndart, A.; Nair, M. Alzheimer’s disease: Pathogenesis, diagnostics, and therapeutics. Int. J. Nanomed. 2019, 14, 5541. [Google Scholar] [CrossRef] [Green Version]
Group | Oral Gavage Treatment | Food Composition | Calorie (kcal/100 g Food) | ||||
---|---|---|---|---|---|---|---|
Normal Pellet | Oil | Corn Starch | Cholesterol | Cholic Acid | |||
Control | Normal saline | 100% | - | - | - | - | 335 |
HFD | Normal saline | 65% | 20% | 10% | 4.5% | 0.5% | 437.75 |
Donepezil | 1.5 mg/kg BW Donepezil | 65% | 20% | 10% | 4.5% | 0.5% | 437.75 |
Simvastatin | 10 mg/kg BW Simvastatin | 65% | 20% | 10% | 4.5% | 0.5% | 437.75 |
Probucol | 200 mg/kg BW Probucol | 65% | 20% | 10% | 4.5% | 0.5% | 437.75 |
GBR-EA100 | 100 mg/kg BW GBR-EA extract | 65% | 20% | 10% | 4.5% | 0.5% | 437.75 |
GBR-EA200 | 200 mg/kg BW GBR-EA extract | 65% | 20% | 10% | 4.5% | 0.5% | 437.75 |
Gene | Accession Number | Primer Sequences with Universal Tags (Underlined) | |
---|---|---|---|
Forward (5′-3′) | Reverse (3′-5′) | ||
ACTB a | NM_031144 | AGGTGACACTATAGAATAGGCATCCTGACCCTGAAGTA | GTACGACTCACTATAGGGAAGACGCAGGATGGCATGAG |
Atp50a | NM_138883 | AGGTGACACTATAGAATACTCTCTGAGTTAAAGACAGTGCTGA | GTACGACTCACTATAGGGAACAATCATCCCACCCATGAT |
Cyclophilin A a | NM_017101 | AGGTGACACTATAGAATATTCTGTAGCTCAGGAGAGCA | GTACGACTCACTATAGGGATTGAAGGGGAATGAGGAAAA |
GAPDH a,# | NM_017008 | AGGTGACACTATAGAATACTGAGGACCAGGTTGTCTCC | GTACGACTCACTATAGGGAGAGGGCCTCTCTCTTGCTCT |
Kan(r) b | - | ||
AChE | NM_172009 | AGGTGACACTATAGAATAAGTTCGACCACTATAGCAAG | GTACGACTCACTATAGGGAAAGATGAGGATCCCCTAGT |
Catalase | NM_012520 | AGGTGACACTATAGAATAACTGCAAGTTCCATTACAAG | GTACGACTCACTATAGGGAGTTCAACTTCAGCAAAATAAT |
CRP | NM_017096 | AGGTGACACTATAGAATACTAAACAGGCCTTCGTATT | GTACGACTCACTATAGGGACAAGCCAAAGCTCTACAAT |
GPX | NM_030826 | AGGTGACACTATAGAATATTGAGAAGTTCCTGGTAGGT | GTACGACTCACTATAGGGATTTTCTGGAAATCAGGTGT |
NOS1 | NM_052799 | AGGTGACACTATAGAATAAACTCTCGATACAACATCCT | GTACGACTCACTATAGGGACTTGTCACTCTGGAAGCTA |
PPAR-γ | NM_013124 | AGGTGACACTATAGAATAAAATCTCTGTTTTATGCTGTTA | GTACGACTCACTATAGGGACAACCATGGTAATTTCTTGT |
SOD1 | NM_017050 | AGGTGACACTATAGAATATCAATATGGGGACAATACAC | GTACGACTCACTATAGGGATACTTTCTTCATTTCCACCTT |
SOD2 | NM_017051 | AGGTGACACTATAGAATATGTATGAAAGTGCTCAAGAT | GTACGACTCACTATAGGGAGCCCTCTTGTGAGTATAAGT |
SOD3 | NM_012880 | AGGTGACACTATAGAATATCGAACTACTTTATGCCC | GTACGACTCACTATAGGGAGAAGACAAACGAGGTCTCTA |
TNF-α | NM_012675 | AGGTGACACTATAGAATACCCAACAAGGAGGAGA | GTACGACTCACTATAGGGATGGTGGTTTGCTACGA |
Groupings | Food Intake | Initial Weight (g) | Final Weight (g) | Weight Gain (g) |
---|---|---|---|---|
(kcal/100 g BW/day) | ||||
Normal | 15.57 ±6.48 a | 259.63 ± 12.33 a | 424.25 ± 19.09 a | 164.63 ± 11.92 a |
HFD | 16.58 ± 6.44 a | 261.00 ± 29.03 a | 479.80 ± 43.72 a | 218.80 ± 27.34 b |
Donepezil | 18.73 ± 6.81 a | 262.50 ± 14.39 a | 422.50 ± 22.12 a | 160.00 ± 28.16 a,b |
Simvastatin | 18.78 ± 2.68 a | 257.25 ± 19.92 a | 425.00 ± 31.94 a | 167.75 ± 38.14 a,b |
Probucol | 17.12 ± 6.17 a | 274.71 ± 14.26 a | 448.71 ± 28.76 a | 174.00 ± 24.41 a,b |
GBR-EA100 | 17.37 ± 6.33 a | 252.18 ± 21.55 a | 426.00 ± 39.06 a | 173.82 ± 34.11 a,b |
GBR-EA200 | 18.65 ± 7.60 a | 260.00 ± 22.01 a | 426.33 ± 38.52 a | 166.33 ± 27.45 a,b |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Azmi, N.H.; Ismail, N.; Imam, M.U.; Ooi, D.J.; Oslan, S.N.H. Modulation of High-Fat Diet-Induced Brain Oxidative Stress by Ferulate-Rich Germinated Brown Rice Ethyl Acetate Extract. Molecules 2022, 27, 4907. https://doi.org/10.3390/molecules27154907
Azmi NH, Ismail N, Imam MU, Ooi DJ, Oslan SNH. Modulation of High-Fat Diet-Induced Brain Oxidative Stress by Ferulate-Rich Germinated Brown Rice Ethyl Acetate Extract. Molecules. 2022; 27(15):4907. https://doi.org/10.3390/molecules27154907
Chicago/Turabian StyleAzmi, Nur Hanisah, Norsharina Ismail, Mustapha Umar Imam, Der Jiun Ooi, and Siti Nur Hazwani Oslan. 2022. "Modulation of High-Fat Diet-Induced Brain Oxidative Stress by Ferulate-Rich Germinated Brown Rice Ethyl Acetate Extract" Molecules 27, no. 15: 4907. https://doi.org/10.3390/molecules27154907