Screening an In-House Isoquinoline Alkaloids Library for New Blockers of Voltage-Gated Na+ Channels Using Voltage Sensor Fluorescent Probes: Hits and Biases
Abstract
:1. Introduction
2. Results
2.1. VSP-FRET Assays Using GH3b6 for Pharmacological Characterization of NaV Channels
2.2. Screening Vegetal Alkaloids for Blockers of NaV Channels Using VSP in GH3b6 Cells
2.3. Effects of Oxostephanine, Liriodenine, Thalmiculine, Bebeerine, and Protopine on Intracellular Na+ Concentration in a Stable Cell Line Expressing hNaV1.3
2.4. Characterization of the Effects of Oxostephanine, Liriodenine, Thalmiculine, Bebeerine, and Protopine on Na+ Currents Elicited by the hNaV1.2, hNaV1.3, and hNaV1.6 Channels
3. Discussion
4. Materials and Methods
4.1. Chemicals
4.2. In-House Library of Vegetal Alkaloids
4.3. Cell Culture
4.4. Fluorescent Assays
4.5. Quantitative Real Time PCR
4.6. HPLC Analysis
4.7. Automated Patch-Clamp Experiments
4.8. Structural Analysis
4.9. Data Bank Search
4.10. Data Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
Sample Availability
Abbreviations
AUC | area under the curve |
BTX | batrachotoxin |
BBIQ | bisbenzylisoquinoline |
IA | isoquinoline alkaloids |
[Na+]i | intracellular Na+ concentration |
NaV channel | voltage-gated Na+ channel |
TTX | tetrodotoxin |
TTX-R | resistant to tetrodotoxin |
TTX-S | sensitive to tetrodotoxin |
VTD | veratridine |
References
- Hille, B. Ion Channels of Excitable Membranes, 3rd ed.Sinauer: Sunderland, MA, USA, 2001; ISBN 978-0-87893-321-1. [Google Scholar]
- Catterall, W.A.; Goldin, A.L.; Waxman, S.G. International Union of Pharmacology. XLVII. Nomenclature and Structure-Function Relationships of Voltage-Gated Sodium Channels. Pharmacol. Rev. 2005, 57, 397–409. [Google Scholar] [CrossRef] [PubMed]
- Eijkelkamp, N.; Linley, J.E.; Baker, M.D.; Minett, M.S.; Cregg, R.; Werdehausen, R.; Rugiero, F.; Wood, J.N. Neurological Perspectives on Voltage-Gated Sodium Channels. Brain 2012, 135, 2585–2612. [Google Scholar] [CrossRef] [PubMed]
- De Lera Ruiz, M.; Kraus, R.L. Voltage-Gated Sodium Channels: Structure, Function, Pharmacology, and Clinical Indications. J. Med. Chem. 2015, 58, 7093–7118. [Google Scholar] [CrossRef] [PubMed]
- Azimova, S.S.; Yunusov, M.S. (Eds.) Natural Compounds: Plant Sources, Structure and Properties; Springer reference; Springer: New York, NY, USA, 2013; ISBN 978-1-4614-0542-9. [Google Scholar]
- Amirkia, V.; Heinrich, M. Alkaloids as Drug Leads – A Predictive Structural and Biodiversity-Based Analysis. Phytochem. Lett. 2014, 10, xlviii–liii. [Google Scholar] [CrossRef]
- Wink, M. Modes of Action of Herbal Medicines and Plant Secondary Metabolites. Medicines 2015, 2, 251–286. [Google Scholar] [CrossRef]
- Wang, S.Y.; Wang, G.K. Voltage-Gated Sodium Channels as Primary Targets of Diverse Lipid-Soluble Neurotoxins. Cell. Signal. 2003, 15, 151–159. [Google Scholar] [CrossRef]
- Kontis, K.J.; Goldin, A.L. Site-Directed Mutagenesis of the Putative Pore Region of the Rat IIA Sodium Channel. Mol. Pharmacol. 1993, 43, 635–644. [Google Scholar] [PubMed]
- Terlau, H.; Heinemann, S.H.; Stuhmer, W.; Pusch, M.; Conti, F.; Imoto, K.; Numa, S. Mapping the Site of Block by Tetrodotoxin and Saxitoxin of Sodium Channel II. FEBS Lett. 1991, 293, 93–96. [Google Scholar] [CrossRef]
- Durán-Riveroll, L.; Cembella, A. Guanidinium Toxins and Their Interactions with Voltage-Gated Sodium Ion Channels. Mar. Drugs. 2017, 15, 303. [Google Scholar] [CrossRef] [PubMed]
- Tsukamoto, T.; Chiba, Y.; Wakamori, M.; Yamada, T.; Tsunogae, S.; Cho, Y.; Sakakibara, R.; Imazu, T.; Tokoro, S.; Satake, Y.; et al. Differential Binding of Tetrodotoxin and Its Derivatives to Voltage-sensitive Sodium Channel Subtypes (Nav 1.1 to Nav 1.7). J. Cereb. Blood Flow Metab. 2017, 174, 3881–3892. [Google Scholar] [CrossRef] [PubMed]
- Catterall, W.A. Activation of the Action Potential Na+ Ionophore by Neurotoxins. An Allosteric Model. J. Biol. Chem. 1977, 252, 8669–8676. [Google Scholar] [CrossRef]
- Tamkun, M.M.; Catterall, W.A. Ion Flux Studies of Voltage-Sensitive Sodium Channels in Synaptic Nerve-Ending Particles. Mol. Pharmacol. 1981, 19, 78–86. [Google Scholar] [PubMed]
- Ameri, A.; Simmet, T. Antagonism of the Aconitine-Induced Inexcitability by the Structurally Related Aconitum Alkaloids, Lappaconitine and Ajacine. Brain Res. 1999, 842, 332–341. [Google Scholar] [CrossRef]
- Li, Y.; Zheng, Y.; Yu, Y.; Gan, Y.; Gao, Z. Inhibitory Effects of Lappaconitine on the Neuronal Isoforms of Voltage-Gated Sodium Channels. Acta Pharmacol. Sin. 2019, 40, 451–459. [Google Scholar] [CrossRef]
- Sun, M.-L.; Ao, J.-P.; Wang, Y.-R.; Huang, Q.; Li, T.-F.; Li, X.-Y.; Wang, Y.-X. Lappaconitine, a C18-Diterpenoid Alkaloid, Exhibits Antihypersensitivity in Chronic Pain through Stimulation of Spinal Dynorphin A Expression. Psychopharmacology 2018, 235, 2559–2571. [Google Scholar] [CrossRef] [PubMed]
- Fischer, F.; Vonderlin, N.; Zitron, E.; Seyler, C.; Scherer, D.; Becker, R.; Katus, H.A.; Scholz, E.P. Inhibition of Cardiac Kv1.5 and Kv4.3 Potassium Channels by the Class Ia Anti-Arrhythmic Ajmaline: Mode of Action. Naunyn-Schmiedebergs Arch. Exp. Pathol. Pharmakol. 2013, 386, 991–999. [Google Scholar] [CrossRef] [PubMed]
- Friedrich, O.; V Wegner, F.; Wink, M.; Fink, R.H.A. Na+ and K+ -Channels as Molecular Targets of the Alkaloid Ajmaline in Skeletal Muscle Fibres: Ajmaline Action on Skeletal Muscle Cation Channels. J. Cereb. Blood Flow Metab. 2007, 151, 63–74. [Google Scholar] [CrossRef] [PubMed]
- Kiesecker, C.; Zitron, E.; Luck, S.; Bloehs, R.; Scholz, E.P.; Kathofer, S.; Thomas, D.; Kreye, V.A.W.; Katus, H.A.; Schoels, W.; et al. Class Ia Anti-Arrhythmic Drug Ajmaline Blocks HERG Potassium Channels: Mode of Action. Naunyn-Schmiedebergs Arch. Exp. Pathol. Pharmakol. 2004, 370, 423–435. [Google Scholar] [CrossRef] [PubMed]
- Miller, D.C.; Harmer, S.C.; Poliandri, A.; Nobles, M.; Edwards, E.C.; Ware, J.S.; Sharp, T.V.; McKay, T.R.; Dunkel, L.; Lambiase, P.D.; et al. Ajmaline Blocks I Na and I Kr without Eliciting Differences between Brugada Syndrome Patient and Control Human Pluripotent Stem Cell-Derived Cardiac Clusters. Stem Cell Res. 2017, 25, 233–244. [Google Scholar] [CrossRef]
- Rolf, S.; Bruns, H.; Wichter, T.; Kirchhof, P.; Ribbing, M.; Wasmer, K.; Paul, M.; Breithardt, G.; Haverkamp, W.; Eckardt, L. The Ajmaline Challenge in Brugada Syndrome: Diagnostic Impact, Safety, and Recommended Protocol. Eur. Hear. J. 2003, 24, 1104–1112. [Google Scholar] [CrossRef]
- Yu, G.; Qian, L.; Yu, J.; Tang, M.; Wang, C.; Zhou, Y.; Geng, X.; Zhu, C.; Yang, Y.; Pan, Y.; et al. Brucine Alleviates Neuropathic Pain in Mice via Reducing the Current of the Sodium Channel. J. Ethnopharmacol. 2019, 233, 56–63. [Google Scholar] [CrossRef] [PubMed]
- Splettstoesser, F.; Bonnet, U.; Wiemann, M.; Bingmann, D.; Büsselberg, D. Modulation of Voltage-Gated Channel Currents by Harmaline and Harmane: Harmala Alkaloids Modulate Voltage-Gated Currents. J. Cereb. Blood Flow Metab. 2005, 144, 52–58. [Google Scholar] [CrossRef] [PubMed]
- Zhao, F.; Tang, Q.; Xu, J.; Wang, S.; Li, S.; Zou, X.; Cao, Z. Dehydrocrenatidine Inhibits Voltage-Gated Sodium Channels and Ameliorates Mechanic Allodia in a Rat Model of Neuropathic Pain. Toxins 2019, 11, 229. [Google Scholar] [CrossRef] [PubMed]
- Bentley, K.W. β-Phenylethylamines and the Isoquinoline Alkaloids. Nat. Prod. Rep. 2006, 23, 444–463. [Google Scholar] [CrossRef] [PubMed]
- Chang, G.-J.; Wu, M.-H.; Wu, Y.-C.; Su, M.-J. Electrophysiological Mechanisms for Antiarrhythmic Efficacy and Positive Inotropy of Liriodenine, a Natural Aporphine Alkaloid from Fissistigma Glaucescens. J. Cereb. Blood Flow Metab. 1996, 118, 1571–1583. [Google Scholar] [CrossRef]
- Xiao-Shan, H.; Qing, L.; Yun-Shu, M.; Ze-Pu, Y. Crebanine Inhibits Voltage-Dependent Na+ Current in Guinea-Pig Ventricular Myocytes. Chin. J. Nat. Med. 2014, 12, 20–23. [Google Scholar] [CrossRef]
- Wang, J.; Ma, Y.; Sachs, F.; Li, J.; Suchyna, T.M. GsMTx4-D Is a Cardioprotectant against Myocardial Infarction during Ischemia and Reperfusion. J. Mol. Cell. Cardiol. 2016, 98, 83–94. [Google Scholar] [CrossRef]
- Araújo, D.A.M.; Mafra, R.A.; Rodrigues, A.L.P.; Miguel-Silva, V.; Beirão, P.S.L.; De Almeida, R.N.; Quintans, L.; Souza, M.F.V.de; Cruz, J.S. N-Salicyloyltryptamine, a New Anticonvulsant Drug, Acts on Voltage-Dependent Na+, Ca2+, and K+ Ion Channels: N-Salicyloyltryptamine Acts on Voltage-Dependent Ion Channels. J. Cereb. Blood Flow Metab. 2003, 140, 1331–1339. [Google Scholar] [CrossRef]
- Baroni, D.; Picco, C.; Barbieri, R.; Moran, O. Antisense-Mediated Post-Transcriptional Silencing of SCN1B Gene Modulates Sodium Channel Functional Expression: Silencing of SCN1B Gene Modulates the Sodium Channel Expression. Biol. Cell 2014, 106, 13–29. [Google Scholar] [CrossRef]
- Campos, F.V.; Coronas, F.I.V.; Beirão, P.S.L. Voltage-Dependent Displacement of the Scorpion Toxin Ts3 from Sodium Channels and Its Implication on the Control of Inactivation: Scorpion Toxin and Sodium Channel Inactivation. J. Cereb. Blood Flow Metab. 2004, 142, 1115–1122. [Google Scholar] [CrossRef]
- So, E.C.; Wu, S.-N.; Lo, Y.-C.; Su, K. Differential Regulation of Tefluthrin and Telmisartan on the Gating Charges of I Na Activation and Inactivation as Well as on Resurgent and Persistent I Na in a Pituitary Cell Line (GH3). Toxicol. Lett. 2018, 285, 104–112. [Google Scholar] [CrossRef] [PubMed]
- Wu, S.-N.; Wu, Y.-H.; Chen, B.-S.; Lo, Y.-C.; Liu, Y.-C. Underlying Mechanism of Actions of Tefluthrin, a Pyrethroid Insecticide, on Voltage-Gated Ion Currents and on Action Currents in Pituitary Tumor (GH3) Cells and GnRH-Secreting (GT1-7) Neurons. Toxicology 2009, 258, 70–77. [Google Scholar] [CrossRef] [PubMed]
- Réthoré, L.; Park, J.; Montnach, J.; Nicolas, S.; Khoury, J.; Le Seac’h, E.; Mabrouk, K.; De Pomyers, H.; Tricoire-Leignel, H.; Mattei, C.; et al. Pharmacological Dissection of the Crosstalk between NaV and CaV Channels in GH3b6 Cells. Int. J. Mol. Sci. 2022, 23, 827. [Google Scholar] [CrossRef] [PubMed]
- Baroni, D.; Moran, O. Molecular Differential Expression of Voltage-Gated Sodium Channel Alpha and Beta Subunit MRNAs in Five Different Mammalian Cell Lines. J. Bioenerg. Biomembr. 2011, 43, 729–738. [Google Scholar] [CrossRef]
- Vega, A.V.; Espinosa, J.L.; Lopez-Dominguez, A.M.; Lopez-Santiago, L.F.; Navarrete, A.; Cota, G. L-Type Calcium Channel Activation up-Regulates the MRNAs for Two Different Sodium Channel Alpha Subunits (Nav1.2 and Nav1.3) in Rat Pituitary GH3 Cells. Mol. Brain Res. 2003, 116, 115–125. [Google Scholar] [CrossRef]
- Iamshanova, O.; Mariot, P.; Lehen’kyi, V.; Prevarskaya, N. Comparison of Fluorescence Probes for Intracellular Sodium Imaging in Prostate Cancer Cell Lines. Eur. Biophys. J. 2016, 45, 765–777. [Google Scholar] [CrossRef]
- Stojilkovic, S.S.; Tabak, J.; Bertram, R. Ion Channels and Signaling in the Pituitary Gland. Endocr. Rev. 2010, 31, 845–915. [Google Scholar] [CrossRef]
- Yang, L.; Li, Q.; Liu, X.; Liu, S. Roles of Voltage-Gated Tetrodotoxin-Sensitive Sodium Channels NaV1.3 and NaV1.7 in Diabetes and Painful Diabetic Neuropathy. Int. J. Mol. Sci. 2016, 17, 1479. [Google Scholar] [CrossRef]
- Zhao, F.; Li, X.; Jin, L.; Zhang, F.; Inoue, M.; Yu, B.; Cao, Z. Development of a Rapid Throughput Assay for Identification of HNav1.7 Antagonist Using Unique Efficacious Sodium Channel Agonist, Antillatoxin. Mar. Drugs. 2016, 14, 36. [Google Scholar] [CrossRef]
- Gonzalez, J.E.; Tsien, R.Y. Improved Indicators of Cell Membrane Potential That Use Fluorescence Resonance Energy Transfer. Chem. Biol. 1997, 4, 269–277. [Google Scholar] [CrossRef]
- Liu, C.J.; Priest, B.T.; Bugianesi, R.M.; Dulski, P.M.; Felix, J.P.; Dick, I.E.; Brochu, R.M.; Knaus, H.G.; Middleton, R.E.; Kaczorowski, G.J.; et al. A High-Capacity Membrane Potential FRET-Based Assay for NaV1.8 Channels. Assay Drug Dev. Technol. 2006, 4, 37–48. [Google Scholar] [CrossRef]
- Middleton, R.E.; Warren, V.A.; Kraus, R.L.; Hwang, J.C.; Liu, C.J.; Dai, G.; Brochu, R.M.; Kohler, M.G.; Gao, Y.D.; Garsky, V.M.; et al. Two Tarantula Peptides Inhibit Activation of Multiple Sodium Channels. Biochemistry 2002, 41, 14734–14747. [Google Scholar] [CrossRef] [PubMed]
- Williams, B.S.; Felix, J.P.; Priest, B.T.; Brochu, R.M.; Dai, K.; Hoyt, S.B.; London, C.; Tang, Y.S.; Duffy, J.L.; Parsons, W.H.; et al. Characterization of a New Class of Potent Inhibitors of the Voltage-Gated Sodium Channel Nav1.7. Biochemistry 2007, 46, 14693–14703. [Google Scholar] [CrossRef] [PubMed]
- Deuis, J.R.; Mueller, A.; Israel, M.R.; Vetter, I. The Pharmacology of Voltage-Gated Sodium Channel Activators. Neuropharmacology 2017, 127, 87–108. [Google Scholar] [CrossRef]
- Chernov-Rogan, T.; Li, T.; Lu, G.; Verschoof, H.; Khakh, K.; Jones, S.W.; Beresini, M.H.; Liu, C.; Ortwine, D.F.; McKerrall, S.J.; et al. Mechanism-Specific Assay Design Facilitates the Discovery of Nav1.7-Selective Inhibitors. Proc. Natl. Acad. Sci. USA 2018, 115, E792–E801. [Google Scholar] [CrossRef]
- Felix, J.P.; Williams, B.S.; Priest, B.T.; Brochu, R.M.; Dick, I.E.; Warren, V.A.; Yan, L.; Slaughter, R.S.; Kaczorowski, G.J.; Smith, M.M.; et al. Functional Assay of Voltage-Gated Sodium Channels Using Membrane Potential-Sensitive Dyes. Assay Drug Dev. Technol. 2004, 2, 260–268. [Google Scholar] [CrossRef]
- Du, Y.; Days, E.; Romaine, I.; Abney, K.K.; Kaufmann, K.; Sulikowski, G.; Stauffer, S.; Lindsley, C.W.; Weaver, C.D. Development and Validation of a Thallium Flux-Based Functional Assay for the Sodium Channel NaV1.7 and Its Utility for Lead Discovery and Compound Profiling. ACS Chem. Neurosci. 2015, 6, 871–878. [Google Scholar] [CrossRef] [PubMed]
- Du, Y.; Garden, D.P.; Wang, L.; Zhorov, B.S.; Dong, K. Identification of New Batrachotoxin-Sensing Residues in Segment IIIS6 of the Sodium Channel. J. Biol. Chem. 2011, 286, 13151–13160. [Google Scholar] [CrossRef] [PubMed]
- Chang, K.C.; Su, M.J.; Peng, Y.I.; Shao, C.C.; Wu, Y.C.; Tseng, Y.Z. Mechanical Effects of Liriodenine on the Left Ventricular-Arterial Coupling in Wistar Rats: Pressure-Stroke Volume Analysis. Br. J. Pharmacol. 2001, 133, 29–36. [Google Scholar] [CrossRef]
- Khamis, S.; Bibby, M.C.; Brown, J.E.; Cooper, P.A.; Scowen, I.; Wright, C.W. Phytochemistry and Preliminary Biological Evaluation of Cyathostemma Argenteum, a Malaysian Plant Used Traditionally for the Treatment of Breast Cancer. Phytother. Res. 2004, 18, 507–510. [Google Scholar] [CrossRef]
- Wang, T.S.; Luo, Y.P.; Wang, J.; He, M.X.; Zhong, M.G.; Li, Y.; Song, X.P. (+)-Rumphiin and Polyalthurea, New Compounds from the Stems of Polyalthia Rumphii. Nat. Prod. Commun. 2013, 8, 1427–1429. [Google Scholar] [CrossRef]
- Chen, C. Review on Pharmacological Activities of Liriodenine. Afr. J. Pharm. Pharmacol. 2013, 7, 1067–1070. [Google Scholar] [CrossRef]
- Coquerel, Q.R.R.; Demares, F.; Geldenhuys, W.J.; Le Ray, A.M.; Breard, D.; Richomme, P.; Legros, C.; Norris, E.; Bloomquist, J.R. Toxicity and Mode of Action of the Aporphine Plant Alkaloid Liriodenine on the Insect GABA Receptor. Toxicon 2021, 201, 141–147. [Google Scholar] [CrossRef] [PubMed]
- Lin, C.H.; Yang, C.M.; Ko, F.N.; Wu, Y.C.; Teng, C.M. Antimuscarinic Action of Liriodenine, Isolated from Fissistigma Glaucescens, in Canine Tracheal Smooth Muscle. Br. J. Pharmacol. 1994, 113, 1464–1470. [Google Scholar] [CrossRef] [PubMed]
- Medeiros, M.A.A.; Pinho, J.F.; De-Lira, D.P.; Barbosa-Filho, J.M.; Araújo, D.A.M.; Cortes, S.F.; Lemos, V.S.; Cruz, J.S. Curine, a Bisbenzylisoquinoline Alkaloid, Blocks L-Type Ca2+ Channels and Decreases Intracellular Ca2+ Transients in A7r5 Cells. Eur. J. Pharmacol. 2011, 669, 100–107. [Google Scholar] [CrossRef] [PubMed]
- Tashjian, A.H. Clonal Strains of Hormone-Producing Pituitary Cells. In Methods in Enzymology; Elsevier: Ansterdam, The Netherlands, 1979; Volume 58, pp. 527–535. ISBN 978-0-12-181958-3. [Google Scholar]
- Priest, B.T.; Garcia, M.L.; Middleton, R.E.; Brochu, R.M.; Clark, S.; Dai, G.; Dick, I.E.; Felix, J.P.; Liu, C.J.; Reiseter, B.S.; et al. A Disubstituted Succinamide Is a Potent Sodium Channel Blocker with Efficacy in a Rat Pain Model. Biochemistry 2004, 43, 9866–9876. [Google Scholar] [CrossRef]
- Colborn, J.M.; Kosoy, M.Y.; Motin, V.L.; Telepnev, M.V.; Valbuena, G.; Myint, K.S.; Fofanov, Y.; Putonti, C.; Feng, C.; Peruski, L. Improved Detection of Bartonella DNA in Mammalian Hosts and Arthropod Vectors by Real-Time PCR Using the NADH Dehydrogenase Gamma Subunit (NuoG). J. Clin. Microbiol. 2010, 48, 4630–4633. [Google Scholar] [CrossRef] [PubMed]
- Sun, J.; Sun, B.; Han, F.; Yan, S.; Yang, H.; Akio, K. Rapid HPLC Method for Determination of 12 Isoflavone Components in Soybean Seeds. Agric. Sci. China 2011, 10, 70–77. [Google Scholar] [CrossRef]
Sample | Inhibitory Effects (%) | Alkaloid Name | Plant Name | 210 nm * (%) | 280 nm * (%) | 1HNMR, | Acceptance |
---|---|---|---|---|---|---|---|
IA50 | 78.3 | tetrandine | Pachygone dasycarpa (Menispermaceae) | 76 | 67 | ND | No |
IA42 | 78.5 | gyrocarpusine | Gyrocarpus americanus (Hernandiaceae) | 68 | 52 | ND | No |
IA24 | 80.5 | oxostephanine | Stephania venosa (Menispermaceae) | 77 | 98 | Confirmed | Yes |
IA52 | 81.9 | bebeerine | Curarea candicans (Menispermaceae) | 83 | 100 | Confirmed | Yes |
IA14 | 84.4 | oxostephanine | Stephania venosa (Menispermaceae) | 91 | 99 | Confirmed | Yes |
IA49 | 91.1 | thalmiculine | Thalictrum cultratum (Ranunculaceae) | 93 | 85 | Confirmed | Yes |
IA36 | 92.2 | sukhodianine | Stephania venosa (Menispermaceae) | 65 | 81 | ND | No |
IA31 | 92.8 | tiliacorinine | Tiliacora racemosa (Menispermaceae) | 73 | 81 | ND | No |
IA39 | 99.1 | liriodenine | Stephania venosa (Menispermaceae) | 77 | 99 | Confirmed | Yes |
IA69 | 99.9 | protopine | Corydalis majori (Fumariaceae) | 85 | 75 | confirmed | Yes |
Sample | Alkaloid Name | Alkaloid Type | IC50 (µM) | Hill Slope | Maximum of Inhibition |
---|---|---|---|---|---|
IA14 | oxostephanine | oxoaporphine | 6.11 ± 0.09 | 0.78 ± 0.12 | 95.78 ± 6.99 |
IA39 | liriodenine | oxoaporphine | 5.00 ± 0.10 | 0.91 ± 0.19 | 83.78 ± 6.59 |
IA49 | thalmiculine | BBIQ | 0.38 ± 0.19 | 1.50 ± 0.93 | 31.07 ± 4.04 |
IA52 | bebeerine | BBIQ | 0.74 ± 0.11 | 1.04 ± 0.29 | 41.04 ± 3.44 |
IA69 | protopine | protopine | 3.97 ± 0.10 | 0.99 ± 0.19 | 64.67 ± 5.50 |
Activation | Inactivation | ||||
---|---|---|---|---|---|
Nav Channel Subtype | Condition | V1/2 (±SEM, mV) | Slope (±SEM) | V1/2 (±SEM, mV) | Slope (±SEM) |
hNaV1.2 | control | −29.5 ± 0.8 (n = 48) | 3.9 ± 0.2 | −61.8 ± 0.7 (n = 66) | −6.4 ± 0.1 |
+bebeerine | −29.1 ± 1.1 (n = 36) | 5.8 ± 0.3 1 | −62.3 ± 1.1 (n = 21) | −8.5 ± 0.3 4 | |
hNaV1.3 | control | −23.3 ± 0.7 (n = 61) | 4.9 ± 0.2 | −58.2 ± 0.6 (n = 54) | −7.1 ± 0.2 |
+bebeerine | −26.9 ± 0.7 (n = 51) | 6.4 ± 0.3 2 | −60.2 ± 0.9 (n = 26) | −8.9 ± 0.3 5 | |
hNaV1.6 | control | −22.5 ± 0.8 (n = 52) | 5.1 ± 0.2 | −59.0 ± 0.8 (n = 50) | −7.7 ± 0.3 |
+bebeerine | −22.1 ± 0.7 (n = 32) | 7.0 ± 0.3 3 | −60.2 ± 0.7 (n = 24) | −9.0 ± 0.3 6 |
Gene Name | GenBank Accession Number | Protein Name | Forward Primer (5’–3’) | Reverse Primer (5’–3’) | Amplicon Size (bp) |
---|---|---|---|---|---|
scn1a | NM_030875.1 | NaV1.1 | gttccgacatcgccagtt | catctcagtttcagtagttgttcca | 92 |
scn2a | NM_012647.1 | NaV1.2 | tggtgtccctggttggag | ccttatttctgtctcagtagttgtgc | 88 |
scn3a | NM_013119.1 | NaV1.3 | gcaccgtccattctaaccat | tttagcttcttgcataagaattgc | 92 |
scn4a | NM_013178.1 | NaV1.4 | ggcactgtctcgatttgagg | ttcatgatggaggggatagc | 71 |
scn5a | NM_013125.2 | NaV1.5 | tgccaccaatgccttgta | catgatgagcatgctaaagagc | 96 |
scn8a | NM_019266.2 | NaV1.6 | ggaagttttccatcatgaatcag | gctgttatgtcgggagagga | 70 |
scn9a | NM_133289 | NaV1.7 | cagcagatgttagaccgactca | actcgtgaactcagcagcag | 78 |
scn10a | NM_017247.1 | NaV1.8 | agaggaccccaagggaca | tggtggttttcacacttttgg | 59 |
scn11a | NM_019265.2 | NaV1.9 | cagaggacgatgcctctaaaa | ttctgggacagtcgtttggt | 60 |
gusb | NM_017015.2 | Gus | ctctggtggccttacctgat | cagactcaggtgttgtcatcg | 78 |
gapdh | NM_017008.3 | Gapdh | tgggaagctggtcatcaac | gcatcaccccatttgatgtt | 77 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Coquerel, Q.; Legendre, C.; Frangieh, J.; Waard, S.D.; Montnach, J.; Cmarko, L.; Khoury, J.; Hassane, C.S.; Bréard, D.; Siegler, B.; et al. Screening an In-House Isoquinoline Alkaloids Library for New Blockers of Voltage-Gated Na+ Channels Using Voltage Sensor Fluorescent Probes: Hits and Biases. Molecules 2022, 27, 4133. https://doi.org/10.3390/molecules27134133
Coquerel Q, Legendre C, Frangieh J, Waard SD, Montnach J, Cmarko L, Khoury J, Hassane CS, Bréard D, Siegler B, et al. Screening an In-House Isoquinoline Alkaloids Library for New Blockers of Voltage-Gated Na+ Channels Using Voltage Sensor Fluorescent Probes: Hits and Biases. Molecules. 2022; 27(13):4133. https://doi.org/10.3390/molecules27134133
Chicago/Turabian StyleCoquerel, Quentin, Claire Legendre, Jacinthe Frangieh, Stephan De Waard, Jérôme Montnach, Leos Cmarko, Joseph Khoury, Charifat Said Hassane, Dimitri Bréard, Benjamin Siegler, and et al. 2022. "Screening an In-House Isoquinoline Alkaloids Library for New Blockers of Voltage-Gated Na+ Channels Using Voltage Sensor Fluorescent Probes: Hits and Biases" Molecules 27, no. 13: 4133. https://doi.org/10.3390/molecules27134133
APA StyleCoquerel, Q., Legendre, C., Frangieh, J., Waard, S. D., Montnach, J., Cmarko, L., Khoury, J., Hassane, C. S., Bréard, D., Siegler, B., Fajloun, Z., De Pomyers, H., Mabrouk, K., Weiss, N., Henrion, D., Richomme, P., Mattei, C., Waard, M. D., Le Ray, A.-M., & Legros, C. (2022). Screening an In-House Isoquinoline Alkaloids Library for New Blockers of Voltage-Gated Na+ Channels Using Voltage Sensor Fluorescent Probes: Hits and Biases. Molecules, 27(13), 4133. https://doi.org/10.3390/molecules27134133