Inhibition of Lipid Accumulation and Adipokine Levels in Maturing Adipocytes by Bauhinia rufescens (Lam.) Stem Bark Extract Loaded Titanium Oxide Nanoparticles
Abstract
:1. Introduction
2. Results and Discussion
2.1. GC-MS Analysis
2.2. Characterization of TiO2 Nanoparticles
2.3. Cytotoxicity
2.4. Biosafety of BR-TiO2-NPs in hMSCs
2.5. Dose Determination Based on Lipid Accumulation Inhibition Potential by BR-TiO2-NPs
2.6. Mitochondrial Function and Oxidative Capacity
2.7. Adipogenesis and Lipolysis Related Gene Expressions
3. Materials and Methods
3.1. Preparation of Bauhinia rufescens (Lam.) (kulkul) Stem Bark Methanol Extract
3.2. GC-MS Analysis of the Extract
3.3. Synthesis of Titanium Oxide Nanoparticles
3.4. Characterization of Titanium Oxide Nanoparticles
3.5. In Vitro Study in Maturing Adipocytes
3.5.1. Chemicals
3.5.2. Human Mesenchymal Stem Cells (hMSCs) Culture and Adipocyte Differentiation
3.5.3. Cytotoxicity Analysis
3.5.4. Propidium Iodide Staining for Nuclear Damage Analysis in hMSCs
3.5.5. Experimental Design for the Antiobesity Study
3.5.6. Oil Red’O and Nile Red Staining Analysis to Determine Lipogenesis Levels
3.5.7. Mitochondrial Membrane Potential Using the JC-1 Staining Assay
3.5.8. Quantitative Polymerase Chain Reaction (qPCR) Analyses
3.5.9. Quantification of Protein Using ELISA
3.6. Statistical Analysis
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Sample Availability
References
- Ikram, M.; Javed, B.; Hassan, S.W.U.; Satti, S.H.; Sarwer, A.; Raja, N.I.; Mashwani, Z.-U. Therapeutic potential of biogenic titanium dioxide nanoparticles: A review on mechanistic approaches. Nanomedicine 2021, 16, 1429–1446. [Google Scholar] [CrossRef] [PubMed]
- Srinivasan, M.; Venkatesan, M.; Arumugam, V.; Natesan, G.; Saravanan, N.; Murugesan, S.; Ramachandran, S.; Ayyasamy, R.; Pugazhendhi, A. Green synthesis and characterization of titanium dioxide nanoparticles (TiO2 NPs) using Sesbania grandiflora and evaluation of toxicity in zebrafish embryos. Process. Biochem. 2019, 80, 197–202. [Google Scholar] [CrossRef]
- Nadeem, M.; Tungmunnithum, D.; Hano, C.; Abbasi, B.H.; Hashmi, S.S.; Ahmad, W.; Zahir, A. The current trends in the green syntheses of titanium oxide nanoparticles and their applications. Green Chem. Lett. Rev. 2018, 11, 492–502. [Google Scholar] [CrossRef] [Green Version]
- Iqbal, H.; Razzaq, A.; Uzair, B.; Ain, N.U.; Sajjad, S.; Althobaiti, N.A.; Albalawi, A.E.; Menaa, B.; Haroon, M.; Khan, M.; et al. Breast Cancer Inhibition by Biosynthesized Titanium Dioxide Nanoparticles Is Comparable to Free Doxorubicin but Appeared Safer in BALB/c Mice. Materials 2021, 14, 3155. [Google Scholar] [CrossRef] [PubMed]
- Batool, A.; Menaa, F.; Uzair, B.; Khan, B.A.; Menaa, B. Progress and Prospects in Translating Nanobiotechnology in Medical Theranostics. Curr. Nanosci. 2020, 16, 685–707. [Google Scholar] [CrossRef]
- Uzair, B.; Liaqat, A.; Iqbal, H.; Menaa, B.; Razzaq, A.; Thiripuranathar, G.; Rana, N.F.; Menaa, F. Green and Cost-Effective Synthesis of Metallic Nanoparticles by Algae: Safe Methods for Translational Medicine. Bioengineering 2020, 7, 129. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Cha, R.; Luo, H.; Hao, W.; Zhang, Y.; Jiang, X. Nanomaterials for the theranostics of obesity. Biomaterials 2019, 223, 119474. [Google Scholar] [CrossRef]
- Ding, Z.; Chen, M.; Tao, X.; Liu, Y.; He, J.; Wang, T.; Li, X. Synergistic Treatment of Obesity via Locally Promoting Beige Ad-ipogenesis and Antioxidative Defense in Adipose Tissues. ACS Biomater. Sci. Eng. 2021, 7, 727–738. [Google Scholar] [CrossRef]
- Modarresi, M.; Chahardoli, A.; Karimi, N.; Chahardoli, S. Variations of glaucine, quercetin and kaempferol contents in Nigella arvensis against Al2O3, NiO, and TiO2 nanoparticles. Heliyon 2020, 6, e04265. [Google Scholar] [CrossRef]
- Liu, R.; Zhang, X.; Pu, Y.; Yin, L.; Li, Y.; Zhang, X.; Liang, G.; Li, X.; Zhang, J. Small-sized titanium dioxide nanoparticles mediate immune toxicity in rat pulmonary alveolar macrophages in vivo. J. Nanosci. Nanotechnol. 2010, 10, 5161–5169. [Google Scholar] [CrossRef]
- Aliyu, A.; Ibrahim, M.; Musa, A.; Ibrahim, H.; Abdulkadir, I.; Oyewale, A. Evaluation of antioxidant activity of leaves extract of Bauhinia rufescens Lam. (Caesalpiniaceae). J. Med. Plant Res. 2009, 3, 563–567. [Google Scholar]
- Maillard, M.P.; Recio-Iglesias, M.C.; Saadou, M.; Stoeckli-Evans, H.; Hostettmann, K. Novel Antifungal Tetracyclic Compounds from Bauhinia rufescens Lam. Helv. Chim. Acta 1991, 74, 791–799. [Google Scholar] [CrossRef]
- Sivaranjani, V.; Philominathan, P. Synthesize of Titanium dioxide nanoparticles using Moringa oleifera leaves and evaluation of wound healing activity. Wound Med. 2016, 12, 1–5. [Google Scholar] [CrossRef]
- Kim, H.; Jeon, D.; Oh, S.; Nam, K.; Son, S.; Gye, M.C.; Shin, I. Titanium dioxide nanoparticles induce apoptosis by interfering with EGFR signaling in human breast cancer cells. Environ. Res. 2019, 175, 117–123. [Google Scholar] [CrossRef] [PubMed]
- Compaoré, M.; Lamien, C.E.; Lamien-Meda, A.; Vlase, L.; Kiendrebeogo, M.; Ionescu, C.; Nacoulma, O. Antioxidant, xanthine oxidase and lipoxygenase inhibitory activities and phenolics of Bauhinia rufescens Lam. (Caesalpiniaceae). Nat. Prod. Res. 2012, 26, 1069–1074. [Google Scholar] [CrossRef]
- Tucaliuc, R.-A.; Cotea, V.V.; Niculaua, M.; Tuchilus, C.; Mantu, D.; Mangalagiu, I.I. New pyridazine–fluorine derivatives: Synthesis, chemistry and biological activity. Part II. Eur. J. Med. Chem. 2013, 67, 367–372. [Google Scholar] [CrossRef]
- Ahmed, A.; Molvi, K.I.; Patel, H.M.; Ullah, R.; Bari, A. Synthesis of novel 2, 3, 5-tri-substituted thiazoles with anti-inflammatory and antibacterial effect causing clinical pathogens. J. Infect. Public Health 2020, 13, 472–479. [Google Scholar] [CrossRef]
- Saniewski, M.; Horbowicz, M.; Kanlayanarat, S. The Biological Activities of Troponoids and Their Use in Agriculture A Review. J. Hortic. Res. 2014, 22, 5–19. [Google Scholar] [CrossRef] [Green Version]
- Cao, F.; Orth, C.; Donlin, M.J.; Adegboyega, P.; Meyers, M.; Murelli, R.P.; Elagawany, M.; Elgendy, B.; Tavis, J.E. Synthesis and Evaluation of Troponoids as a New Class of Antibiotics. ACS Omega 2018, 3, 15125–15133. [Google Scholar] [CrossRef]
- Rout, D.; Dash, U.C.; Kanhar, S.; Swain, S.K.; Sahoo, A.K. The modulatory role of prime identified compounds in the bioactive fraction of Homalium zeylanicum in high-fat diet fed-streptozotocin-induced type 2 diabetic rats. J. Ethnopharmacol. 2020, 260, 113099. [Google Scholar] [CrossRef]
- Bhowmik, A.; Das, S.; Sarkar, W.; Saidalavi, K.; Mishra, A.; Roy, A.; Deb, I. Diastereoselective Spirocyclization via Intramo-lecular C (sp3)−H Bond Functionalization Triggered by Sequential [1,5]-Hydride Shift/Cyclization Process: Approach to Spiro-tetrahydroquinolines. Adv. Synth. Catal. 2021, 363, 826–832. [Google Scholar] [CrossRef]
- Schoepfer, J.; Fretz, H.; Chaudhuri, B.; Muller, L.; Seeber, E.; Meijer, L.; Lozach, O.; Vangrevelinghe, E.; Furet, P. Structure-based design and synthesis of 2-benzylidene-benzofuran-3-ones as flavopiridol mimics. J. Med. Chem. 2002, 45, 1741–1747. [Google Scholar] [CrossRef]
- Jo, G.-H.; Choi, I.-W.; Jeong, J.-W.; Kim, G.-Y.; Kim, J.; Suh, H.; Ryu, C.-H.; Kim, W.-J.; Choi, Y.H. Anti-inflammatory potential of newly synthesized 4-[(butylsulfinyl) methyl]-1, 2-benzenediol in lipopolysaccharide-stimulated BV2 microglia. Molecules 2014, 19, 16609–16623. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Clerici, F.; Gelmi, M.L.; Pellegrino, S.; Pocar, D. ChemInform Abstract: Chemistry of Biologically Active Isothiazoles. ChemInform 2009, 40. [Google Scholar] [CrossRef]
- Pein, H.; Ville, A.; Pace, S.; Temml, V.; Garscha, U.; Raasch, M.; Alsabil, K.; Viault, G.; Dinh, C.-P.; Guilet, D.; et al. Endogenous metabolites of vitamin E limit inflammation by targeting 5-lipoxygenase. Nat. Commun. 2018, 9, 1–17. [Google Scholar] [CrossRef] [Green Version]
- Quintanilla-Licea, R.; Vargas-Villarreal, J.; Verde-Star, M.J.; Rivas-Galindo, V.M.; Hernández, D.T. Antiprotozoal Activity Against Entamoeba histolytica of Flavonoids Isolated from Lippia graveolens Kunth. Molecules 2020, 25, 2464. [Google Scholar] [CrossRef]
- Zhang, X.; Blumenthal, R.M.; Cheng, X. A Role for N6-Methyladenine in DNA Damage Repair. Trends Biochem. Sci. 2020, 46, 175–183. [Google Scholar] [CrossRef] [PubMed]
- Buysse, A.M.; Yap, M.C.; Hunter, R.; Babcock, J.; Huang, X. Synthesis and biological activity of pyridazine amides, hydrazones and hydrazides. Pest Manag. Sci. 2017, 73, 782–795. [Google Scholar] [CrossRef]
- Mohammed, A.E.; Al-Qahtani, A.; Al-Mutairi, A.; Al-Shamri, B.; Aabed, K. Antibacterial and cytotoxic potential of biosyn-thesized silver nanoparticles by some plant extracts. Nanomaterials 2018, 8, 382. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hariharan, D.; Srinivasan, K.; Nehru, L. Synthesis and characterization of TiO2 nanoparticles using Cynodon dactylon leaf extract for antibacterial and anticancer (A549 Cell Lines) Activity. J. Nanomed. Res. 2017, 5, 1–5. [Google Scholar]
- Manrique, G.D.; Lajolo, F.M. FT-IR spectroscopy as a tool for measuring degree of methyl esterification in pectins isolated from ripening papaya fruit. Postharvest Biol. Technol. 2002, 25, 99–107. [Google Scholar] [CrossRef]
- Santhoshkumar, T.; Rahuman, A.A.; Jayaseelan, C.; Rajakumar, G.; Marimuthu, S.; Kirthi, A.V.; Velayutham, K.; Thomas, J.; Venkatesan, J.; Kim, S.-K. Green synthesis of titanium dioxide nanoparticles using Psidium guajava extract and its antibacterial and antioxidant properties. Asian Pac. J. Trop. Med. 2014, 7, 968–976. [Google Scholar] [CrossRef] [Green Version]
- Hudlikar, M.; Joglekar, S.; Dhaygude, M.; Kodam, K. Green synthesis of TiO2 nanoparticles by using aqueous extract of Jatropha curcas L. latex. Mater. Lett. 2012, 75, 196–199. [Google Scholar] [CrossRef]
- Venkatachalam, P.; Sangeetha, P.; Geetha, N.; Sahi, S.V. Phytofabrication of bioactive molecules encapsulated metallic silver nanoparticles from Cucumis sativus L. and its enhanced wound healing potential in rat model. J. Nanomed. 2015, 2015, 753193. [Google Scholar]
- Ravichandran, S.; Paluri, V.; Kumar, G.; Loganathan, K.; Venkata, B.R.K. A novel approach for the biosynthesis of silver oxide nanoparticles using aqueous leaf extract ofCallistemon lanceolatus(Myrtaceae) and their therapeutic potential. J. Exp. Nanosci. 2015, 11, 445–458. [Google Scholar] [CrossRef] [Green Version]
- Ramadan, A.R.; Yacoub, N.; Amin, H.; Ragai, J. The effect of phosphate anions on surface and acidic properties of TiO2 hydrolyzed from titanium ethoxide. Colloids Surf. A Physicochem. Eng. Asp. 2009, 352, 118–125. [Google Scholar] [CrossRef]
- Hair, M.; Tripp, C. Alkylchlorosilane reactions at the silica surface. Colloids Surf. A Physicochem. Eng. Asp. 1995, 105, 95–103. [Google Scholar] [CrossRef]
- Maurya, A.; Chauhan, P.; Mishra, A.; Pandey, A.K. Surface functionalization of TiO2 with plant extracts and their combined antimicrobial activities against E. faecalis and E. coli. J. Res. Updates Polym. 2012, 1, 43–51. [Google Scholar] [CrossRef]
- Sharma, M.; Behl, K.; Nigam, S.; Joshi, M. TiO2-GO nanocomposite for photocatalysis and environmental applications: A green synthesis approach. Vacuum 2018, 156, 434–439. [Google Scholar] [CrossRef]
- Phromma, S.; Wutikhun, T.; Kasamechonchung, P.; Eksangsri, T.; Sapcharoenkun, C. Effect of Calcination Temperature on Photocatalytic Activity of Synthesized TiO2 Nanoparticles via Wet Ball Milling Sol-Gel Method. Appl. Sci. 2020, 10, 993. [Google Scholar] [CrossRef] [Green Version]
- Yan, Y.; Shi, W.; Peng, W.; Lin, Y.; Zhang, C.; Li, L.; Sun, Y.; Ju, H.; Zhu, J.; Ma, W.; et al. Proton-free electron-trapping feature of titanium dioxide nanoparticles without the characteristic blue color. Commun. Chem. 2019, 2, 88. [Google Scholar] [CrossRef]
- Humayun, M.; Raziq, F.; Khan, A.; Luo, W. Modification strategies of TiO2 for potential applications in photocatalysis: A critical review. Green Chem. Lett. Rev. 2018, 11, 86–102. [Google Scholar] [CrossRef] [Green Version]
- Hanaor, D.A.H.; Sorrell, C.C. Review of the anatase to rutile phase transformation. J. Mater. Sci. 2010, 46, 855–874. [Google Scholar] [CrossRef] [Green Version]
- Muhammad, A.; Sirat, H.M. COX-2 inhibitors from stem bark of Bauhinia rufescens Lam. (Fabaceae). EXCLI J. 2013, 12, 824. [Google Scholar] [CrossRef] [PubMed]
- Guo, Y.; Pei, Y.; Li, K.; Cui, W.; Zhang, D. DNA N6-methyladenine modification in hypertension. Aging 2020, 12, 6276–6291. [Google Scholar] [CrossRef]
- Kanoujia, J.; Singh, M.; Singh, P.; Parashar, P.; Tripathi, C.B.; Arya, M.; Saraf, S.A. Genipin crosslinked soy-whey based bio-active material for atorvastatin loaded nanoparticles: Preparation, characterization and in vivo antihyperlipidemic study. RSC Adv. 2016, 6, 93275–93287. [Google Scholar] [CrossRef]
- Joyce, P.; Ulmefors, H.; Maghrebi, S.; Subramaniam, S.; Wignall, A.; Jõemetsa, S.; Höök, F.; Prestidge, C.A. Enhancing the Cellular Uptake and Antibacterial Activity of Rifampicin through Encapsulation in Mesoporous Silica Nanoparticles. Nanomaterials 2020, 10, 815. [Google Scholar] [CrossRef] [Green Version]
- Gao, L.; Hu, Y.; Hu, D.; Li, Y.; Yang, S.; Dong, X.; Alharbi, S.A.; Liu, H. Anti-obesity activity of gold nanoparticles synthesized from Salacia chinensis modulates the biochemical alterations in high-fat diet-induced obese rat model via AMPK signaling pathway. Arab. J. Chem. 2020, 13, 6589–6597. [Google Scholar] [CrossRef]
- Rayalam, S.; Della-Fera, M.A.; Baile, C.A. Phytochemicals and regulation of the adipocyte life cycle. J. Nutr. Biochem. 2008, 19, 717–726. [Google Scholar] [CrossRef] [PubMed]
- Zhang, G.; Sun, Q.; Liu, C. Influencing Factors of Thermogenic Adipose Tissue Activity. Front. Physiol. 2016, 7, 29. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brandão, B.B.; Poojari, A.; Rabiee, A. Thermogenic Fat: Development, Physiological Function, and Therapeutic Potential. Int. J. Mol. Sci. 2021, 22, 5906. [Google Scholar] [CrossRef] [PubMed]
- Kang, B.; Kim, C.Y.; Hwang, J.; Jo, K.; Kim, S.; Suh, H.J.; Choi, H.S. Punicalagin, a pomegranate-derived ellagitannin, sup-presses obesity and obesity-induced inflammatory responses via the Nrf2/Keap1 signaling pathway. Mol. Nutr. Food Res. 2019, 63, 1900574. [Google Scholar] [CrossRef] [PubMed]
- Choi, M.; Mukherjee, S.; Yun, J.W. Anthocyanin oligomers stimulate browning in 3T3-L1 white adipocytes via activation of the β3-adrenergic receptor and ERK signaling pathway. Phytotherapy Res. 2021, 35, 6281–6294. [Google Scholar] [CrossRef]
- Nakamura, K.; Fuster, J.J.; Walsh, K. Adipokines: A link between obesity and cardiovascular disease. J. Cardiol. 2013, 63, 250–259. [Google Scholar] [CrossRef] [Green Version]
- Katiyar, P.; Yadu, B.; Korram, J.; Satnami, M.L.; Kumar, M.; Keshavkant, S. Titanium nanoparticles attenuates arsenic toxicity by up-regulating expressions of defensive genes in Vigna radiata L. J. Environ. Sci. 2020, 92, 18–27. [Google Scholar] [CrossRef] [PubMed]
- Yagoub, A.A.; Alshammari, G.M.; Subash-Babu, P.; Mohammed, M.A.A.; Yahya, M.A.; Alhosain, A.I. Synthesis of Ziziphus spina-christi (Jujube) Root Methanol Extract Loaded Functionalized Silver Nanoparticle (ZS-Ag-NPs); Physiochemical Characterization and Effect of ZS-Ag-NPs on Adipocyte Maturation, Adipokine, and Vascular Smooth Muscle Cell Interaction. Nanomaterials 2021, 11, 2563. [Google Scholar]
- McCoy, M.K.; Cookson, M.R. DJ-1 regulation of mitochondrial function and autophagy through oxidative stress. Autophagy 2011, 7, 531–532. [Google Scholar] [CrossRef] [Green Version]
- Dinkova-Kostova, A.T.; Kostov, R.V.; Kazantsev, A.G. The role of Nrf2 signaling in counteracting neurodegenerative diseases. FEBS J. 2018, 285, 3576–3590. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Subash-Babu, P.; Al-Saran, N.; Alshammari, G.M.; Al-Harbi, L.N.; Alhussain, M.H.; Shamlan, G.; AlSedairy, S.A.; Alshatwi, A.A. Evaluation of Biosafety, Antiobesity, and Endothelial Cells Proliferation Potential of Basil Seed Extract Loaded Organic Solid Lipid Nanoparticle. Front. Pharmacol. 2021, 12, 722258. [Google Scholar] [CrossRef] [PubMed]
- Yuan, J.S.; Reed, A.; Chen, F.; Stewart, C.N., Jr. Statistical analysis of real-time PCR data. BMC Bioinform. 2006, 7, 85. [Google Scholar] [CrossRef] [Green Version]
- Shi, H.; Magaye, R.; Castranova, V.; Zhao, J. Titanium dioxide nanoparticles: A review of current toxicological data. Part. Fibre Toxicol. 2013, 10, 15–33. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sadrieh, N.; Wokovich, A.M.; Gopee, N.V.; Zheng, J.; Haines, D.; Parmiter, D.; Siitonen, P.H.; Cozart, C.R.; Patri, A.K.; McNeil, S.E. Lack of significant dermal penetration of titanium dioxide from sunscreen formulations containing nano-and submicron-size TiO2 particles. Toxicol. Sci. 2010, 115, 156–166. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tsyganova, N.A.; Khairullin, R.M.; Terentyuk, G.S.; Khlebtsov, B.; Bogatyrev, V.A.; Dykman, L.A.; Erykov, S.N.; Khlebtsov, N. Penetration of Pegylated Gold Nanoparticles Through Rat Placental Barrier. Bull. Exp. Biol. Med. 2014, 157, 383–385. [Google Scholar] [CrossRef] [PubMed]
- Song, B.; Liu, J.; Feng, X.; Wei, L.; Shao, L. A review on potential neurotoxicity of titanium dioxide nanoparticles. Nanoscale Res. Lett. 2015, 10, 1–17. [Google Scholar] [CrossRef] [Green Version]
No | RT (min) | Peak Area (%) | Compound Name | Molecular Formula | Molecular Weight (g/mol) | Compound Nature | Bioactivity |
---|---|---|---|---|---|---|---|
1 | 18.05 | 7.58 | 2,4,6-Cycloheptatrien-1-one (Tropone) | C7H6O | 106.12 | Cyclic aliphatic ketone | Antibacterial, antifungal, insecticidal, antimalarial, antitumor, anti-ischemic, iron chelating, and inhibitory activity against polyphenol oxidase activity [18,19]. |
2-Coumaranone | C8H6O2 | 134.13 | Benzofurn ketone | Spirocyclic 2-Coumaranone derivatives have pharmacological activities against different biological targets [21,22]. | |||
2 | 23.99 | 53.10 | Tridecanoic acid, 4,8,12-trimethyl-, methyl ester | C17H34O2 | 270.5 | Aliphatic ester | Derivatives have immune-regulatory and anti-inflammatory functions [20,25]. |
(Methylthio)-acetonitrile | C3H5NS | 87.15 | Thionitriles | Not reported. | |||
3 | 25.69 | 24.85 | 1H-Purin-6-amine, N-methyl-(N6-Methyladenine) | C6H7N5 | 149.15 | Purine | Antiprotozoal agents. DNA damage repair agents [26,27]. |
3-Methylpyridazine | C5H6N2 | 94.11 | Heterocyclic organic compound | Derivatives have antimicrobial, anticancer, and anti-inflammatory activities [16,17,28]. | |||
4 | 34.86 | 3.98 | 9-Octadecenoic acid (Z)-, methyl ester (Methyl Oleate) | C19H36O2 | 296.50 | Fatty acid ester | Not reported. |
9-Octadecenoic acid, methyl ester, (E)-(Methyl eliadate) | C19H36O2 | 296.50 | Fatty acid ester | Not reported. | |||
5 | 43.54 | 4.30 | 1,2-Benzisothiazol-3-amine tbdms | C13H20N2 SSi | 264.46 | Heterocyclic compound | Derivatives have antimicrobial, antiproliferative, and anti-inflammatory activities [24]. |
6 | 52.52 | 6.19 | 1,2-Benzenediol, 3,5-bis(1,1-dimethylethyl)- | C14H22O2 | 222.32 | Phenols | Anti-inflammatory effects [23]. |
Primer | Forward Sequence (5′ to 3′) | Reverse Sequence (5′ to 3′) |
---|---|---|
LPO | CTGCCCTATGACAGCAAGAAGC | CGGTTATGCTCGCGGAGAAAGA |
GPX-1 | GTGCTCGGCTTCCCGTGCAAC | CTCGAAGAGCATGAAGTTGGGC |
GSS | GGAACTCCAACAAGGGAGCA | TTCGGGGTCGGAAGACCTT |
TNF-α | CTCTTCTGCCTGCTGCACTTTG | ATGGGCTACAGGCTTGTCACTC |
IL-1β | CCACAGACCTTCCAGGAGAATG | GTGCAGTTCAGTGATCGTACAGG |
NF-κb | GCGCTTCTCTGCCTTCCTTA | TCTTCAGGTTTGATGCCCCC |
C/EBPα | CCGGGAGAACTCTAACTC | GATGTAGGCGCTGATGT |
PPARγ | TCATAATGCCATCAGGTTTG | CTGGTCGATATCACTGGAG |
LPL | AGGACCCCTGAAGACAG | GGCACCCAACTCTCATA |
HSL | CCTCATGGCTCAACTCC | GGTTCTTGACTATGGGTGA |
Adiponectin-R1 | CTACTGTTGCAAGCTCTC C | CTTCACATCTTTCATGTACACC |
PPARγC1α | CCCTGCCATTGTTAAGACC | TGCTGCTGTTCCTGTTTTC |
UCP-1 | AGGCTTCCAGTACCATTAGGT | CTGAGTGAGGCAAAGCTGATTT |
PRDM16 | CCCCACATTCCGCTGTGA | CTCGCAATCCTTGCACTCA |
NRF-2 | CACATCCAGTCAGAAACCAGTGG | GGAATGTCTGCGCCAAAAGCTG |
IL-6 | AGACAGCCACTCACCTCTTCAG | TTCTGCCAGTGCCTCTTTGCTG |
LTB4-R | CCTGTGTCACTATGTCTGCGGA | ATCGCCTTGGTGCGTAGCTTCT |
β-Actin | GATCTTGATCTTCATGGTGCTAGG | TTGTAACCAACTGGGACCATATGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Alshammari, G.M.; Yagoub, A.E.A.; Subash-Babu, P.; Hassan, A.B.; Al-Nouri, D.M.; Mohammed, M.A.; Yahya, M.A.; Elsayim, R. Inhibition of Lipid Accumulation and Adipokine Levels in Maturing Adipocytes by Bauhinia rufescens (Lam.) Stem Bark Extract Loaded Titanium Oxide Nanoparticles. Molecules 2021, 26, 7238. https://doi.org/10.3390/molecules26237238
Alshammari GM, Yagoub AEA, Subash-Babu P, Hassan AB, Al-Nouri DM, Mohammed MA, Yahya MA, Elsayim R. Inhibition of Lipid Accumulation and Adipokine Levels in Maturing Adipocytes by Bauhinia rufescens (Lam.) Stem Bark Extract Loaded Titanium Oxide Nanoparticles. Molecules. 2021; 26(23):7238. https://doi.org/10.3390/molecules26237238
Chicago/Turabian StyleAlshammari, Ghedeir M., Abu ElGasim A. Yagoub, Pandurangan Subash-Babu, Amro B. Hassan, Doha M. Al-Nouri, Mohammed A. Mohammed, Mohammed A. Yahya, and Rasha Elsayim. 2021. "Inhibition of Lipid Accumulation and Adipokine Levels in Maturing Adipocytes by Bauhinia rufescens (Lam.) Stem Bark Extract Loaded Titanium Oxide Nanoparticles" Molecules 26, no. 23: 7238. https://doi.org/10.3390/molecules26237238
APA StyleAlshammari, G. M., Yagoub, A. E. A., Subash-Babu, P., Hassan, A. B., Al-Nouri, D. M., Mohammed, M. A., Yahya, M. A., & Elsayim, R. (2021). Inhibition of Lipid Accumulation and Adipokine Levels in Maturing Adipocytes by Bauhinia rufescens (Lam.) Stem Bark Extract Loaded Titanium Oxide Nanoparticles. Molecules, 26(23), 7238. https://doi.org/10.3390/molecules26237238